Variant

Variant ID Consequence Effect Gene AC AN AF NS NHOM maxEAF
17-26900556-G-A p.Asn361Asn synonymous ALDOC 7 83274 8.40599E-5 41637 0 3.29462E-5
17-26900557-T-C p.Asn361Ser missense ALDOC 2 83276 2.40165E-5 41638 0 NA
17-26900564-T-C p.Ile359Val missense ALDOC 1 83286 1.20068E-5 41643 0 8.23655E-6
17-26900580-T-G p.Ala353Ala synonymous ALDOC 2 83274 2.40171E-5 41637 0 NA
17-26900587-C-T p.Gly351Glu missense ALDOC 2 83268 2.40188E-5 41634 0 3.29468E-5
17-26900598-T-A p.Gly347Gly synonymous ALDOC 1 83250 1.2012E-5 41625 0 8.23642E-6
17-26900609-C-T p.Glu344Lys missense ALDOC 2 83214 2.40344E-5 41607 0 NA
17-26900637-CACCTGCAAAAGGGAGCGTGGAGTAAGCAGGCTGAGCCAGCCCACAGGTGCCAAGCCCTGCCCAGGCTATAGCCTCTGGGTGCTGCCCCCACCCACCACCACCTGTAGCTCCCA-C p.Val334fs frameshift ALDOC 4 83088 4.81417E-5 41544 1 NA
17-26900755-C-T p.Glu333Lys missense+splice_region ALDOC 1 82742 1.20858E-5 41371 0 3.98251E-6
17-26900761-G-A p.Arg331Trp missense ALDOC 1 82820 1.20744E-5 41410 0 4.1351E-5
17-26900767-T-C p.Ile329Val missense ALDOC 1 82922 1.20595E-5 41461 0 NA
17-26900799-C-T p.Arg318Gln missense ALDOC 2 83044 2.40836E-5 41522 0 1.65175E-5
17-26900800-G-A p.Arg318Trp missense ALDOC 1 83052 1.20406E-5 41526 0 3.30115E-5
17-26900808-C-A p.Arg315Leu missense ALDOC 1 83074 1.20375E-5 41537 0 3.97725E-6
17-26900808-C-T p.Arg315Gln missense ALDOC 1 83074 1.20375E-5 41537 0 2.47427E-5
17-26900817-T-C p.Asn312Ser missense ALDOC 454 83092 0.00546382 41546 14 0.0120846
17-26900823-G-A p.Ala310Val missense ALDOC 1 83116 1.20314E-5 41558 0 NA
17-26900832-TGCAGGGCAC-T p.Arg304_Leu306del disruptive_inframe_deletion ALDOC 1 83106 1.20328E-5 41553 0 NA
17-26900837-G-C p.Ala305Ala synonymous ALDOC 5 83094 6.01728E-5 41547 0 8.24022E-5
17-26900841-C-T p.Arg304His missense ALDOC 3 83048 3.61237E-5 41524 0 1.19307E-5
17-26900842-G-A p.Arg304Cys missense ALDOC 2 83068 2.40767E-5 41534 0 1.03398E-4
17-26900855-G-A p.Thr299Thr synonymous ALDOC 1 83060 1.20395E-5 41530 0 NA
17-26900861-C-T p.Ala297Ala synonymous ALDOC 6 83006 7.22839E-5 41503 0 1.64813E-5
17-26900862-G-A p.Ala297Val missense ALDOC 28 83000 3.37349E-4 41500 0 6.25E-4
17-26900863-C-T p.Ala297Thr missense ALDOC 1 83002 1.20479E-5 41501 0 NA
17-26900864-C-A p.Trp296Cys missense ALDOC 2 82986 2.41005E-5 41493 0 NA
17-26900867-G-A p.Pro295Pro synonymous ALDOC 2 83000 2.40964E-5 41500 0 3.977E-6
17-26900868-G-A p.Pro295Leu missense ALDOC 1 82978 1.20514E-5 41489 0 8.35176E-5
17-26900869-G-A p.Pro295Ser missense ALDOC 1 82982 1.20508E-5 41491 0 6.37105E-5
17-26900872-G-A p.Arg294* stop_gained ALDOC 1 82936 1.20575E-5 41468 0 1.19318E-5
17-26900887-G-A p.Arg289Cys missense ALDOC 7 82718 8.46249E-5 41359 1 3.18451E-5
17-26900894-G-A p.Ala286Ala synonymous ALDOC 1 82628 1.21024E-5 41314 0 3.9782E-6
17-26900898-T-C p.Asn285Ser missense ALDOC 3 82534 3.63487E-5 41267 0 1.19355E-5
17-26900908-A-G p.Phe282Leu missense ALDOC 1 82366 1.21409E-5 41183 0 6.59794E-5
17-26900923-C-T p.Glu277Lys missense ALDOC 1 81756 1.22315E-5 40878 0 3.9827E-6
17-26900924-G-A p.Ser276Ser synonymous ALDOC 3 81672 3.67323E-5 40836 0 9.55657E-5
17-26900935-C-A p.Gly273Trp missense ALDOC 1 81262 1.23059E-5 40631 0 8.25328E-6
17-26900938-A-C p.Ser272Ala missense ALDOC 1 81100 1.23305E-5 40550 0 NA
17-26900952-C-G p.Gly267Ala missense+splice_region ALDOC 4 80574 4.96438E-5 40287 0 4.78606E-5
17-26900954-T-TGGGACAGCTGGGGGCACAGTGCGACGCAGGGCAGTGAC c.800-3_800-2insGTCACTGCCCTGCGTCGCACTGTGCCCCCAGCTGTCCC splice_region ALDOC 2 80484 2.48497E-5 40242 1 NA
17-26900955-A-C c.800-3T>G splice_region ALDOC 1 80432 1.24329E-5 40216 0 3.99058E-6
17-26900957-T-A c.800-5A>T splice_region ALDOC 7 80292 8.71818E-5 40146 0 1.27608E-4
17-26901079-T-C c.799+6A>G splice_region ALDOC 1 82748 1.20849E-5 41374 0 2.13741E-5
17-26901081-G-A c.799+4C>T splice_region ALDOC 1 82760 1.20831E-5 41380 0 6.37471E-5
17-26901082-T-C c.799+3A>G splice_region ALDOC 1 82798 1.20776E-5 41399 0 8.74539E-6
17-26901097-G-T p.Pro263Thr missense ALDOC 1 83010 1.20467E-5 41505 0 NA
17-26901098-G-A p.Pro262Pro synonymous ALDOC 1 83010 1.20467E-5 41505 0 4.25174E-6
17-26901103-C-T p.Val261Met missense ALDOC 1 83034 1.20433E-5 41517 0 NA
17-26901104-A-T p.Thr260Thr synonymous ALDOC 44 83052 5.29789E-4 41526 0 0.00159378
17-26901108-C-T p.Arg259His missense ALDOC 3 83060 3.61185E-5 41530 0 2.61862E-5
17-26901111-C-T p.Arg258His missense ALDOC 16 83108 1.92521E-4 41554 0 2.93248E-4
17-26901112-G-A p.Arg258Cys missense ALDOC 1 83100 1.20337E-5 41550 0 8.70065E-6
17-26901138-A-G p.Ile249Thr missense ALDOC 3 83232 3.60438E-5 41616 0 3.66423E-5
17-26901145-CT-C p.Glu247fs frameshift ALDOC 1 83246 1.20126E-5 41623 0 NA
17-26901152-A-G p.Tyr244Tyr synonymous ALDOC 7 83262 8.4072E-5 41631 0 4.0292E-5
17-26901168-G-T p.Ala239Asp missense ALDOC 3 83254 3.60343E-5 41627 0 8.48378E-6
17-26901176-C-T p.Pro236Pro synonymous ALDOC 3 83252 3.60352E-5 41626 0 2.4073E-5
17-26901177-G-A p.Pro236Leu missense ALDOC 5 83264 6.005E-5 41632 0 4.24139E-5
17-26901179-G-T p.Thr235Thr synonymous ALDOC 1 83256 1.20111E-5 41628 0 3.18878E-5
17-26901188-G-A p.Asn232Asn synonymous ALDOC 1 83268 1.20094E-5 41634 0 8.49921E-6
17-26901194-C-T p.Lys230Lys synonymous ALDOC 214 83260 0.00257026 41630 1 0.00634526
17-26901197-G-A p.Leu229Leu synonymous ALDOC 55 83280 6.60423E-4 41640 0 0.00149863
17-26901205-T-A p.Thr227Ser missense ALDOC 4 83260 4.80423E-5 41630 0 1.2128E-5
17-26901215-G-A p.Tyr223Tyr synonymous ALDOC 4 83268 4.80377E-5 41634 0 3.27544E-5
17-26901221-A-C p.His221Gln missense ALDOC 1 83266 1.20097E-5 41633 0 NA
17-26901242-G-A p.Tyr214Tyr synonymous ALDOC 34 83154 4.0888E-4 41577 1 0.00151057
17-26901246-A-T p.Val213Glu missense ALDOC 1 83122 1.20305E-5 41561 0 NA
17-26901247-C-G p.Val213Leu missense ALDOC 1 83112 1.2032E-5 41556 0 NA
17-26901261-T-TTCTCTGTAACATACTGACAACGTTTGAGGTCGTGGTCTCCATCA c.625-3_625-2insTGATGGAGACCACGACCTCAAACGTTGTCAGTATGTTACAGAGA splice_region ALDOC 2 82912 2.4122E-5 41456 1 NA
17-26901264-G-A c.625-5C>T splice_region ALDOC 1 82836 1.2072E-5 41418 0 NA
17-26901266-G-A c.625-7C>T splice_region ALDOC 1 82796 1.20779E-5 41398 0 9.56084E-5
17-26901517-CTG-C p.Thr206fs frameshift ALDOC 1 83348 1.19979E-5 41674 0 NA
17-26901523-C-T p.Val205Ile missense ALDOC 8 83350 9.59808E-5 41675 0 1.27502E-4
17-26901524-A-G p.Tyr204Tyr synonymous ALDOC 2 83350 2.39952E-5 41675 0 NA
17-26901529-GACA-G p.Cys202del conservative_inframe_deletion ALDOC 7 83352 8.39812E-5 41676 0 7.9533E-6
17-26901532-A-G p.Cys202Arg missense ALDOC 2 83360 2.39923E-5 41680 0 6.25E-4
17-26901534-C-T p.Arg201His missense ALDOC 2 83360 2.39923E-5 41680 0 2.47097E-5
17-26901542-G-A p.Asp198Asp synonymous ALDOC 1 83364 1.19956E-5 41682 0 8.23655E-6
17-26901544-C-T p.Asp198Asn missense ALDOC 2 83368 2.399E-5 41684 0 NA
17-26901545-G-A p.His197His synonymous ALDOC 4 83374 4.79766E-5 41687 0 0.00125
17-26901579-A-G p.Ile186Thr missense ALDOC 1 83372 1.19944E-5 41686 0 3.97668E-6
17-26901584-C-T p.Val184Val synonymous ALDOC 1 83366 1.19953E-5 41683 0 4.94201E-5
17-26901595-TCTGCAGGCAAGAGCAGAGATGCTTGGGAGGGGCAGTAGGGGAGATGAAGAAAGCCTTGTGACTCTCTCCCCACCAGGCATACAGGGCACCTAGCTCACCACCCTCCCAACACACACAC-T c.540+1_541-1del splice_acceptor ALDOC 12 83368 1.4394E-4 41684 5 NA
17-26901600-A-C c.541-5T>G splice_region ALDOC 1 83340 1.1999E-5 41670 0 NA
17-26901601-G-A c.541-6C>T splice_region ALDOC 4 83338 4.79973E-5 41669 0 3.97697E-6
17-26901724-A-G p.Ile177Thr missense ALDOC 4 83274 4.80342E-5 41637 0 3.18613E-5
17-26901729-G-A p.Ala175Ala splice_region+synonymous ALDOC 1 83276 1.20083E-5 41638 0 NA
17-26901736-C-T p.Arg173His missense ALDOC 1 83268 1.20094E-5 41634 0 4.9469E-5
17-26901746-C-T p.Val170Met missense ALDOC 7 83270 8.40639E-5 41635 0 6.25E-4
17-26901747-G-C p.Asn169Lys missense ALDOC 2 83278 2.40159E-5 41639 0 3.18634E-5
17-26901747-G-A p.Asn169Asn synonymous ALDOC 1 83278 1.2008E-5 41639 0 3.18634E-5
17-26901748-T-C p.Asn169Ser missense ALDOC 2 83282 2.40148E-5 41641 0 9.55779E-5
17-26901753-G-A p.Asn167Asn synonymous ALDOC 4 83258 4.80434E-5 41629 0 0.00125
17-26901772-G-T p.Ala161Glu missense ALDOC 2 83248 2.40246E-5 41624 1 NA
17-26901778-G-A p.Pro159Leu missense ALDOC 1 83248 1.20123E-5 41624 0 NA
17-26901784-C-T p.Arg157His missense ALDOC 6 83238 7.20825E-5 41619 0 5.03525E-4
17-26901785-G-A p.Arg157Cys missense ALDOC 13 83240 1.56175E-4 41620 0 1.23571E-4
17-26901785-G-T p.Arg157Ser missense ALDOC 2 83240 2.40269E-5 41620 0 NA
17-26901803-C-T p.Val151Met missense ALDOC 2 83238 2.40275E-5 41619 0 3.18695E-5
17-26901808-C-T p.Arg149His missense+splice_region ALDOC 2 83238 2.40275E-5 41619 0 3.18674E-5
17-26901809-G-A p.Arg149Cys missense ALDOC 1 83226 1.20155E-5 41613 0 1.98855E-5
17-26901814-T-C p.Lys147Arg missense ALDOC 1 83246 1.20126E-5 41623 0 NA
17-26901828-A-G p.Gly142Gly synonymous ALDOC 1 83250 1.2012E-5 41625 0 NA
17-26901837-C-T p.Lys139Lys synonymous ALDOC 7 83272 8.40619E-5 41636 0 7.95374E-5
17-26901847-G-T p.Ala136Asp missense ALDOC 5 83282 6.0037E-5 41641 0 9.55962E-5
17-26901853-C-T p.Arg134His missense ALDOC 3 83292 3.60179E-5 41646 0 1.40031E-4
17-26901854-G-A p.Arg134Cys missense ALDOC 7 83296 8.40377E-5 41648 0 5.17014E-5
17-26901870-C-A p.Leu128Leu synonymous ALDOC 1 83314 1.20028E-5 41657 0 NA
17-26901873-CCCTGCAAGCACAGTGCCAACCTCATTACTCTGCCCCTCTTTTACCAGCATCAACTATCTAACACCTCTTTGGTCCTCAAGCCCACCCATCCTATA-C p.Leu128fs frameshift ALDOC 14 83322 1.68023E-4 41661 7 NA
17-26901874-C-G p.Gly127Ala missense+splice_region ALDOC 1 83324 1.20013E-5 41662 0 1.59081E-5
17-26901879-A-G c.380-5T>C splice_region ALDOC 1 83316 1.20025E-5 41658 0 NA
17-26901971-T-C p.Gln126Gln splice_region+synonymous ALDOC 1 83368 1.1995E-5 41684 0 3.97646E-6
17-26901973-G-C p.Gln126Glu missense ALDOC 3 83370 3.59842E-5 41685 0 3.18735E-5
17-26901988-C-T p.Gly121Arg missense ALDOC 5 83382 5.9965E-5 41691 0 6.37186E-5
17-26902006-G-C p.Pro115Ala missense ALDOC 19 83364 2.27916E-4 41682 0 1.91241E-4
17-26902022-AACCTGTAGAGGAAGTACAAGCAGAGGGTTGAATCCAGGCAGGATTCTCCTTGCTACCCCTCCTACACAAGCTTATTTTCACACCCAGCTTCCATTCAGAGCAGGGCCAGGGGCTGC-A p.Val109fs frameshift ALDOC 8 83344 9.59877E-5 41672 4 NA
17-26902138-C-T c.324+3G>A splice_region ALDOC 11 82956 1.326E-4 41478 0 9.55414E-5
17-26902152-C-T p.Val105Met missense ALDOC 2 82850 2.414E-5 41425 0 1.91167E-4
17-26902153-G-A p.Val104Val synonymous ALDOC 5 82836 6.03602E-5 41418 0 1.07532E-4
17-26902155-C-A p.Val104Phe missense ALDOC 2 82808 2.41523E-5 41404 0 8.24906E-6
17-26902155-C-T p.Val104Ile missense ALDOC 1 82808 1.20761E-5 41404 0 7.96476E-6
17-26902164-T-C p.Lys101Glu missense ALDOC 1 82698 1.20922E-5 41349 0 NA
17-26902165-A-G p.Asp100Asp synonymous ALDOC 1 82698 1.20922E-5 41349 0 6.36943E-5
17-26902166-T-C p.Asp100Gly missense ALDOC 1 82684 1.20942E-5 41342 0 NA
17-26902178-C-T p.Arg96Gln missense ALDOC 3 82368 3.64219E-5 41184 0 3.5884E-5
17-26902182-C-T p.Val95Ile missense ALDOC 1 82208 1.21643E-5 41104 0 1.19627E-5
17-26902192-A-G p.Gly91Gly synonymous ALDOC 2 81848 2.44355E-5 40924 0 3.30049E-5
17-26902203-C-T p.Asp88Asn missense ALDOC 19 81542 2.33009E-4 40771 0 6.36699E-4
17-26902222-A-G p.His81His synonymous ALDOC 1 81274 1.23041E-5 40637 0 NA
17-26902228-G-T p.Phe79Leu missense ALDOC 1 81330 1.22956E-5 40665 0 NA
17-26902259-C-T p.Arg69His missense ALDOC 2 82246 2.43173E-5 41123 0 2.39131E-5
17-26902260-G-A p.Arg69Cys missense ALDOC 1 82306 1.21498E-5 41153 0 1.65046E-5
17-26902262-T-C p.Asp68Gly missense ALDOC 1 82342 1.21445E-5 41171 0 NA
17-26902276-C-G p.Leu63Leu synonymous ALDOC 2 82714 2.41797E-5 41357 0 NA
17-26902286-C-T p.Arg60His missense ALDOC 2 82810 2.41517E-5 41405 0 2.47492E-5
17-26902286-C-A p.Arg60Leu missense ALDOC 1 82812 1.20755E-5 41406 0 8.24974E-6
17-26902287-G-A p.Arg60Cys missense ALDOC 1 82846 1.20706E-5 41423 0 NA
17-26902298-C-T p.Arg56His missense ALDOC 3 82992 3.61481E-5 41496 0 8.24824E-6
17-26902299-G-A p.Arg56Cys missense ALDOC 1 83020 1.20453E-5 41510 0 NA
17-26902305-C-T p.Glu54Lys missense ALDOC 1 83132 1.20291E-5 41566 0 8.24538E-6
17-26902306-C-G p.Glu53Asp missense ALDOC 1 83150 1.20265E-5 41575 0 3.97829E-6
17-26902327-T-G p.Gln46His missense ALDOC 1 83246 1.20126E-5 41623 0 NA
17-26902337-C-T p.Arg43Gln missense ALDOC 1 83268 1.20094E-5 41634 0 3.97731E-6
17-26902349-C-A p.Ser39Ile missense ALDOC 2 83270 2.40183E-5 41635 0 1.19328E-5
17-26902351-GCCTAGGGGCAAACAAAGAGAGGCAGTGAGAACATCCCCAGGGTCCCCTAGCCACCTGTACCCTACCTGGCTACAGATGTCCACTTA-G p.Gly38fs frameshift ALDOC 14 83270 1.68128E-4 41635 7 NA
17-26902358-G-A c.113-6C>T splice_region ALDOC 11 83280 1.32085E-4 41640 0 1.81318E-4
17-26902360-C-A c.113-8G>T splice_region ALDOC 1 83278 1.2008E-5 41639 0 7.95558E-6
17-26902431-C-T c.112+8G>A splice_region ALDOC 1 83334 1.19999E-5 41667 0 NA
17-26902439-C-G p.Gly38Arg missense+splice_region ALDOC 2 83346 2.39964E-5 41673 0 NA
17-26902452-C-T p.Ala33Ala synonymous ALDOC 4 83330 4.80019E-5 41665 0 6.36983E-5
17-26902473-C-T p.Pro26Pro synonymous ALDOC 1 83320 1.20019E-5 41660 0 6.36983E-5
17-26902474-G-A p.Pro26Leu missense ALDOC 3 83318 3.60066E-5 41659 0 0.00125
17-26902486-C-T p.Arg22Gln missense ALDOC 9 83302 1.08041E-4 41651 0 7.95361E-6
17-26902487-G-A p.Arg22Trp missense ALDOC 2 83294 2.40113E-5 41647 0 3.2975E-5
17-26902493-C-T p.Ala20Thr missense ALDOC 1 83272 1.20088E-5 41636 0 NA
17-26902508-CCTT-C p.Lys14del conservative_inframe_deletion ALDOC 2 83218 2.40333E-5 41609 0 1.15576E-4
17-26902512-C-T c.-79G>A splice_region ALDOC 1 83196 1.20198E-5 41598 0 3.97814E-6
17-26902513-T-C p.Lys13Arg missense ALDOC 1 83198 1.20195E-5 41599 0 8.25887E-6
17-26902517-G-C p.Gln12Glu missense ALDOC 2 83148 2.40535E-5 41574 0 3.97829E-6
17-26902519-T-C p.Glu11Gly missense ALDOC 1 83120 1.20308E-5 41560 0 NA
17-26902524-A-G p.Ser9Ser synonymous ALDOC 1 83080 1.20366E-5 41540 0 0.00100705
17-26902534-G-A p.Pro6Leu missense ALDOC 3 82920 3.61795E-5 41460 0 1.2738E-4
17-26902539-C-T p.Ser4Ser synonymous ALDOC 4 82714 4.83594E-5 41357 0 6.25E-4
17-26902540-G-A p.Ser4Leu missense ALDOC 1 82724 1.20884E-5 41362 0 9.55414E-5
17-26902565-G-GTGCGCAGCCAGTTAGCAGCCGCAGCCACAAGCACAGCTCGGGTTCTGATCC c.-12-4_-12-3insGGATCAGAACCCGAGCTGTGCTTGTGGCTGCGGCTGCTAACTGGCTGCGCA splice_region ALDOC 2 81404 2.45688E-5 40702 1 NA
17-26902565-G-A c.-12-3C>T splice_region ALDOC 2 81406 2.45682E-5 40703 0 4.01245E-6
17-26902566-G-A c.-12-4C>T splice_region ALDOC 2 81278 2.46069E-5 40639 0 4.01474E-6
17-26902630-A-G c.-80T>C 5_prime_UTR_premature_start_codon_gain ALDOC 215 61988 0.00346841 30994 1 0.00213335
17-26902862-A-G c.-312T>C 5_prime_UTR_premature_start_codon_gain ALDOC 1 26720 3.74252E-5 13360 0 NA
17-26902866-A-G c.-316T>C 5_prime_UTR_premature_start_codon_gain ALDOC 1 26868 3.7219E-5 13434 0 NA
17-26902906-G-C c.-356C>G 5_prime_UTR_premature_start_codon_gain ALDOC 1 26368 3.79248E-5 13184 0 NA
17-26902980-T-TA c.-13+2_-13+3insT splice_donor ALDOC 1 24548 4.07365E-5 12274 0 NA
17-26902985-C-T c.-15G>A splice_region ALDOC 1 24524 4.07764E-5 12262 0 NA
17-26903221-G-A c.-251C>T 5_prime_UTR_premature_start_codon_gain ALDOC 1 11480 8.7108E-5 5740 0 1.27397E-4
17-26903273-T-G c.-303A>C 5_prime_UTR_premature_start_codon_gain ALDOC 2 6740 2.96736E-4 3370 0 7.32671E-4
17-26903285-G-A c.-315C>T 5_prime_UTR_premature_start_codon_gain ALDOC 1 5694 1.75623E-4 2847 0 3.18431E-5
17-26903922-G-A c.-116C>T 5_prime_UTR_premature_start_codon_gain ALDOC 3 28166 1.06511E-4 14083 0 NA
17-26904019-C-T c.-213G>A 5_prime_UTR_premature_start_codon_gain ALDOC 1 27468 3.6406E-5 13734 0 NA
17-26904032-G-A c.-226C>T 5_prime_UTR_premature_start_codon_gain ALDOC 1 27296 3.66354E-5 13648 0 3.1902E-5
17-26904096-C-A c.-290G>T 5_prime_UTR_premature_start_codon_gain ALDOC 3 26472 1.13327E-4 13236 0 6.37674E-5
17-26904099-G-A c.-293C>T 5_prime_UTR_premature_start_codon_gain ALDOC 1 26448 3.781E-5 13224 0 NA
17-26904156-G-A c.-350C>T 5_prime_UTR_premature_start_codon_gain ALDOC 1 25590 3.90778E-5 12795 0 NA
17-26904263-A-G c.-457T>C 5_prime_UTR_premature_start_codon_gain ALDOC 2 17702 1.12982E-4 8851 0 NA