Variant

Variant ID Consequence Effect Gene AC AN AF NS NHOM maxEAF
16-30064471-C-T c.-1027C>T 5_prime_UTR_premature_start_codon_gain ALDOA 84 3350 0.0250746 1675 1 0.0234818
16-30064581-C-T c.-1019C>T 5_prime_UTR_premature_start_codon_gain ALDOA 18 14396 0.00125035 7198 0 2.8688E-4
16-30064726-G-T c.-874G>T 5_prime_UTR_premature_start_codon_gain ALDOA 1 44514 2.24648E-5 22257 0 NA
16-30064819-ACGTAAGTCCGGGC-A c.-924_-924+12delCGTAAGTCCGGGC splice_donor ALDOA 1 44752 2.23454E-5 22376 0 NA
16-30064820-CG-C c.-924+1delG splice_donor ALDOA 3 44748 6.70421E-5 22374 0 6.37146E-5
16-30064821-G-GT c.-924+1_-924+2insT splice_donor ALDOA 1 44744 2.23494E-5 22372 0 3.18654E-5
16-30064826-T-C c.-924+6T>C splice_region ALDOA 19 44732 4.24752E-4 22366 0 3.50586E-4
16-30066098-C-T c.-923-7C>T splice_region ALDOA 3 44710 6.70991E-5 22355 0 NA
16-30066099-G-A c.-923-6G>A splice_region ALDOA 1 44676 2.23834E-5 22338 0 6.38978E-5
16-30066100-T-A c.-923-5T>A splice_region ALDOA 1 44796 2.23234E-5 22398 0 NA
16-30066101-C-G c.-923-4C>G splice_region ALDOA 4 44832 8.9222E-5 22416 0 6.37959E-5
16-30066103-A-G c.-923-2A>G splice_acceptor ALDOA 2 44854 4.45891E-5 22427 0 NA
16-30066103-A-T c.-923-2A>T splice_acceptor ALDOA 2 44854 4.45891E-5 22427 0 NA
16-30066118-C-T c.-910C>T 5_prime_UTR_premature_start_codon_gain ALDOA 2 45134 4.43125E-5 22567 0 NA
16-30066119-G-A c.-909G>A 5_prime_UTR_premature_start_codon_gain ALDOA 11 45094 2.43935E-4 22547 0 3.82873E-4
16-30066133-C-T c.-895C>T 5_prime_UTR_premature_start_codon_gain ALDOA 2 45238 4.42106E-5 22619 0 3.18939E-5
16-30066179-C-T c.-849C>T 5_prime_UTR_premature_start_codon_gain ALDOA 2 45480 4.39754E-5 22740 0 NA
16-30066188-C-T c.-840C>T 5_prime_UTR_premature_start_codon_gain ALDOA 2 45494 4.39618E-5 22747 0 NA
16-30066225-C-T c.-803C>T 5_prime_UTR_premature_start_codon_gain ALDOA 6 45406 1.32141E-4 22703 0 NA
16-30066250-T-A c.-780+2T>A splice_donor ALDOA 5 45266 1.10458E-4 22633 0 6.38244E-5
16-30066513-C-T c.-759C>T 5_prime_UTR_premature_start_codon_gain ALDOA 3 45376 6.61142E-5 22688 0 9.56816E-5
16-30066526-T-A n.584T>A splice_region ALDOA 1 45446 2.20041E-5 22723 0 NA
16-30066572-G-T c.-700G>T 5_prime_UTR_premature_start_codon_gain ALDOA 1 45572 2.19433E-5 22786 0 NA
16-30066649-G-GACTGGGCACCTCGCTGCCCCCGC c.-624+1_-624+2insACTGGGCACCTCGCTGCCCCCGC splice_donor ALDOA 1 45544 2.19568E-5 22772 0 NA
16-30075049-G-A c.-623-1G>A splice_acceptor ALDOA 1 44568 2.24376E-5 22284 0 NA
16-30075102-C-T c.-571C>T 5_prime_UTR_premature_start_codon_gain ALDOA 3 44936 6.67616E-5 22468 0 NA
16-30075103-G-A c.-570G>A 5_prime_UTR_premature_start_codon_gain ALDOA 1 44932 2.22559E-5 22466 0 NA
16-30075115-C-T c.-558C>T 5_prime_UTR_premature_start_codon_gain ALDOA 3 44924 6.67795E-5 22462 0 NA
16-30075158-C-T c.-515C>T 5_prime_UTR_premature_start_codon_gain ALDOA 2 44554 4.48893E-5 22277 0 NA
16-30075402-C-T c.-271C>T 5_prime_UTR_premature_start_codon_gain ALDOA 2 3860 5.18135E-4 1930 0 NA
16-30075571-T-TCCCTGGCCAAAGATTTATTTCTCTTGACAACCAAGGGCCTCC c.-104+2_-104+3insCCCTGGCCAAAGATTTATTTCTCTTGACAACCAAGGGCCTCC splice_region ALDOA 2 2964 6.74764E-4 1482 1 NA
16-30075571-T-TCCCTGGCCAAAGATTTATTTCTCTTGACAACCAAGGGCCTCCGTCTG c.-104+2_-104+3insCCCTGGCCAAAGATTTATTTCTCTTGACAACCAAGGGCCTCCGTCTG splice_region ALDOA 2 2962 6.75219E-4 1481 1 NA
16-30075725-C-G c.-123C>G 5_prime_UTR_premature_start_codon_gain ALDOA 1 3014 3.31785E-4 1507 0 NA
16-30075909-G-A c.-218G>A 5_prime_UTR_premature_start_codon_gain ALDOA 2 2892 6.91563E-4 1446 0 0.00248392
16-30076995-T-C c.-275T>C 5_prime_UTR_premature_start_codon_gain ALDOA 1 26130 3.82702E-5 13065 0 NA
16-30077030-C-T c.-240C>T 5_prime_UTR_premature_start_codon_gain ALDOA 1 36748 2.72124E-5 18374 0 NA
16-30077041-G-T c.-229G>T 5_prime_UTR_premature_start_codon_gain ALDOA 2 38950 5.13479E-5 19475 0 NA
16-30077044-G-A c.-226G>A 5_prime_UTR_premature_start_codon_gain ALDOA 1 39350 2.5413E-5 19675 0 NA
16-30077062-C-T c.-208C>T 5_prime_UTR_premature_start_codon_gain ALDOA 1 41210 2.4266E-5 20605 0 NA
16-30077096-C-T c.-174C>T 5_prime_UTR_premature_start_codon_gain ALDOA 1 43070 2.3218E-5 21535 0 NA
16-30077116-C-T c.-154C>T 5_prime_UTR_premature_start_codon_gain ALDOA 12 43866 2.7356E-4 21933 0 1.59439E-4
16-30077131-C-G c.-139C>G 5_prime_UTR_premature_start_codon_gain ALDOA 12 44174 2.71653E-4 22087 0 0.00102054
16-30077161-C-T c.-109C>T 5_prime_UTR_premature_start_codon_gain ALDOA 20 44388 4.50572E-4 22194 0 2.55477E-4
16-30077221-C-T c.-49C>T 5_prime_UTR_premature_start_codon_gain ALDOA 1 44220 2.26142E-5 22110 0 NA
16-30077230-C-T c.-40C>T 5_prime_UTR_premature_start_codon_gain ALDOA 23 44128 5.21211E-4 22064 0 8.28765E-4
16-30077242-G-A c.-28G>A 5_prime_UTR_premature_start_codon_gain ALDOA 5 44076 1.1344E-4 22038 0 3.18918E-5
16-30077247-A-T c.-23A>T 5_prime_UTR_premature_start_codon_gain ALDOA 1 43874 2.27925E-5 21937 0 NA
16-30077249-G-GAAC c.-22+1_-22+2insAAC splice_donor ALDOA 2 43774 4.56892E-5 21887 1 NA
16-30078211-G-A c.-8G>A 5_prime_UTR_premature_start_codon_gain ALDOA 2 77118 2.59343E-5 38559 0 NA
16-30078220-T-C p.Met1? start_lost ALDOA 13 77178 1.68442E-4 38589 0 1.35062E-4
16-30078224-A-C p.Ala2Ala synonymous ALDOA 1 77208 1.2952E-5 38604 0 6.75074E-6
16-30078229-G-A p.Arg4His missense ALDOA 2 77248 2.58906E-5 38624 0 9.55353E-5
16-30078230-C-T p.Arg4Arg synonymous ALDOA 1 77250 1.2945E-5 38625 0 NA
16-30078240-G-A p.Gly8Arg missense ALDOA 1 77336 1.29306E-5 38668 0 2.62502E-4
16-30078248-C-T p.Ser10Ser synonymous ALDOA 13 77362 1.68041E-4 38681 0 9.55475E-5
16-30078255-A-G p.Met13Val missense ALDOA 2 77396 2.58411E-5 38698 0 6.50111E-5
16-30078260-C-T p.Thr14Thr synonymous ALDOA 1 77408 1.29186E-5 38704 0 6.68458E-6
16-30078264-C-T p.Leu16Leu synonymous ALDOA 1 77424 1.29159E-5 38712 0 3.18471E-5
16-30078270-A-G p.Met18Val missense ALDOA 1 77446 1.29122E-5 38723 0 1.33273E-5
16-30078279-G-A p.Ala21Thr missense ALDOA 4 77468 5.16342E-5 38734 0 9.55657E-5
16-30078282-T-C p.Phe22Leu missense ALDOA 1 77476 1.29072E-5 38738 0 3.18634E-5
16-30078290-TC-T p.Pro26fs frameshift ALDOA 2 77490 2.58098E-5 38745 0 NA
16-30078304-G-A p.Ser29Asn missense ALDOA 1 77544 1.28959E-5 38772 0 NA
16-30078313-T-C p.Leu32Pro missense ALDOA 1 77570 1.28916E-5 38785 0 6.04741E-6
16-30078317-C-T p.His33His synonymous ALDOA 2 77592 2.57759E-5 38796 0 1.08096E-4
16-30078329-C-T p.Gly37Gly synonymous ALDOA 3 77662 3.86289E-5 38831 0 NA
16-30078330-A-C p.Asn38His missense ALDOA 1 77686 1.28723E-5 38843 0 NA
16-30078335-C-T p.Thr39Thr synonymous ALDOA 2 77734 2.57288E-5 38867 0 NA
16-30078346-CAG-C p.Glu44fs frameshift ALDOA 1 77840 1.28469E-5 38920 0 4.33276E-5
16-30078354-G-C p.Gly46Arg missense ALDOA 1 77926 1.28327E-5 38963 0 NA
16-30078363-C-T c.141+4C>T splice_region ALDOA 2 78098 2.56088E-5 39049 0 5.3144E-6
16-30078365-G-A c.141+6G>A splice_region ALDOA 1 78130 1.27992E-5 39065 0 1.0598E-5
16-30078367-G-A c.141+8G>A splice_region ALDOA 1 78122 1.28005E-5 39061 0 NA
16-30078548-T-A c.-21-7T>A splice_region ALDOA 3 81978 3.65952E-5 40989 0 5.80123E-5
16-30078562-C-A p.Ala50Asp missense ALDOA 1 82248 1.21584E-5 41124 0 NA
16-30078564-A-G p.Thr51Ala missense ALDOA 3 82296 3.64538E-5 41148 0 9.56328E-5
16-30078566-T-C p.Thr51Thr synonymous ALDOA 1 82326 1.21468E-5 41163 0 8.25518E-6
16-30078568-C-G p.Thr52Ser missense ALDOA 2 82346 2.42878E-5 41173 0 NA
16-30078588-T-C p.Tyr5His missense ALDOA 2 82582 2.42184E-5 41291 0 NA
16-30078594-G-A p.Ala7Thr missense ALDOA 5 82656 6.04917E-5 41328 0 7.15968E-5
16-30078595-C-T p.Ala7Val missense ALDOA 1 82666 1.20969E-5 41333 0 5.04032E-4
16-30078597-C-T p.Leu8Leu synonymous ALDOA 1 82686 1.20939E-5 41343 0 2.38665E-5
16-30078602-C-T p.Thr9Thr synonymous ALDOA 2 82758 2.41668E-5 41379 0 7.15979E-5
16-30078605-G-A p.Pro10Pro synonymous ALDOA 1 82812 1.20755E-5 41406 0 6.26566E-4
16-30078615-A-G p.Lys14Glu missense ALDOA 2 82952 2.41103E-5 41476 0 NA
16-30078617-G-A p.Lys14Lys synonymous ALDOA 1 82962 1.20537E-5 41481 0 NA
16-30078621-C-G p.Leu16Val missense ALDOA 1 82990 1.20496E-5 41495 0 3.9776E-6
16-30078623-G-T p.Leu16Leu synonymous ALDOA 1 82984 1.20505E-5 41492 0 NA
16-30078630-A-G p.Ile19Val missense ALDOA 4 83030 4.81754E-5 41515 0 NA
16-30078633-G-A p.Ala20Thr missense ALDOA 2 83022 2.409E-5 41511 0 6.25E-4
16-30078636-C-T p.His21Tyr missense ALDOA 9 83018 1.0841E-4 41509 0 9.5584E-5
16-30078638-C-T p.His21His synonymous ALDOA 1 83020 1.20453E-5 41510 0 NA
16-30078638-CC-TT p.HisArg21HisCys missense ALDOA 2 83020 2.40906E-5 41510 0 NA
16-30078639-C-T p.Arg22Cys missense ALDOA 9 83016 1.08413E-4 41508 0 0.00375
16-30078680-G-A p.Glu35Glu synonymous ALDOA 1 82954 1.20549E-5 41477 0 3.97839E-6
16-30078681-T-G p.Ser36Ala missense ALDOA 1 82934 1.20578E-5 41467 0 NA
16-30078686-TGGTGCGGGCAGGAGACAGAATGGGTGGAGGGTGCAGGGTTGGGAGTGGCAGGCTGATCCCCTAATTCCCATGTGACACTCCCA-T p.Ser39fs frameshift ALDOA 15 82946 1.80841E-4 41473 7 NA
16-30078690-G-A c.112+3G>A splice_region ALDOA 3 82936 3.61725E-5 41468 0 3.18674E-5
16-30078691-C-T c.112+4C>T splice_region ALDOA 82 82910 9.89024E-4 41455 0 0.00204004
16-30078691-C-G c.112+4C>G splice_region ALDOA 3 82914 3.61821E-5 41457 0 6.25E-4
16-30078692-G-A c.112+5G>A splice_region ALDOA 6 82920 7.23589E-5 41460 0 8.2631E-6
16-30078765-TC-T c.113-3delC splice_region ALDOA 1 82906 1.20619E-5 41453 0 NA
16-30078766-C-T c.113-5C>T splice_region ALDOA 12 82940 1.44683E-4 41470 0 6.25E-4
16-30078785-C-T p.Arg43Trp missense ALDOA 1 82972 1.20523E-5 41486 0 1.19856E-5
16-30078786-G-A p.Arg43Gln missense ALDOA 1 82964 1.20534E-5 41482 0 9.57182E-5
16-30078786-G-T p.Arg43Leu missense ALDOA 2 82964 2.41068E-5 41482 0 NA
16-30078786-G-C p.Arg43Pro missense ALDOA 2 82964 2.41068E-5 41482 0 3.99361E-6
16-30078805-C-T p.Thr49Thr synonymous ALDOA 1 83002 1.20479E-5 41501 0 4.98066E-5
16-30078806-G-A p.Glu50Lys missense ALDOA 2 82992 2.40987E-5 41496 0 NA
16-30078811-C-T p.Asn51Asn synonymous ALDOA 1 83020 1.20453E-5 41510 0 NA
16-30078814-C-T p.Thr52Thr synonymous ALDOA 3 83014 3.61385E-5 41507 0 3.19E-5
16-30078814-C-G p.Thr52Thr synonymous ALDOA 3 83014 3.61385E-5 41507 0 1.19641E-5
16-30078825-G-GTC p.Phe58fs frameshift ALDOA 1 82940 1.20569E-5 41470 0 NA
16-30078827-C-T p.Arg57Cys missense ALDOA 2 82934 2.41156E-5 41467 0 2.48682E-5
16-30078829-CTT-C p.Phe58fs frameshift ALDOA 1 82978 1.20514E-5 41489 0 NA
16-30078837-G-T p.Arg60Leu missense ALDOA 2 82972 2.41045E-5 41486 0 2.23328E-4
16-30078837-G-A p.Arg60His missense ALDOA 1 82972 1.20523E-5 41486 0 3.1904E-5
16-30078847-G-C p.Leu63Leu synonymous ALDOA 2 82988 2.40999E-5 41494 0 NA
16-30078856-T-C p.Ala66Ala synonymous ALDOA 1 82990 1.20496E-5 41495 0 8.27595E-6
16-30078860-G-T p.Asp68Tyr missense ALDOA 2 82972 2.41045E-5 41486 0 NA
16-30078860-G-A p.Asp68Asn missense ALDOA 4 82972 4.8209E-5 41486 0 2.14941E-4
16-30078864-G-A p.Arg69His missense ALDOA 1 82958 1.20543E-5 41479 0 3.30814E-5
16-30078871-C-G p.Asn71Lys missense ALDOA 5 83012 6.02323E-5 41506 0 4.96024E-5
16-30078878-A-C p.Ile74Leu missense ALDOA 1 83022 1.2045E-5 41511 0 1.59439E-4
16-30078898-C-G p.Phe80Leu missense ALDOA 1 83126 1.20299E-5 41563 0 7.95475E-6
16-30078907-A-G p.Thr83Thr synonymous ALDOA 158 83134 0.00190055 41567 2 0.00319264
16-30078909-T-G p.Leu84Arg missense ALDOA 1 83150 1.20265E-5 41575 0 3.97738E-6
16-30078920-G-A p.Ala88Thr missense ALDOA 1 83212 1.20175E-5 41606 0 NA
16-30078922-G-A p.Ala88Ala synonymous ALDOA 3 83216 3.60508E-5 41608 0 6.76116E-5
16-30078932-C-T p.Arg92Cys missense ALDOA 1 83226 1.20155E-5 41613 0 6.60393E-5
16-30078937-C-T p.Pro93Pro synonymous ALDOA 2 83260 2.40211E-5 41630 0 4.12752E-5
16-30078962-G-T p.Gly102Cys missense ALDOA 1 83226 1.20155E-5 41613 0 NA
16-30078966-G-C p.Gly103Ala missense ALDOA 1 83212 1.20175E-5 41606 0 NA
16-30078967-T-A p.Gly103Gly synonymous ALDOA 13 83198 1.56254E-4 41599 0 5.10139E-4
16-30079016-A-G n.508+8A>G splice_region ALDOA 1 81952 1.22023E-5 40976 0 3.99904E-6
16-30079527-A-G n.509-2A>G splice_acceptor ALDOA 1 6054 1.6518E-4 3027 0 0.0714286
16-30079963-A-C c.325-4A>C splice_region ALDOA 1 83348 1.19979E-5 41674 0 NA
16-30079967-G-T p.Val109Leu missense+splice_region ALDOA 1 83364 1.19956E-5 41682 0 3.97947E-6
16-30079978-C-T p.Gly112Gly synonymous ALDOA 4 83378 4.79743E-5 41689 0 1.15388E-4
16-30079979-G-A p.Val113Met missense ALDOA 3 83380 3.59799E-5 41690 0 6.36983E-5
16-30079986-C-T p.Pro115Leu missense ALDOA 1 83382 1.1993E-5 41691 0 3.97829E-6
16-30079988-CT-C p.Leu116fs frameshift ALDOA 1 83394 1.19913E-5 41697 0 NA
16-30079990-G-C p.Leu116Leu synonymous ALDOA 3 83394 3.59738E-5 41697 0 8.24035E-6
16-30079992-C-G p.Ala117Gly missense ALDOA 1 83396 1.1991E-5 41698 0 1.64807E-5
16-30080000-A-G p.Asn120Asp missense ALDOA 1 83390 1.19918E-5 41695 0 2.47194E-5
16-30080005-C-T p.Gly121Gly synonymous ALDOA 3 83388 3.59764E-5 41694 0 0.00100705
16-30080006-G-A p.Glu122Lys missense ALDOA 1 83386 1.19924E-5 41693 0 1.59105E-5
16-30080012-A-G p.Thr124Ala missense ALDOA 1 83388 1.19921E-5 41694 0 NA
16-30080019-AAGGTGAGAACTGTTTGATTCTCTGCCCTACGAACCCAACCAGAGCAGGTTTGGGTGCTGGGAGGAGTGGAAACCACATGCCCCTCCCCACCGTGCTCTGACCCCTTCCTCTTCTCTT-A p.Leu128fs frameshift ALDOA 4 83386 4.79697E-5 41693 1 NA
16-30080140-G-A p.Gly127Gly splice_region+synonymous ALDOA 3 83368 3.5985E-5 41684 0 3.97671E-6
16-30080159-C-T p.Arg134Cys missense ALDOA 1 83370 1.19947E-5 41685 0 3.18573E-5
16-30080167-C-G p.Ala136Ala synonymous ALDOA 1 83368 1.1995E-5 41684 0 NA
16-30080169-A-T p.Gln137Leu missense ALDOA 1 83382 1.1993E-5 41691 0 NA
16-30080174-A-T p.Lys139* stop_gained ALDOA 1 83382 1.1993E-5 41691 0 NA
16-30080179-G-A p.Lys140Lys synonymous ALDOA 2 83376 2.39877E-5 41688 0 8.2375E-6
16-30080182-C-T p.Asp141Asp synonymous ALDOA 1 83366 1.19953E-5 41683 0 3.295E-5
16-30080188-T-C p.Ala143Ala synonymous ALDOA 2 83360 2.39923E-5 41680 0 NA
16-30080232-C-G p.Thr158Ser missense ALDOA 3 83308 3.60109E-5 41654 0 3.18532E-5
16-30080243-C-T p.Leu162Phe missense ALDOA 1 83300 1.20048E-5 41650 0 3.97674E-6
16-30080245-C-G p.Leu162Leu synonymous ALDOA 59 83310 7.08198E-4 41655 0 0.00124204
16-30080246-G-A p.Ala163Thr missense ALDOA 1 83306 1.20039E-5 41653 0 1.9884E-5
16-30080265-A-G p.Asn169Ser missense ALDOA 31 83308 3.72113E-4 41654 0 1.9484E-4
16-30080276-C-T p.Arg162Cys missense+splice_region ALDOA 16 83274 1.92137E-4 41637 0 2.86642E-4
16-30080277-G-A p.Arg162His missense+splice_region ALDOA 3 83270 3.60274E-5 41635 0 5.03525E-4
16-30080281-T-C p.Tyr174Tyr synonymous ALDOA 1 83268 1.20094E-5 41634 0 NA
16-30080299-G-GAATGGCATT c.540_540+1insAATGGCATT splice_donor ALDOA 1 83196 1.20198E-5 41598 0 NA
16-30080316-T-C c.552+5T>C splice_region ALDOA 4 83068 4.81533E-5 41534 0 3.30218E-5
16-30080319-A-G c.552+8A>G splice_region ALDOA 1 83020 1.20453E-5 41510 0 2.47692E-5
16-30080626-G-C c.541-1G>C splice_acceptor ALDOA 1 83328 1.20008E-5 41664 0 NA
16-30080638-G-A p.Val184Val synonymous ALDOA 1 83326 1.20011E-5 41663 0 8.23805E-6
16-30080639-C-T p.Pro185Ser missense ALDOA 1 83330 1.20005E-5 41665 0 7.95317E-6
16-30080644-C-T p.Ile186Ile synonymous ALDOA 5 83332 6.0001E-5 41666 0 2.14179E-4
16-30080645-G-A p.Val187Met missense ALDOA 8 83334 9.59992E-5 41667 1 1.98826E-5
16-30080645-G-C p.Val187Leu missense ALDOA 1 83334 1.19999E-5 41667 0 3.97652E-6
16-30080656-G-A p.Glu190Glu synonymous ALDOA 1 83336 1.19996E-5 41668 0 NA
16-30080659-C-T p.Ile191Ile synonymous ALDOA 1 83336 1.19996E-5 41668 0 NA
16-30080666-G-A p.Asp194Asn missense ALDOA 1 83336 1.19996E-5 41668 0 NA
16-30080688-G-A p.Arg201His missense ALDOA 2 83330 2.4001E-5 41665 0 4.94226E-5
16-30080698-T-C p.Tyr204Tyr synonymous ALDOA 1 83348 1.19979E-5 41674 0 8.23723E-6
16-30080701-G-T p.Val205Val synonymous ALDOA 1 83340 1.1999E-5 41670 0 NA
16-30080704-C-T p.Thr206Thr synonymous ALDOA 3 83354 3.59911E-5 41677 0 1.5907E-5
16-30080705-G-A p.Glu207Lys missense ALDOA 1 83350 1.19976E-5 41675 0 NA
16-30080708-AAGGTAAATGGCTACCTGCCTGACCAGTGCAAGGTGGCTGGCCGGGGACCCTGGGGCTAACCCCTATCCTCTCCTCCACCCCACTACCCACCGTGCGCCTGCTCTGCTCC-A p.Val209fs frameshift ALDOA 8 83338 9.59946E-5 41669 2 NA
16-30080712-TAAATGGCTACCTGCCTGACCAGTGCAAGGTGGCTGGCCGGGGAC-T c.624+3_624+46delAAATGGCTACCTGCCTGACCAGTGCAAGGTGGCTGGCCGGGGAC splice_region ALDOA 1 83346 1.19982E-5 41673 0 NA
16-30080715-A-G c.624+5A>G splice_region ALDOA 1 83344 1.19985E-5 41672 0 3.97671E-6
16-30080816-C-T c.625-4C>T splice_region ALDOA 1 82982 1.20508E-5 41491 0 3.97978E-6
16-30080818-A-G c.625-2A>G splice_acceptor ALDOA 2 82982 2.41016E-5 41491 0 NA
16-30080824-T-C p.Leu210Pro missense ALDOA 2 82946 2.41121E-5 41473 0 NA
16-30080830-C-T p.Ala212Val missense ALDOA 2 82946 2.41121E-5 41473 0 4.77601E-5
16-30080832-G-C p.Val213Leu missense ALDOA 4 82946 4.82241E-5 41473 0 1.91131E-4
16-30080832-G-A p.Val213Ile missense ALDOA 1 82946 1.2056E-5 41473 0 NA
16-30080836-A-G p.Tyr214Cys missense ALDOA 2 82944 2.41127E-5 41472 0 3.18613E-5
16-30080840-G-T p.Lys215Asn missense ALDOA 2 82964 2.41068E-5 41482 0 3.18674E-5
16-30080854-A-G p.His220Arg missense ALDOA 4 82932 4.82323E-5 41466 0 1.19378E-5
16-30080855-C-T p.His220His synonymous ALDOA 1 82940 1.20569E-5 41470 0 3.18593E-5
16-30080856-C-A p.His221Asn missense ALDOA 3 82952 3.61655E-5 41476 0 5.76844E-5
16-30080865-C-T p.Leu224Leu synonymous ALDOA 1 82934 1.20578E-5 41467 0 NA
16-30080873-C-T p.Gly226Gly synonymous ALDOA 1 82942 1.20566E-5 41471 0 NA
16-30080890-A-C p.Asn232Thr missense ALDOA 1 82864 1.2068E-5 41432 0 NA
16-30080892-A-G p.Met233Val missense ALDOA 1 82868 1.20674E-5 41434 0 2.47317E-5
16-30080894-G-A p.Met233Ile missense ALDOA 5 82860 6.03427E-5 41430 0 2.72075E-4
16-30080908-A-G p.His238Arg missense ALDOA 1 82776 1.20808E-5 41388 0 6.36983E-5
16-30080909-T-G p.His238Gln missense ALDOA 1 82766 1.20823E-5 41383 0 0.00125
16-30080911-C-T p.Ala239Val missense ALDOA 2 82746 2.41704E-5 41373 0 NA
16-30080931-C-T p.His246Tyr missense ALDOA 10 82586 1.21086E-4 41293 0 1.23462E-4
16-30080943-G-A p.Ala250Thr missense ALDOA 1 82344 1.21442E-5 41172 0 3.18613E-5
16-30080954-C-T p.Thr253Thr synonymous ALDOA 6 81994 7.31761E-5 40997 0 1.15994E-4
16-30080955-G-A p.Val254Ile missense ALDOA 16 81972 1.95189E-4 40986 0 2.15407E-4
16-30080955-G-C p.Val254Leu missense ALDOA 1 81974 1.2199E-5 40987 0 NA
16-30080958-A-G p.Thr255Ala missense ALDOA 1 81918 1.22073E-5 40959 0 2.48707E-5
16-30080959-C-T p.Thr255Ile missense ALDOA 1 81862 1.22157E-5 40931 0 6.37105E-5
16-30080962-C-T p.Ala256Val missense ALDOA 7 81736 8.56416E-5 40868 0 4.79348E-5
16-30080964-C-A p.Leu257Met missense ALDOA 1 81680 1.22429E-5 40840 0 3.31928E-5
16-30080968-G-A p.Arg258His missense ALDOA 2 81434 2.45598E-5 40717 0 2.49323E-5
16-30080970-C-T p.Arg259Cys missense ALDOA 1 81412 1.22832E-5 40706 0 3.32486E-5
16-30080971-G-A p.Arg259His missense ALDOA 1 81432 1.22802E-5 40716 0 6.37146E-5
16-30080975-A-G p.Thr260Thr synonymous ALDOA 2 81400 2.457E-5 40700 0 NA
16-30080978-G-GC p.Ala264fs frameshift ALDOA 2 81202 2.46299E-5 40601 0 4.17021E-5
16-30080978-G-C p.Val261Val synonymous ALDOA 2 81208 2.46281E-5 40604 0 3.18613E-5
16-30080984-C-T p.Pro263Pro synonymous ALDOA 3 81136 3.6975E-5 40568 0 2.50417E-5
16-30080985-G-A p.Ala264Thr missense ALDOA 3 81020 3.70279E-5 40510 0 3.18613E-5
16-30080995-G-A c.799+1G>A splice_donor ALDOA 1 80712 1.23897E-5 40356 0 NA
16-30081148-C-CA c.800-3_800-2insA splice_acceptor ALDOA 10 82384 1.21383E-4 41192 0 3.18748E-5
16-30081161-C-T p.Phe270Phe synonymous ALDOA 1 82760 1.20831E-5 41380 0 NA
16-30081162-C-T p.Leu271Leu synonymous ALDOA 101 82776 0.00122016 41388 0 0.0040282
16-30081167-T-A p.Ser272Ser synonymous ALDOA 2 82818 2.41493E-5 41409 0 3.97988E-6
16-30081170-A-T p.Gly273Gly synonymous ALDOA 1 82836 1.2072E-5 41418 0 3.97953E-6
16-30081185-G-C p.Glu278Asp missense ALDOA 6 83050 7.22456E-5 41525 0 2.72863E-4
16-30081191-G-A p.Ala280Ala synonymous ALDOA 4 83068 4.81533E-5 41534 0 1.27494E-4
16-30081205-A-G p.Asn285Ser missense ALDOA 3 83168 3.60716E-5 41584 0 4.95917E-5
16-30081218-G-A p.Lys289Lys synonymous ALDOA 4 83148 4.8107E-5 41574 0 1.65404E-5
16-30081225-C-T p.Leu292Leu synonymous ALDOA 1 83144 1.20273E-5 41572 0 3.97845E-6
16-30081236-C-T p.Pro295Pro synonymous ALDOA 2 83110 2.40645E-5 41555 0 3.97871E-6
16-30081248-C-T p.Thr299Thr synonymous ALDOA 1 83056 1.20401E-5 41528 0 NA
16-30081252-T-C p.Ser301Pro missense ALDOA 1 83016 1.20459E-5 41508 0 NA
16-30081257-C-T p.Tyr302Tyr synonymous ALDOA 35 82926 4.22063E-4 41463 1 2.82925E-4
16-30081258-G-A p.Gly303Ser missense ALDOA 1 82916 1.20604E-5 41458 0 4.99293E-5
16-30081269-G-A p.Leu306Leu synonymous ALDOA 1 82814 1.20753E-5 41407 0 8.35352E-6
16-30081270-C-G p.Gln307Glu missense ALDOA 1 82802 1.2077E-5 41401 0 NA
16-30081279-G-A p.Ala310Thr missense ALDOA 1 82652 1.20989E-5 41326 0 3.99511E-6
16-30081280-C-T p.Ala310Val missense ALDOA 2 82624 2.4206E-5 41312 0 8.3675E-6
16-30081282-C-G p.Leu311Val missense ALDOA 1 82636 1.21013E-5 41318 0 3.99811E-6
16-30081296-C-T p.Gly315Gly synonymous ALDOA 2 82260 2.43132E-5 41130 0 9.56694E-5
16-30081303-A-G p.Lys318Glu missense ALDOA 1 82150 1.21729E-5 41075 0 1.67819E-5
16-30081309-A-T p.Asn320Tyr missense ALDOA 3 82062 3.65577E-5 41031 0 NA
16-30081318-G-T p.Ala323Ser missense ALDOA 1 81892 1.22112E-5 40946 0 1.27445E-4
16-30081323-G-A p.Ala324Ala synonymous ALDOA 13 81764 1.58994E-4 40882 0 6.25E-4
16-30081340-A-G p.Lys330Arg missense ALDOA 1 81688 1.22417E-5 40844 0 9.56145E-5
16-30081342-C-T p.Arg331* stop_gained ALDOA 1 81658 1.22462E-5 40829 0 1.6854E-5
16-30081343-G-A p.Arg331Gln missense ALDOA 3 81682 3.67278E-5 40841 0 4.00692E-6
16-30081349-TGGTAAGGATAGGCAGGAGGTGGGCAGGGTGCCTGGGTGGATGGGACTCGGAGAAGAGCCCTTCTCACTCCACCCCTCTCCCTGCTTA-T p.Ala334fs frameshift ALDOA 15 81732 1.83527E-4 40866 7 8.42758E-6
16-30081358-T-C p.Ile336Thr missense ALDOA 6 81730 7.34125E-5 40865 0 2.00324E-5
16-30081367-G-T p.Arg339Met missense ALDOA 11900 81440 0.14612 40720 1049 0.197271
16-30081379-G-T p.Cys343Phe missense ALDOA 1 81730 1.22354E-5 40865 0 8.39504E-6
16-30081384-G-A p.Gly345Ser missense ALDOA 1 81808 1.22237E-5 40904 0 3.99543E-6
16-30081396-T-G p.Ser349Ala missense ALDOA 1 81992 1.21963E-5 40996 0 NA
16-30081397-C-T p.Ser349Leu missense ALDOA 1 82016 1.21927E-5 41008 0 1.92266E-4
16-30081398-G-A p.Ser349Ser synonymous ALDOA 1 82070 1.21847E-5 41035 0 1.66981E-5
16-30081399-G-A p.Glu350Lys missense ALDOA 1 82114 1.21782E-5 41057 0 1.59398E-4
16-30081422-C-T p.Thr357Thr synonymous ALDOA 7 82730 8.46126E-5 41365 0 1.59337E-4
16-30081427-T-C p.Leu359Pro missense ALDOA 1 82846 1.20706E-5 41423 0 3.98394E-6
16-30081439-C-T p.Ala334Val missense+splice_region ALDOA 4 83014 4.81846E-5 41507 0 8.29119E-6
16-30081454-G-A p.Cys339Tyr missense ALDOA 1 83134 1.20288E-5 41567 0 NA
16-30081455-T-C p.Cys339Cys synonymous ALDOA 2 83130 2.40587E-5 41565 0 3.9808E-6
16-30081458-A-G p.Gln340Gln synonymous ALDOA 19 83158 2.28481E-4 41579 0 5.09781E-4
16-30081469-C-T p.Thr344Ile missense ALDOA 1 83180 1.20221E-5 41590 0 3.97997E-6
16-30081473-G-C p.Pro345Pro synonymous ALDOA 1 83186 1.20213E-5 41593 0 6.3743E-5
16-30081473-G-A p.Pro345Pro synonymous ALDOA 6 83186 7.21275E-5 41593 0 3.18715E-5
16-30081476-C-T p.Ser346Ser synonymous ALDOA 847 83160 0.0101852 41580 65 0.0269407
16-30081477-G-A p.Gly347Ser missense ALDOA 215 83190 0.00258445 41595 0 0.005625
16-30081477-G-T p.Gly347Cys missense ALDOA 2 83190 2.40414E-5 41595 0 7.95887E-6
16-30081490-C-T p.Ala351Val missense ALDOA 3 83172 3.60698E-5 41586 0 8.26392E-6
16-30081492-G-C p.Ala352Pro missense ALDOA 1 83176 1.20227E-5 41588 0 NA
16-30081499-G-C p.Ser354Thr missense ALDOA 1 83180 1.20221E-5 41590 0 8.26351E-6
16-30081500-C-T p.Ser354Ser synonymous ALDOA 1 83174 1.2023E-5 41587 0 2.47901E-5
16-30081512-C-T p.Phe358Phe synonymous ALDOA 4 83156 4.81024E-5 41578 0 5.96796E-5
16-30081513-G-A p.Val359Ile missense ALDOA 7 83136 8.41994E-5 41568 0 3.30568E-5
16-30081515-C-T p.Val359Val synonymous ALDOA 1 83130 1.20294E-5 41565 0 1.6527E-5
16-30081525-G-A p.Ala363Thr missense ALDOA 1 83080 1.20366E-5 41540 0 1.59148E-5
16-30081526-C-T p.Ala363Val missense ALDOA 2 83082 2.40726E-5 41541 0 5.17187E-5
16-30081527-C-T p.Ala363Ala synonymous ALDOA 5 83088 6.01772E-5 41544 0 9.1503E-5
16-30081589-TGAA-T c.*7-7_*7-5delAGA splice_region ALDOA 22 82342 2.67178E-4 41171 0 3.18613E-5
16-30081597-A-T c.*7-2A>T splice_acceptor ALDOA 1 82230 1.2161E-5 41115 0 NA
16-30081599-G-A c.*7G>A splice_region ALDOA 1 82106 1.21794E-5 41053 0 NA
16-30081601-C-T c.*9C>T splice_region ALDOA 1 82058 1.21865E-5 41029 0 1.27397E-4
16-30081700-C-T c.*167C>T splice_region ALDOA 3 73338 4.09065E-5 36669 0 NA
16-30081701-G-A c.*168G>A splice_region ALDOA 8 72874 1.09779E-4 36437 0 NA
16-30081730-G-T c.*197G>T splice_region ALDOA 3 68284 4.39342E-5 34142 0 6.37064E-5
16-30081734-G-T c.*201G>T splice_region ALDOA 1 67608 1.47911E-5 33804 0 3.18451E-5