Variant

Variant ID Consequence Effect Gene AC AN AF NS NHOM maxEAF
16-5083971-G-A c.-1090G>A 5_prime_UTR_premature_start_codon_gain ALG1 2 74384 2.68875E-5 37192 0 NA
16-5083982-C-G c.-1079C>G 5_prime_UTR_premature_start_codon_gain ALG1 2 72340 2.76472E-5 36170 0 NA
16-5083991-C-T c.-1070C>T 5_prime_UTR_premature_start_codon_gain ALG1 226 69904 0.00323301 34952 0 0.00943697
16-5084032-G-T c.-1029G>T 5_prime_UTR_premature_start_codon_gain ALG1 1 53724 1.86137E-5 26862 0 NA
16-5084070-C-G c.-999+8C>G splice_region ALG1 3 39286 7.63631E-5 19643 0 NA
16-5121828-G-A c.-23G>A 5_prime_UTR_premature_start_codon_gain ALG1 1 71726 1.39419E-5 35863 0 1.29569E-5
16-5121853-G-A p.Met1? start_lost ALG1 2 72968 2.74093E-5 36484 0 NA
16-5121855-C-T p.Ala2Val missense ALG1 1 72780 1.374E-5 36390 0 1.2935E-5
16-5121858-C-A p.Ala3Asp missense ALG1 16 72896 2.19491E-4 36448 0 0.00188206
16-5121858-C-G p.Ala3Gly missense ALG1 1 72896 1.37182E-5 36448 0 NA
16-5121859-C-T p.Ala3Ala synonymous ALG1 1 73042 1.36908E-5 36521 0 4.2938E-6
16-5121860-T-G p.Ser4Ala missense ALG1 1 73050 1.36893E-5 36525 0 NA
16-5121863-T-G p.Cys5Gly missense ALG1 1 73266 1.36489E-5 36633 0 8.63371E-6
16-5121864-G-T p.Cys5Phe missense ALG1 2 73236 2.7309E-5 36618 0 2.36451E-5
16-5121864-G-A p.Cys5Tyr missense ALG1 1 73236 1.36545E-5 36618 0 NA
16-5121864-G-C p.Cys5Ser missense ALG1 1 73236 1.36545E-5 36618 0 1.18226E-5
16-5121865-C-T p.Cys5Cys synonymous ALG1 5 73250 6.82594E-5 36625 0 2.58891E-5
16-5121869-G-C p.Val7Leu missense ALG1 1 73254 1.36511E-5 36627 0 1.19821E-5
16-5121869-G-A p.Val7Ile missense ALG1 15 73254 2.04767E-4 36627 1 0.00313283
16-5121870-T-G p.Val7Gly missense ALG1 4 73246 5.46105E-5 36623 0 9.07755E-5
16-5121871-C-T p.Val7Val synonymous ALG1 33 73362 4.49824E-4 36681 0 9.5584E-4
16-5121871-C-CCTGCTGGCGCTGTGTCTG p.Ala10_Leu15dup conservative_inframe_insertion ALG1 4 73364 5.45227E-5 36682 0 9.5584E-5
16-5121872-C-T p.Leu8Leu synonymous ALG1 17 73398 2.31614E-4 36699 0 0.00176367
16-5121875-C-T p.Leu9Leu synonymous ALG1 3 73330 4.09109E-5 36665 0 5.21376E-4
16-5121875-C-G p.Leu9Val missense ALG1 2 73330 2.7274E-5 36665 0 1.25606E-5
16-5121877-G-C p.Leu9Leu synonymous ALG1 1 73344 1.36344E-5 36672 0 NA
16-5121877-G-T p.Leu9Leu synonymous ALG1 1 73344 1.36344E-5 36672 0 2.54323E-5
16-5121878-G-GCGCTGTGTCTGCTGCTGC p.Cys12_Leu17dup conservative_inframe_insertion ALG1 2 73166 2.73351E-5 36583 0 6.37024E-5
16-5121878-G-C p.Ala10Pro missense ALG1 3 73168 4.10015E-5 36584 0 NA
16-5121879-C-T p.Ala10Val missense ALG1 3 73144 4.1015E-5 36572 0 3.18573E-5
16-5121880-G-A p.Ala10Ala synonymous ALG1 1 73186 1.36638E-5 36593 0 NA
16-5121880-G-C p.Ala10Ala synonymous ALG1 1 73186 1.36638E-5 36593 0 8.8896E-6
16-5121881-C-T p.Leu11Leu synonymous ALG1 7 73290 9.5511E-5 36645 0 1.35051E-5
16-5121886-T-C p.Cys12Cys synonymous ALG1 4 73392 5.45019E-5 36696 0 1.52355E-4
16-5121887-C-T p.Leu13Leu synonymous ALG1 1 73420 1.36203E-5 36710 0 1.42013E-5
16-5121887-C-G p.Leu13Val missense ALG1 1 73420 1.36203E-5 36710 0 6.27105E-5
16-5121889-G-A p.Leu13Leu synonymous ALG1 1 73398 1.36243E-5 36699 0 3.05979E-5
16-5121889-G-C p.Leu13Leu synonymous ALG1 1 73398 1.36243E-5 36699 0 9.23574E-6
16-5121894-T-TGCC p.Pro16dup disruptive_inframe_insertion ALG1 1 73368 1.36299E-5 36684 0 NA
16-5121896-C-T p.Pro16Ser missense ALG1 2 73352 2.72658E-5 36676 0 2.97805E-5
16-5121897-CGCT-C p.Leu20del conservative_inframe_deletion ALG1 2 73348 2.72673E-5 36674 0 2.77287E-5
16-5121897-C-G p.Pro16Arg missense ALG1 1 73366 1.36303E-5 36683 0 NA
16-5121900-T-TGCTGCC p.Leu18_Leu19insProLeu disruptive_inframe_insertion ALG1 2 73432 2.72361E-5 36716 0 NA
16-5121904-G-A p.Leu18Leu synonymous ALG1 2 73460 2.72257E-5 36730 0 9.30596E-6
16-5121910-G-A p.Leu20Leu synonymous ALG1 11 73524 1.49611E-4 36762 0 2.86716E-4
16-5121912-G-A p.Gly21Glu missense ALG1 1 73560 1.35943E-5 36780 0 3.36338E-5
16-5121922-G-A p.Lys24Lys synonymous ALG1 1 73164 1.36679E-5 36582 0 5.22466E-4
16-5121924-G-C p.Arg25Pro missense ALG1 2 72952 2.74153E-5 36476 0 NA
16-5121931-C-G p.Arg27Arg synonymous ALG1 1 72774 1.37412E-5 36387 0 4.97646E-6
16-5121945-C-A p.Ala32Asp missense ALG1 4 72510 5.51648E-5 36255 0 1.59327E-4
16-5121960-C-T p.Ala37Val missense ALG1 2 73130 2.73486E-5 36565 0 NA
16-5121963-TG-T p.Val39fs frameshift ALG1 1 73106 1.36788E-5 36553 0 NA
16-5121971-G-A p.Gly41Ser missense ALG1 2 73582 2.71806E-5 36791 0 4.91367E-6
16-5121976-C-T p.Asp42Asp synonymous ALG1 1 73502 1.36051E-5 36751 0 3.19081E-5
16-5121992-C-T p.Arg48Cys missense ALG1 1 74306 1.34579E-5 37153 0 NA
16-5121994-T-C p.Arg48Arg synonymous ALG1 1 74408 1.34394E-5 37204 0 4.63143E-6
16-5121999-A-G p.Gln50Arg missense ALG1 1 74678 1.33908E-5 37339 0 4.62402E-6
16-5122000-G-A p.Gln50Gln synonymous ALG1 3 74694 4.01639E-5 37347 0 1.86274E-4
16-5122016-T-A p.Leu56Met missense ALG1 1 74866 1.33572E-5 37433 0 NA
16-5122026-A-G p.His59Arg missense ALG1 5 74646 6.69828E-5 37323 0 9.57854E-5
16-5122027-C-T p.His59His synonymous ALG1 3 74584 4.02231E-5 37292 0 2.1065E-5
16-5122029-G-T p.Gly60Val missense ALG1 1 74504 1.34221E-5 37252 0 NA
16-5122034-T-C p.Ser62Pro missense ALG1 1 74304 1.34582E-5 37152 0 NA
16-5122036-G-T p.Ser62Ser synonymous ALG1 2 74230 2.69433E-5 37115 0 8.66814E-5
16-5122041-C-A p.Thr64Asn missense ALG1 237 74064 0.00319994 37032 1 0.00347595
16-5122045-C-T p.Leu65Leu synonymous ALG1 1 73920 1.35281E-5 36960 0 4.65484E-5
16-5122054-C-T p.Phe68Phe synonymous ALG1 1 73098 1.36803E-5 36549 0 0.0010582
16-5122058-A-AACTCCAAACCCCATGATGAGCTCTTGCAGAACAACAGAATTCAGATT p.Ser70fs frameshift ALG1 1 72702 1.37548E-5 36351 0 NA
16-5122059-G-A c.208+1G>A splice_donor ALG1 2 72618 2.75414E-5 36309 0 NA
16-5122068-C-CA p.Arg74fs frameshift ALG1 1 71524 1.39813E-5 35762 0 4.87187E-5
16-5122070-A-AC p.Arg74fs frameshift ALG1 1 71136 1.40576E-5 35568 0 NA
16-5122071-G-GGGTC p.Trp76fs frameshift ALG1 1 70970 1.40905E-5 35485 0 5.03069E-5
16-5122071-G-A p.Arg74Lys missense ALG1 1 70970 1.40905E-5 35485 0 9.28574E-6
16-5122072-G-GGTCT p.Trp76fs frameshift ALG1 37647 70118 0.536909 35059 10237 0.604134
16-5122072-G-GTCT p.Arg74_Val75insSer conservative_inframe_insertion ALG1 2 70710 2.82845E-5 35355 0 3.22706E-5
16-5122077-G-GTCT p.Trp76delinsCysLeu disruptive_inframe_insertion ALG1 1 69890 1.43082E-5 34945 0 4.48431E-5
16-5122077-G-T p.Trp76Leu missense ALG1 1 69894 1.43074E-5 34947 0 NA
16-5122078-G-GC p.Glu77fs frameshift ALG1 1 68350 1.46306E-5 34175 0 NA
16-5122081-G-A p.Glu77Glu synonymous ALG1 8 68072 1.17523E-4 34036 1 0.00125
16-5122086-G-T p.Arg79Leu missense ALG1 1 67036 1.49174E-5 33518 0 6.63773E-6
16-5122087-A-G p.Arg79Arg synonymous ALG1 1 66766 1.49777E-5 33383 0 NA
16-5122088-T-C p.Cys80Arg missense ALG1 1 66746 1.49822E-5 33373 0 NA
16-5122088-TGCTCTCTCA-T p.Ser81_Ser83del conservative_inframe_deletion ALG1 1 66746 1.49822E-5 33373 0 NA
16-5122100-C-T p.Arg84Cys missense ALG1 2 63148 3.16716E-5 31574 0 2.74326E-5
16-5122101-G-A p.Arg84His missense ALG1 1 63042 1.58624E-5 31521 0 NA
16-5122290-C-G c.-140C>G 5_prime_UTR_premature_start_codon_gain ALG1 1 31654 3.15916E-5 15827 0 NA
16-5122298-TCTC-T c.-129_-127delCCT splice_region ALG1 1 31504 3.1742E-5 15752 0 NA
16-5122948-T-A c.209-4T>A splice_region ALG1 1 83302 1.20045E-5 41651 0 3.97624E-6
16-5122953-C-G p.Asn70Lys missense+splice_region ALG1 2 83334 2.39998E-5 41667 0 NA
16-5122955-C-T p.Ser71Phe missense ALG1 7 83342 8.39913E-5 41671 0 1.03381E-4
16-5122955-C-G p.Ser71Cys missense ALG1 1 83342 1.19988E-5 41671 0 3.97621E-6
16-5122958-A-C p.Lys72Thr missense ALG1 1 83344 1.19985E-5 41672 0 NA
16-5122962-C-G p.Pro73Pro synonymous ALG1 4 83344 4.79939E-5 41672 0 2.47097E-5
16-5122964-A-T p.His74Leu missense ALG1 6 83354 7.19821E-5 41677 0 1.03382E-4
16-5122971-G-A p.Glu76Glu synonymous ALG1 1 83362 1.19959E-5 41681 0 NA
16-5122978-C-A p.Gln79Lys missense ALG1 1 83360 1.19962E-5 41680 0 NA
16-5122980-GAAC-G p.Asn81del disruptive_inframe_deletion ALG1 1 83360 1.19962E-5 41680 0 6.36821E-5
16-5122983-C-T p.Asn80Asn synonymous ALG1 1 83360 1.19962E-5 41680 0 NA
16-5123001-G-A p.Val86Val synonymous ALG1 1 83400 1.19904E-5 41700 0 8.23669E-6
16-5123002-G-C p.Gly87Arg missense ALG1 3 83402 3.59704E-5 41701 0 6.36208E-5
16-5123010-A-G p.Thr89Thr synonymous ALG1 1 83398 1.19907E-5 41699 0 1.64731E-5
16-5123022-TCTTGCAGGTAGGATGCCGTCAACTCCAGAATCCTCTGAATCCATGGGCTGGGGGCAGGGGGTGTTCGTTTGAAAAGCCGTGCAGATTGCCAGACGCTCCTTTGGTAGTCACAGGTGTTTTCTGA-T p.Ala95fs frameshift ALG1 7 83392 8.39409E-5 41696 1 NA
16-5123027-C-T p.Ala95Val missense+splice_region ALG1 3 83376 3.59816E-5 41688 0 9.55475E-5
16-5123032-A-G c.286+3A>G splice_region ALG1 1 83358 1.19964E-5 41679 0 6.37064E-5
16-5123037-G-A c.286+8G>A splice_region ALG1 1 83354 1.1997E-5 41677 0 3.97633E-6
16-5123037-G-T c.286+8G>T splice_region ALG1 1 83354 1.1997E-5 41677 0 1.64742E-5
16-5123160-C-T p.Pro98Leu missense ALG1 1 83402 1.19901E-5 41701 0 NA
16-5123161-C-T p.Pro98Pro synonymous ALG1 2 83396 2.3982E-5 41698 0 NA
16-5123162-C-T p.Arg99* stop_gained ALG1 2 83396 2.3982E-5 41698 0 3.18593E-5
16-5123171-C-T p.Gln102* stop_gained ALG1 3 83406 3.59686E-5 41703 0 3.18593E-5
16-5123173-G-T p.Gln102His missense ALG1 1 83410 1.1989E-5 41705 0 NA
16-5123176-C-T c.-25C>T 5_prime_UTR_premature_start_codon_gain ALG1 3 83408 3.59678E-5 41704 0 1.4004E-4
16-5123177-G-A p.Gly104Arg missense ALG1 1 83404 1.19898E-5 41702 0 3.97636E-6
16-5123179-A-C p.Gly104Gly synonymous ALG1 3 83404 3.59695E-5 41702 0 1.6475E-5
16-5123180-G-T p.Val105Phe missense ALG1 2 83400 2.39808E-5 41700 0 NA
16-5123201-A-C p.Met112Leu missense ALG1 530 83396 0.00635522 41698 6 0.0119806
16-5123202-T-C p.Met1? start_lost ALG1 2 83398 2.39814E-5 41699 0 3.18492E-5
16-5123224-G-C p.Met119Ile missense ALG1 1 83374 1.19941E-5 41687 0 NA
16-5123228-A-C p.Arg121Arg synonymous ALG1 2 83368 2.399E-5 41684 0 2.22916E-4
16-5123251-T-C p.Phe128Phe synonymous ALG1 6 83274 7.20513E-5 41637 0 1.73262E-4
16-5123264-A-G c.390+7A>G splice_region ALG1 2 83200 2.40385E-5 41600 0 NA
16-5125385-C-G c.391-4C>G splice_region ALG1 1 83348 1.19979E-5 41674 0 NA
16-5125390-A-AC p.Gly134fs frameshift ALG1 1 83364 1.19956E-5 41682 0 NA
16-5125394-C-T c.391-5C>T splice_region ALG1 1 83370 1.19947E-5 41685 0 1.19299E-5
16-5125396-C-G p.Pro133Arg missense ALG1 1 83372 1.19944E-5 41686 0 3.97678E-6
16-5125397-A-AG p.Leu135fs frameshift ALG1 1 83376 1.19939E-5 41688 0 NA
16-5125397-A-C c.391-2A>C splice_acceptor ALG1 4 83376 4.79754E-5 41688 0 3.18613E-5
16-5125399-G-C p.Val131Leu missense+splice_region ALG1 1 83376 1.19939E-5 41688 0 1.64731E-5
16-5125408-G-C p.Ser137Thr missense ALG1 2 83384 2.39854E-5 41692 0 NA
16-5125427-C-T p.Ser140Leu missense ALG1 2 83396 2.3982E-5 41698 0 8.23642E-6
16-5125428-G-A p.Val144Met missense ALG1 5 83394 5.99564E-5 41697 0 2.47093E-5
16-5125429-T-A p.Val144Glu missense ALG1 1 83398 1.19907E-5 41699 0 NA
16-5125453-T-C p.Leu152Pro missense ALG1 1 83398 1.19907E-5 41699 0 NA
16-5125455-G-A p.Val153Ile missense ALG1 2 83396 2.3982E-5 41698 0 3.18512E-5
16-5125464-TG-T p.Trp156fs frameshift ALG1 1 83390 1.19918E-5 41695 0 3.97627E-6
16-5125464-T-C p.Trp156Arg missense ALG1 2 83390 2.39837E-5 41695 0 NA
16-5125465-G-A p.Trp156* stop_gained ALG1 1 83392 1.19916E-5 41696 0 NA
16-5125465-G-T p.Trp156Leu missense ALG1 2 83392 2.39831E-5 41696 0 3.97624E-6
16-5125467-C-T p.His157Tyr missense ALG1 1 83386 1.19924E-5 41693 0 3.9763E-6
16-5125469-C-A p.His157Gln missense ALG1 1 83392 1.19916E-5 41696 0 NA
16-5125475-T-C p.Met156Thr missense ALG1 7 83392 8.39409E-5 41696 0 6.58913E-5
16-5125478-C-T p.Ala157Val missense ALG1 6 83388 7.19528E-5 41694 0 3.50385E-4
16-5125481-C-T p.Thr158Ile missense ALG1 2 83388 2.39843E-5 41694 0 8.32071E-6
16-5125492-G-C p.Gly165Ala missense ALG1 1 83388 1.19921E-5 41694 0 5.76559E-5
16-5125505-C-T p.Ala166Val missense ALG1 1 83386 1.19924E-5 41693 0 NA
16-5125508-C-CA p.Asn171fs frameshift ALG1 1 83390 1.19918E-5 41695 0 NA
16-5125512-C-A p.His172Asn missense ALG1 1 83388 1.19921E-5 41694 0 8.2371E-6
16-5125512-C-T p.His172Tyr missense ALG1 1 83388 1.19921E-5 41694 0 8.2371E-6
16-5125515-C-T p.Pro173Ser missense ALG1 3 83386 3.59773E-5 41693 0 3.29484E-5
16-5125524-C-T p.Leu176Leu synonymous ALG1 2 83372 2.39889E-5 41686 0 2.47129E-5
16-5125532-C-T p.Pro175Leu missense ALG1 3 83354 3.59911E-5 41677 0 5.03525E-4
16-5125538-G-A c.539+1G>A splice_donor ALG1 3 83348 3.59937E-5 41674 0 3.18552E-5
16-5125540-G-C c.539+3G>C splice_region ALG1 2 83330 2.4001E-5 41665 0 9.55536E-5
16-5127439-T-G c.540-7T>G splice_region ALG1 1 82926 1.20589E-5 41463 0 3.18471E-5
16-5127449-C-T p.Thr178Met missense ALG1 1 83042 1.20421E-5 41521 0 1.64764E-5
16-5127450-G-A p.Glu182Lys missense ALG1 2 83060 2.4079E-5 41530 0 1.19313E-5
16-5127460-T-G p.Phe185Cys missense ALG1 551 83128 0.00662833 41564 6 0.0129676
16-5127462-G-A p.Gly186Arg missense ALG1 2 83148 2.40535E-5 41574 0 NA
16-5127472-C-G p.Ser189Cys missense ALG1 1 83192 1.20204E-5 41596 0 NA
16-5127481-A-G p.Asn192Ser missense ALG1 4 83216 4.80677E-5 41608 0 2.47121E-5
16-5127484-T-C p.Leu193Pro missense ALG1 1 83230 1.20149E-5 41615 0 8.23737E-6
16-5127485-G-A p.Leu193Leu synonymous ALG1 3 83232 3.60438E-5 41616 0 2.78357E-5
16-5127486-T-C p.Cys194Arg missense ALG1 1 83232 1.20146E-5 41616 0 NA
16-5127496-A-G p.Asn197Ser missense ALG1 2 83258 2.40217E-5 41629 0 8.23723E-6
16-5127505-G-A p.Arg200Gln missense ALG1 3 83242 3.60395E-5 41621 0 2.47121E-5
16-5127506-A-AGAAGACCTGGCGG p.Asp205fs frameshift ALG1 1 83246 1.20126E-5 41623 0 NA
16-5127507-G-C p.Glu201Gln missense ALG1 1 83246 1.20126E-5 41623 0 8.23764E-5
16-5127508-A-C p.Glu201Ala missense ALG1 1 83234 1.20143E-5 41617 0 5.56687E-5
16-5127514-T-C p.Leu203Pro missense ALG1 1 83198 1.20195E-5 41599 0 2.47125E-5
16-5127517-C-T p.Ala204Val missense ALG1 3 83168 3.60716E-5 41584 0 9.06185E-5
16-5127517-C-A p.Ala204Glu missense ALG1 1 83168 1.20239E-5 41584 0 3.29522E-5
16-5127518-G-A p.Ala204Ala synonymous ALG1 4 83158 4.81012E-5 41579 0 1.64758E-5
16-5127527-G-C p.Trp207Cys missense ALG1 2 83112 2.40639E-5 41556 0 NA
16-5127527-G-A p.Trp207* stop_gained ALG1 1 83112 1.2032E-5 41556 0 NA
16-5127539-C-T c.629+4C>T splice_region ALG1 2 82964 2.41068E-5 41482 0 3.9775E-6
16-5127542-T-C c.629+7T>C splice_region ALG1 1 82904 1.20621E-5 41452 0 1.64829E-5
16-5127917-C-T p.Thr213Thr synonymous ALG1 4 81034 4.9362E-5 40517 0 9.55414E-5
16-5127918-G-A p.Val214Ile missense ALG1 2 81042 2.46786E-5 40521 0 NA
16-5127920-C-G p.Val214Val synonymous ALG1 1 81052 1.23378E-5 40526 0 NA
16-5127923-C-T p.Tyr215Tyr synonymous ALG1 1 81050 1.23381E-5 40525 0 3.63651E-5
16-5127924-G-A p.Asp216Asn missense ALG1 3 81046 3.7016E-5 40523 0 8.39588E-6
16-5127926-C-T p.Asp216Asp synonymous ALG1 2 81066 2.46713E-5 40533 0 6.36983E-5
16-5127930-C-T p.Pro218Ser missense ALG1 2 81072 2.46694E-5 40536 0 9.23454E-5
16-5127932-C-T p.Pro218Pro synonymous ALG1 4 81070 4.93401E-5 40535 0 6.37186E-5
16-5127960-G-T p.Asp228Tyr missense ALG1 11 81064 1.35695E-4 40532 0 0.00728477
16-5127961-A-G p.Asp228Gly missense ALG1 2 81062 2.46725E-5 40531 0 3.18735E-5
16-5127966-C-T p.Gln230* stop_gained ALG1 1 81044 1.2339E-5 40522 0 NA
16-5127972-C-T p.Arg232Trp missense ALG1 21 81046 2.59112E-4 40523 0 1.88826E-4
16-5127973-G-A p.Arg232Gln missense ALG1 4 81032 4.93632E-5 40516 0 1.23359E-5
16-5127980-C-T p.Phe234Phe synonymous ALG1 1 81018 1.23429E-5 40509 0 NA
16-5127985-A-C p.Lys236Thr missense ALG1 1 80984 1.23481E-5 40492 0 NA
16-5127993-A-C p.Ser239Arg missense ALG1 1 80930 1.23564E-5 40465 0 6.37024E-5
16-5128001-C-T p.His241His synonymous ALG1 5322 80722 0.06593 40361 205 0.0707816
16-5128001-C-G p.His241Gln missense ALG1 1 80880 1.2364E-5 40440 0 1.66643E-5
16-5128006-C-T p.Pro243Leu missense ALG1 4 80838 4.94817E-5 40419 0 6.37024E-5
16-5128007-G-A p.Pro243Pro synonymous ALG1 1 80814 1.23741E-5 40407 0 NA
16-5128007-G-T p.Pro243Pro synonymous ALG1 1 80814 1.23741E-5 40407 0 6.84428E-5
16-5128017-C-T p.Arg247Cys missense+splice_region ALG1 8 80644 9.92014E-5 40322 0 0.00131926
16-5128018-G-GCTCAGAACCTGAGGACCCAGTCACGGAGC c.740_740+1insCTCAGAACCTGAGGACCCAGTCACGGAGC splice_donor ALG1 2 80614 2.48096E-5 40307 1 NA
16-5128021-A-G c.740+3A>G splice_region ALG1 1 80544 1.24156E-5 40272 0 NA
16-5128773-C-T p.Asp252Asp synonymous ALG1 3 81452 3.68315E-5 40726 0 1.67729E-5
16-5128773-C-G p.Asp252Glu missense ALG1 2 81452 2.45543E-5 40726 0 6.37389E-5
16-5128774-C-T p.Pro253Ser missense ALG1 2 81448 2.45555E-5 40724 0 NA
16-5128781-C-T p.Thr255Met missense ALG1 1 81472 1.22742E-5 40736 0 5.03389E-5
16-5128781-C-G p.Thr255Arg missense ALG1 1 81472 1.22742E-5 40736 0 NA
16-5128782-G-A p.Thr255Thr synonymous ALG1 1 81468 1.22748E-5 40734 0 1.67729E-5
16-5128783-G-A p.Glu256Lys missense ALG1 46 81486 5.64514E-4 40743 0 7.64916E-4
16-5128786-C-T p.Arg257Trp missense ALG1 11 81466 1.35026E-4 40733 0 1.91302E-4
16-5128787-G-A p.Arg257Gln missense ALG1 2 81462 2.45513E-5 40731 0 6.37796E-5
16-5128788-G-C p.Arg257Arg synonymous ALG1 1 81474 1.22739E-5 40737 0 NA
16-5128790-C-T p.Ser258Leu missense ALG1 36 81476 4.41848E-4 40738 0 3.50631E-4
16-5128791-G-A p.Ser258Ser synonymous ALG1 3 81460 3.68279E-5 40730 0 5.8548E-4
16-5128791-G-C p.Ser258Ser synonymous ALG1 5 81460 6.13798E-5 40730 0 7.54869E-5
16-5128793-C-A p.Ala259Asp missense ALG1 1 81454 1.22769E-5 40727 0 3.9993E-6
16-5128798-A-T p.Thr261Ser missense ALG1 2 81440 2.4558E-5 40720 0 4.19526E-5
16-5128799-C-T p.Thr261Met missense ALG1 2 81446 2.45561E-5 40723 0 2.36004E-4
16-5128800-G-A p.Thr261Thr synonymous ALG1 2 81462 2.45513E-5 40731 0 2.00006E-5
16-5128804-C-T p.Arg263Trp missense ALG1 25 81416 3.07065E-4 40708 0 7.00949E-4
16-5128808-A-G p.Asp264Gly missense ALG1 1 81426 1.22811E-5 40713 0 NA
16-5128810-G-T p.Ala265Ser missense ALG1 2 81426 2.45622E-5 40713 0 6.37105E-5
16-5128817-G-A p.Ser267Asn missense ALG1 6095 81196 0.0750653 40598 310 0.098566
16-5128818-C-T p.Ser267Ser synonymous ALG1 20 81326 2.45924E-4 40663 0 9.55718E-5
16-5128819-G-A p.Gly268Arg missense ALG1 8 81350 9.83405E-5 40675 0 1.27421E-4
16-5128824-GGTGACGCGTCTCCGTGAGCGGCCA-G p.Val270_Pro277del disruptive_inframe_deletion ALG1 1 81302 1.22998E-5 40651 0 3.18573E-5
16-5128829-C-T p.Thr271Met missense ALG1 5 81204 6.15733E-5 40602 0 6.37267E-5
16-5128831-C-T p.Arg272Cys missense ALG1 8 81172 9.85561E-5 40586 0 9.56267E-5
16-5128832-G-A p.Arg272His missense ALG1 5 81146 6.16173E-5 40573 0 3.18715E-5
16-5128834-C-G p.Leu273Val missense ALG1 3 81126 3.69795E-5 40563 0 1.69797E-5
16-5128836-C-T p.Leu273Leu synonymous ALG1 1 81088 1.23323E-5 40544 0 NA
16-5128837-C-T p.Arg274Cys missense ALG1 2 81048 2.46767E-5 40524 0 6.28931E-4
16-5128838-G-A p.Arg274His missense ALG1 14 81030 1.72776E-4 40515 1 0.00233918
16-5128840-G-A p.Glu275Lys missense ALG1 1 81020 1.23426E-5 40510 0 NA
16-5128842-G-C p.Glu275Asp missense ALG1 3 80948 3.70608E-5 40474 0 8.52791E-6
16-5128842-G-A p.Glu275Glu synonymous ALG1 1 80948 1.23536E-5 40474 0 NA
16-5128844-G-A p.Arg276Gln missense ALG1 33 80898 4.07921E-4 40449 0 0.00188917
16-5128849-G-A p.Ala278Thr missense ALG1 1 80828 1.2372E-5 40414 0 4.02492E-6
16-5128857-G-C p.Leu280Leu synonymous ALG1 4426 80510 0.0549745 40255 136 0.0834306
16-5128858-G-T p.Val281Phe missense ALG1 1 80646 1.23999E-5 40323 0 2.01459E-5
16-5128868-C-T p.Thr284Met missense ALG1 3 80416 3.7306E-5 40208 0 1.731E-5
16-5128875-G-T p.Trp286Cys missense ALG1 1 80256 1.24601E-5 40128 0 NA
16-5128877-CAGGTCTGCAGGACCCCTGGGGCACTTGGGGTTGGTGTGACGGGCACCTGGCCAACCTGTGTTCTCCTCACCCCTGCCAGTCCTGCATGCTCCCACCCTGCCACGGTCTCAATGAGAACGGGAGGGCCTGTGAGCTGGAAGAGGGGTGTCTAGAAACAGGCCCCTGACATTCAATTCTCTTCTCAT-C p.Glu288fs frameshift ALG1 2 80196 2.49389E-5 40098 0 NA
16-5128878-A-G p.Thr287Thr splice_region+synonymous ALG1 1 80184 1.24713E-5 40092 0 6.09597E-5
16-5128887-G-A c.862+8G>A splice_region ALG1 1 79932 1.25106E-5 39966 0 NA
16-5129065-A-G p.Glu288Gly missense+splice_region ALG1 9 78876 1.14103E-4 39438 0 7.87756E-5
16-5129069-C-T p.Asp289Asp synonymous ALG1 65 78854 8.24308E-4 39427 0 0.00315307
16-5129074-A-G p.Asp291Gly missense ALG1 1 78876 1.26781E-5 39438 0 2.25296E-5
16-5129077-TCTC-T p.Ser293del conservative_inframe_deletion ALG1 1 78880 1.26775E-5 39440 0 1.31175E-5
16-5129090-G-A p.Leu296Leu synonymous ALG1 16 78864 2.02881E-4 39432 0 6.05173E-4
16-5129098-T-C p.Leu299Ser missense ALG1 1 78784 1.26929E-5 39392 0 NA
16-5129101-A-G p.Glu300Gly missense+splice_region ALG1 1 78748 1.26987E-5 39374 0 NA
16-5129103-A-C p.Lys301Gln missense+splice_region ALG1 6 78728 7.62118E-5 39364 0 6.79656E-5
16-5129103-A-G p.Lys301Glu missense+splice_region ALG1 1 78730 1.27016E-5 39365 0 3.96319E-5
16-5129104-G-A c.901+1G>A splice_donor ALG1 3 78730 3.81049E-5 39365 0 NA
16-5129766-C-G p.Leu307Val missense ALG1 1 80910 1.23594E-5 40455 0 6.60928E-5
16-5129766-CTT-C p.Leu307fs frameshift ALG1 2 80910 2.47188E-5 40455 0 NA
16-5129779-A-G p.Asn311Ser missense ALG1 4 80886 4.94523E-5 40443 0 2.4775E-5
16-5129780-C-A p.Asn311Lys missense ALG1 6 80914 7.41528E-5 40457 0 6.37836E-5
16-5129781-C-G p.Leu312Val missense ALG1 1 80920 1.23579E-5 40460 0 NA
16-5129782-T-C p.Leu312Pro missense ALG1 2 80924 2.47145E-5 40462 0 NA
16-5129790-C-G p.Leu315Val missense ALG1 1 80910 1.23594E-5 40455 0 7.96591E-6
16-5129793-G-A p.Val316Ile missense ALG1 41 80854 5.07087E-4 40427 0 6.53595E-4
16-5129799-G-A p.Val318Met missense ALG1 2 80862 2.47335E-5 40431 0 2.38985E-5
16-5129806-C-T p.Thr320Ile missense+splice_region ALG1 1 80824 1.23726E-5 40412 0 NA
16-5129809-G-C c.961+1G>C splice_donor ALG1 1 80796 1.23769E-5 40398 0 1.65196E-5
16-5129816-C-T c.961+8C>T splice_region ALG1 5 80776 6.18996E-5 40388 0 3.18593E-5
16-5129816-C-G c.961+8C>G splice_region ALG1 6 80776 7.42795E-5 40388 0 1.27437E-4
16-5130941-G-T c.962-6G>T splice_region ALG1 1 78582 1.27256E-5 39291 0 6.38203E-5
16-5130950-A-G p.Lys322Arg missense ALG1 16 78684 2.03345E-4 39342 0 5.76701E-4
16-5130956-C-T p.Pro324Leu missense ALG1 1 78686 1.27087E-5 39343 0 NA
16-5130961-A-G p.Arg326Gly missense ALG1 1 78696 1.27071E-5 39348 0 NA
16-5130970-T-C p.Tyr329His missense ALG1 2 78718 2.54071E-5 39359 0 NA
16-5130973-A-T p.Ser330Cys missense ALG1 4 78718 5.08143E-5 39359 0 1.71312E-5
16-5130973-AG-A p.Ser330fs frameshift ALG1 1 78718 1.27036E-5 39359 0 NA
16-5130976-C-T p.Arg331Cys missense ALG1 19 78860 2.40933E-4 39430 0 5.10399E-4
16-5130977-G-A p.Arg331His missense ALG1 1 78872 1.26788E-5 39436 0 1.76841E-5
16-5130978-C-T p.Arg331Arg synonymous ALG1 1 78882 1.26772E-5 39441 0 8.84095E-6
16-5130981-C-T p.Leu332Leu synonymous ALG1 2 78922 2.53415E-5 39461 0 1.15577E-4
16-5130983-T-A p.Ile333Asn missense ALG1 1 78906 1.26733E-5 39453 0 NA
16-5131021-C-A p.Pro346Thr missense ALG1 6 78814 7.61286E-5 39407 0 2.23385E-4
16-5131021-C-T p.Pro346Ser missense ALG1 2 78814 2.53762E-5 39407 0 NA
16-5131022-C-G p.Pro346Arg missense ALG1 4 78808 5.07563E-5 39404 0 3.5439E-5
16-5131023-C-T p.Pro346Pro synonymous ALG1 1 78808 1.26891E-5 39404 0 NA
16-5131029-G-A p.Leu348Leu synonymous ALG1 1 78730 1.27016E-5 39365 0 NA
16-5131033-G-A p.Ala350Thr missense ALG1 3 78660 3.81388E-5 39330 0 8.58811E-6
16-5131036-G-A p.Glu351Lys missense ALG1 1 78608 1.27214E-5 39304 0 2.23442E-4
16-5131040-A-T p.Asp352Val missense ALG1 2 78510 2.54745E-5 39255 0 6.39141E-5
16-5131045-C-T p.Pro354Ser missense ALG1 3 78448 3.82419E-5 39224 0 8.60348E-6
16-5131047-C-T p.Pro354Pro synonymous ALG1 1 78424 1.27512E-5 39212 0 NA
16-5131050-G-C p.Leu355Leu synonymous ALG1 1 78318 1.27685E-5 39159 0 8.92045E-6
16-5131055-T-C p.Leu357Pro missense+splice_region ALG1 1 78138 1.27979E-5 39069 0 NA
16-5131057-G-C p.Gly358Arg missense+splice_region ALG1 1 78066 1.28097E-5 39033 0 NA
16-5132564-G-A p.Ser359Ser synonymous ALG1 3 80896 3.70847E-5 40448 0 1.99602E-5
16-5132566-C-T p.Ala360Val missense ALG1 2 80914 2.47176E-5 40457 0 2.50279E-5
16-5132567-G-A p.Ala360Ala synonymous ALG1 398 80880 0.00492087 40440 2 0.00441748
16-5132567-G-C p.Ala360Ala synonymous ALG1 1 80912 1.23591E-5 40456 0 NA
16-5132569-A-C p.Asp361Ala missense ALG1 1 80930 1.23564E-5 40465 0 NA
16-5132571-C-T p.Leu362Leu synonymous ALG1 6 80942 7.41272E-5 40471 0 7.98308E-6
16-5132575-G-C p.Gly363Ala missense ALG1 1 80966 1.23509E-5 40483 0 NA
16-5132576-T-G p.Gly363Gly synonymous ALG1 9 80964 1.11161E-4 40482 0 3.18634E-4
16-5132577-G-A p.Val364Ile missense ALG1 2 80974 2.46993E-5 40487 0 3.18512E-5
16-5132578-T-G p.Val364Gly missense ALG1 2 80966 2.47017E-5 40483 0 8.31463E-6
16-5132579-C-G p.Val364Val synonymous ALG1 111 80966 0.00137095 40483 0 0.00445627
16-5132583-C-G p.Leu366Val missense ALG1 1 80980 1.23487E-5 40490 0 8.31117E-6
16-5132588-C-T p.His367His synonymous ALG1 1 81010 1.23442E-5 40505 0 NA
16-5132590-C-T p.Thr368Met missense ALG1 1 81016 1.23432E-5 40508 0 5.89623E-4
16-5132636-C-T p.Phe383Phe synonymous ALG1 38879 79894 0.486632 39947 9673 0.524257
16-5132637-G-A p.Gly384Arg missense ALG1 2 81090 2.4664E-5 40545 0 3.99326E-6
16-5132648-G-C p.Leu387Phe missense ALG1 1 81094 1.23314E-5 40547 0 NA
16-5132666-C-G p.Asn393Lys missense ALG1 11 81086 1.35658E-4 40543 0 3.24088E-4
16-5132675-G-A c.1187+1G>A splice_donor ALG1 2 81076 2.46682E-5 40538 0 2.50505E-5
16-5132677-A-G c.1187+3A>G splice_region ALG1 5 81082 6.1666E-5 40541 0 1.00192E-4
16-5132678-G-A c.1187+4G>A splice_region ALG1 2 81082 2.46664E-5 40541 0 8.3538E-6
16-5133679-G-A c.1188-4G>A splice_region ALG1 2 80220 2.49314E-5 40110 0 1.04883E-4
16-5133680-C-T c.1188-3C>T splice_region ALG1 1 80202 1.24685E-5 40101 0 8.75964E-6
16-5133680-CA-C c.1188-2delA splice_acceptor ALG1 1 80202 1.24685E-5 40101 0 3.18471E-5
16-5133717-C-T p.Leu408Leu synonymous ALG1 69 79852 8.64099E-4 39926 0 0.00176263
16-5133717-CT-C p.Leu408fs frameshift ALG1 2 79860 2.50438E-5 39930 0 NA
16-5133721-T-A p.Val409Asp missense ALG1 1 79812 1.25294E-5 39906 0 8.43156E-6
16-5133738-G-C p.Glu415Gln missense ALG1 1 79612 1.25609E-5 39806 0 NA
16-5133745-C-CTG p.Ala418fs frameshift ALG1 1 79536 1.25729E-5 39768 0 1.27504E-5
16-5133750-C-G p.Gln419Glu missense ALG1 2 79438 2.51769E-5 39719 0 4.26348E-6
16-5133763-C-A c.1263+5C>A splice_region ALG1 2 79456 2.51712E-5 39728 0 NA
16-5133766-C-T c.1263+8C>T splice_region ALG1 2 79426 2.51807E-5 39713 0 3.18634E-5
16-5134762-A-C p.Ser425Ser synonymous ALG1 1 79102 1.26419E-5 39551 0 1.28987E-5
16-5134768-T-C p.Phe427Phe synonymous ALG1 3 79096 3.79286E-5 39548 0 6.37267E-5
16-5134774-T-A p.Asp429Glu missense ALG1 8619 78592 0.109668 39296 488 0.11741
16-5134775-C-A p.Pro430Thr missense ALG1 4 79110 5.05625E-5 39555 0 1.2738E-4
16-5134779-C-T p.Ala431Val missense ALG1 11 79106 1.39054E-4 39553 0 1.6128E-4
16-5134780-G-A p.Ala431Ala synonymous ALG1 3 79118 3.7918E-5 39559 0 3.1902E-5
16-5134792-C-T p.Asn435Asn synonymous ALG1 1 79144 1.26352E-5 39572 0 8.87784E-6
16-5134799-C-T p.Arg438Trp missense ALG1 3 79154 3.79008E-5 39577 0 8.59875E-6
16-5134800-G-A p.Arg438Gln missense ALG1 1 79152 1.26339E-5 39576 0 1.71985E-5
16-5134811-C-T p.Arg442Trp missense ALG1 1 79158 1.2633E-5 39579 0 6.37105E-5
16-5134812-G-A p.Arg442Gln missense ALG1 3 79158 3.78989E-5 39579 0 8.88478E-6
16-5134819-G-A p.Ser444Ser synonymous ALG1 7 79160 8.84285E-5 39580 0 2.76194E-4
16-5134829-C-T p.Arg448* stop_gained ALG1 1 79156 1.26333E-5 39578 0 2.95879E-4
16-5134830-G-A p.Arg448Gln missense ALG1 1 79154 1.26336E-5 39577 0 0.00163577
16-5134834-G-T p.Trp449Cys missense ALG1 1 79162 1.26323E-5 39581 0 NA
16-5134836-A-G p.Asp450Gly missense ALG1 1 79158 1.2633E-5 39579 0 4.30293E-6
16-5134851-A-G p.Gln455Arg missense ALG1 1 79126 1.26381E-5 39563 0 NA
16-5134862-C-T p.Pro459Ser missense ALG1 1 79156 1.26333E-5 39578 0 6.37674E-5
16-5134874-G-T p.Asp463Tyr missense ALG1 1 79172 1.26307E-5 39586 0 2.66757E-5
16-5134879-A-G p.Thr464Thr synonymous ALG1 1 79174 1.26304E-5 39587 0 NA
16-5135394-A-G c.*512A>G splice_region ALG1 2 53510 3.73762E-5 26755 0 NA
16-5135669-C-G n.594+4C>G splice_region ALG1 71 80884 8.778E-4 40442 1 0.00206954
16-5135670-T-C n.594+5T>C splice_region ALG1 1 80880 1.2364E-5 40440 0 NA