Variant

Variant ID Consequence Effect Gene AC AN AF NS NHOM maxEAF
1-19199292-G-A c.*41+6C>T splice_region ALDH4A1 1 80346 1.24462E-5 40173 0 1.25932E-4
1-19199299-T-TGGAC c.*36_*39dupGTCC splice_region ALDH4A1 24 81074 2.96026E-4 40537 0 4.78042E-4
1-19199350-A-T p.Tyr561Asn missense ALDH4A1 11 82772 1.32895E-4 41386 0 6.25E-4
1-19199353-C-T p.Ala560Thr missense ALDH4A1 4 82794 4.83127E-5 41397 0 2.47913E-5
1-19199354-G-A p.Tyr559Tyr synonymous ALDH4A1 10 82832 1.20726E-4 41416 0 9.55802E-5
1-19199379-T-C p.His551Arg missense ALDH4A1 1 83084 1.2036E-5 41542 0 3.97842E-6
1-19199380-G-A p.His551Tyr missense ALDH4A1 2 83088 2.40709E-5 41544 0 NA
1-19199381-T-C p.Thr550Thr synonymous ALDH4A1 27 83088 3.24957E-4 41544 1 6.25E-4
1-19199388-T-C p.Lys548Arg missense ALDH4A1 5 83122 6.01525E-5 41561 0 9.56023E-5
1-19199388-TTGA-T p.Ile547del disruptive_inframe_deletion ALDH4A1 1 83122 1.20305E-5 41561 0 8.2496E-6
1-19199390-G-A p.Ile547Ile synonymous ALDH4A1 2 83130 2.40587E-5 41565 0 NA
1-19199395-C-A p.Val546Phe missense ALDH4A1 1 83132 1.20291E-5 41566 0 3.18776E-5
1-19199400-G-A p.Pro544Leu missense ALDH4A1 510 83138 0.00613438 41569 15 0.0110601
1-19199402-C-T p.Ser543Ser synonymous ALDH4A1 8 83146 9.62163E-5 41573 0 4.94968E-5
1-19199403-G-T p.Ser543* stop_gained ALDH4A1 1 83166 1.20241E-5 41583 0 NA
1-19199405-C-T p.Thr542Thr synonymous ALDH4A1 1 83174 1.2023E-5 41587 0 3.29995E-5
1-19199406-G-A p.Thr542Met missense ALDH4A1 1 83178 1.20224E-5 41589 0 1.47184E-4
1-19199413-G-A p.Arg540Cys missense ALDH4A1 5 83158 6.01265E-5 41579 0 1.65003E-5
1-19199419-T-G p.Ile538Leu missense ALDH4A1 2 83156 2.40512E-5 41578 0 NA
1-19199429-G-A p.Gly534Gly synonymous ALDH4A1 1 83144 1.20273E-5 41572 0 1.19387E-5
1-19199448-G-T p.Thr528Asn missense ALDH4A1 1346 82946 0.0162274 41473 22 0.0214081
1-19199448-G-C p.Thr528Ser missense ALDH4A1 1 83044 1.20418E-5 41522 0 NA
1-19199449-T-C p.Thr528Ala missense+splice_region ALDH4A1 2 83042 2.40842E-5 41521 0 NA
1-19199453-T-C c.1580-2A>G splice_acceptor ALDH4A1 3 82982 3.61524E-5 41491 0 3.18512E-5
1-19199455-C-A c.1580-4G>T splice_region ALDH4A1 2 82898 2.4126E-5 41449 0 3.98839E-6
1-19199456-G-A c.1580-5C>T splice_region ALDH4A1 5 82894 6.0318E-5 41447 0 3.18552E-5
1-19200965-C-T p.Arg524Gln missense ALDH4A1 3 82722 3.6266E-5 41361 0 3.18654E-5
1-19200965-CG-C p.Arg524fs frameshift ALDH4A1 1 82722 1.20887E-5 41361 0 3.9992E-6
1-19200966-G-A p.Arg524* stop_gained ALDH4A1 1 82522 1.2118E-5 41261 0 NA
1-19200968-G-GC p.Ala523fs frameshift ALDH4A1 6 82682 7.25672E-5 41341 1 0.00302115
1-19200968-G-GCC p.Ala523fs frameshift ALDH4A1 1 82702 1.20916E-5 41351 0 NA
1-19200968-G-A p.Ala523Val missense ALDH4A1 2 82702 2.41832E-5 41351 0 NA
1-19200969-C-A p.Ala523Ser missense ALDH4A1 3 82670 3.62889E-5 41335 0 1.20436E-5
1-19200971-C-T p.Gly522Glu missense ALDH4A1 2 82894 2.41272E-5 41447 1 NA
1-19200973-C-A p.Gly521Gly synonymous ALDH4A1 1 82926 1.20589E-5 41463 0 3.98839E-6
1-19200974-C-G p.Gly521Ala missense ALDH4A1 3 82932 3.61742E-5 41466 0 4.45945E-4
1-19200974-C-A p.Gly521Val missense ALDH4A1 1 82932 1.20581E-5 41466 0 1.994E-5
1-19200975-C-CA p.Gly521fs frameshift ALDH4A1 2 82886 2.41295E-5 41443 0 1.19653E-5
1-19200988-G-A p.Gly516Gly synonymous ALDH4A1 3540 82856 0.0427247 41428 160 0.0655242
1-19200997-C-T p.Ser513Ser synonymous ALDH4A1 1 83120 1.20308E-5 41560 0 1.19501E-5
1-19200998-G-A p.Ser513Leu missense ALDH4A1 1 83228 1.20152E-5 41614 0 6.37308E-5
1-19201007-G-C p.Ser510Cys missense ALDH4A1 9 83302 1.08041E-4 41651 0 5.03525E-4
1-19201014-C-T p.Asp508Asn missense ALDH4A1 4 83322 4.80065E-5 41661 0 4.11834E-5
1-19201024-G-C p.Phe504Leu missense ALDH4A1 2 83356 2.39935E-5 41678 0 8.23655E-6
1-19201031-C-A p.Gly502Val missense ALDH4A1 3 83352 3.59919E-5 41676 0 3.18512E-5
1-19201032-C-T p.Gly502Ser missense ALDH4A1 1 83354 1.1997E-5 41677 0 3.97693E-6
1-19201033-G-A p.Ala501Ala synonymous ALDH4A1 1 83346 1.19982E-5 41673 0 1.64731E-4
1-19201037-G-C p.Ala500Gly missense ALDH4A1 1 83346 1.19982E-5 41673 0 NA
1-19201053-T-C p.Lys495Glu missense ALDH4A1 2 83334 2.39998E-5 41667 0 8.23683E-6
1-19201057-G-A p.Ala493Ala synonymous ALDH4A1 1 83332 1.20002E-5 41666 0 7.95368E-6
1-19201059-C-T p.Ala493Thr missense ALDH4A1 1 83322 1.20016E-5 41661 0 3.18512E-5
1-19201068-C-G p.Val490Leu missense ALDH4A1 2 83302 2.4009E-5 41651 0 0.00125
1-19201068-C-T p.Val490Met missense ALDH4A1 3 83302 3.60135E-5 41651 0 1.59215E-4
1-19201069-G-C p.Val489Val synonymous ALDH4A1 13 83292 1.56077E-4 41646 0 6.25E-4
1-19201071-C-T p.Val489Ile missense ALDH4A1 8 83296 9.6043E-5 41648 0 0.00151057
1-19201072-G-A p.Asp488Asp synonymous ALDH4A1 8 83288 9.60523E-5 41644 0 2.38654E-5
1-19201899-C-T p.Thr479Thr synonymous ALDH4A1 2 83270 2.40183E-5 41635 0 5.04032E-4
1-19201900-G-A p.Thr479Met missense ALDH4A1 1 83260 1.20106E-5 41630 0 1.98826E-5
1-19201909-T-C p.Tyr476Cys missense ALDH4A1 1 83270 1.20091E-5 41635 0 NA
1-19201919-T-C p.Thr473Ala missense ALDH4A1 3655 83186 0.0439377 41593 170 0.0676085
1-19201928-C-T p.Val470Ile missense ALDH4A1 8724 83178 0.104883 41589 535 0.128128
1-19201929-C-T p.Leu469Leu synonymous ALDH4A1 1 83266 1.20097E-5 41633 0 NA
1-19201933-T-C p.Gln468Arg missense ALDH4A1 2 83264 2.402E-5 41632 0 NA
1-19201938-C-T p.Thr466Thr synonymous ALDH4A1 3 83272 3.60265E-5 41636 0 3.18857E-5
1-19201938-C-A p.Thr466Thr synonymous ALDH4A1 8 83272 9.60707E-5 41636 0 9.56572E-5
1-19201939-G-A p.Thr466Met missense ALDH4A1 5 83272 6.00442E-5 41636 1 1.27543E-4
1-19201942-T-A p.Glu465Val missense ALDH4A1 1 83266 1.20097E-5 41633 0 NA
1-19201951-T-G p.Lys462Thr missense ALDH4A1 87 83248 0.00104507 41624 0 0.00200906
1-19201955-C-T p.Asp461Asn missense ALDH4A1 9 83242 1.08118E-4 41621 0 6.76036E-5
1-19201956-A-G p.Asp460Asp synonymous ALDH4A1 60123 82732 0.72672 41366 21834 0.7475
1-19201956-A-T p.Asp460Glu missense ALDH4A1 1 83234 1.20143E-5 41617 0 NA
1-19201959-C-G p.Pro459Pro synonymous ALDH4A1 26 83236 3.12365E-4 41618 0 2.8234E-4
1-19201959-C-T p.Pro459Pro synonymous ALDH4A1 3 83236 3.60421E-5 41618 0 8.24022E-6
1-19201960-G-A p.Pro459Leu missense ALDH4A1 2 83246 2.40252E-5 41623 0 6.37796E-5
1-19201967-C-T p.Val457Ile missense ALDH4A1 2 83226 2.4031E-5 41613 0 3.97662E-5
1-19201967-C-G p.Val457Leu missense ALDH4A1 1 83226 1.20155E-5 41613 0 8.24117E-6
1-19201968-G-A p.Tyr456Tyr synonymous ALDH4A1 5 83222 6.00803E-5 41611 0 9.56755E-5
1-19201978-A-G p.Leu453Pro missense ALDH4A1 2 83216 2.40338E-5 41608 0 2.47284E-5
1-19201980-T-C p.Val452Val synonymous ALDH4A1 1 83196 1.20198E-5 41598 0 3.9769E-6
1-19201983-A-G p.Pro451Pro synonymous ALDH4A1 1 83182 1.20218E-5 41591 0 3.18776E-5
1-19201989-G-A p.Phe449Phe synonymous ALDH4A1 6 83122 7.21831E-5 41561 0 3.18878E-5
1-19201992-G-A p.Ile448Ile synonymous ALDH4A1 1 83122 1.20305E-5 41561 0 NA
1-19201999-T-TCCTTCATGATGGGCTCCTGAGGGTCCTTGCTCTCCACGATGC c.1339-3_1339-2insGCATCGTGGAGAGCAAGGACCCTCAGGAGCCCATCATGAAGG splice_region ALDH4A1 1 83074 1.20375E-5 41537 0 NA
1-19201999-T-TCCTTCATGATGGGCTCCTGAGGGTCCTTGCTCTCC c.1339-3_1339-2insGGAGAGCAAGGACCCTCAGGAGCCCATCATGAAGG splice_region ALDH4A1 2 83074 2.40749E-5 41537 1 NA
1-19201999-T-TCCTTCATGATGGGCTCCTG c.1339-3_1339-2insCAGGAGCCCATCATGAAGG splice_region ALDH4A1 1 83074 1.20375E-5 41537 0 NA
1-19202803-A-G c.1338+6T>C splice_region ALDH4A1 1 82286 1.21527E-5 41143 0 8.27513E-6
1-19202812-C-T p.Lys445Lys synonymous ALDH4A1 2 82450 2.42571E-5 41225 0 NA
1-19202820-TG-T p.Ile443fs frameshift ALDH4A1 4 82498 4.8486E-5 41249 0 1.91168E-4
1-19202824-C-A p.Glu441Asp missense ALDH4A1 2 82518 2.42371E-5 41259 0 NA
1-19202836-C-T p.Lys437Lys synonymous ALDH4A1 2 82480 2.42483E-5 41240 0 NA
1-19202847-C-A p.Val434Leu missense ALDH4A1 4 82286 4.86109E-5 41143 0 2.47991E-5
1-19202855-G-T p.Pro431His missense ALDH4A1 2 82130 2.43516E-5 41065 0 3.18431E-5
1-19202866-G-A p.Tyr427Tyr synonymous ALDH4A1 1 81886 1.22121E-5 40943 0 1.24172E-4
1-19202874-C-T p.Val425Met missense ALDH4A1 1 81660 1.22459E-5 40830 0 1.19588E-5
1-19202875-G-A p.Ser424Ser synonymous ALDH4A1 17 81616 2.08292E-4 40808 0 0.0010142
1-19202876-G-T p.Ser424Tyr missense ALDH4A1 1 81650 1.22474E-5 40825 0 8.28954E-6
1-19202886-A-G p.Cys421Arg missense ALDH4A1 107 81476 0.00131327 40738 0 0.00164704
1-19202891-C-T p.Gly419Asp missense ALDH4A1 2 81448 2.45555E-5 40724 0 3.59675E-5
1-19202891-C-A p.Gly419Val missense ALDH4A1 1 81448 1.22778E-5 40724 0 NA
1-19202895-C-G p.Gly418Arg missense ALDH4A1 12 81368 1.47478E-4 40684 0 6.25E-4
1-19202896-G-A p.Ala417Ala synonymous ALDH4A1 39260 80726 0.486336 40363 9673 0.5175
1-19202907-T-C p.Thr414Ala missense ALDH4A1 1 81208 1.23141E-5 40604 0 1.7092E-5
1-19202911-G-C p.Ser412Arg missense ALDH4A1 7 81136 8.62749E-5 40568 0 4.27402E-5
1-19202911-G-T p.Ser412Arg missense ALDH4A1 8 81136 9.85999E-5 40568 0 1.59286E-4
1-19202916-G-A p.Pro411Ser missense ALDH4A1 2 81066 2.46713E-5 40533 0 1.22255E-5
1-19202917-T-C p.Ser410Ser synonymous ALDH4A1 54258 80096 0.677412 40048 18531 0.702448
1-19202921-G-A p.Ser409Phe missense ALDH4A1 3 80918 3.70746E-5 40459 0 9.20285E-6
1-19202924-CGT-TGC p.AlaArg407AlaHis missense ALDH4A1 1 80764 1.23818E-5 40382 0 NA
1-19202925-G-A p.Arg408Cys missense ALDH4A1 5 80750 6.19195E-5 40375 1 5.16529E-4
1-19202926-T-C p.Ala407Ala synonymous ALDH4A1 54051 79870 0.676737 39935 18456 0.706079
1-19202926-TGC-CGT p.Ala407Thr missense ALDH4A1 1 80704 1.2391E-5 40352 0 NA
1-19202928-C-T p.Ala407Thr missense ALDH4A1 1 80620 1.24039E-5 40310 0 4.26203E-6
1-19202928-C-A p.Ala407Ser missense ALDH4A1 3 80620 3.72116E-5 40310 0 3.18715E-5
1-19202929-G-A p.His406His synonymous ALDH4A1 175 80648 0.00216992 40324 1 0.00398546
1-19202931-G-A p.His406Tyr missense ALDH4A1 1 80522 1.2419E-5 40261 0 3.18593E-5
1-19202951-C-T p.Arg399His missense ALDH4A1 7 80682 8.67604E-5 40341 0 6.25782E-4
1-19202952-G-A p.Arg399Cys missense ALDH4A1 4 80698 4.95675E-5 40349 0 1.24274E-4
1-19202966-G-A c.1186-5C>T splice_region ALDH4A1 1 80514 1.24202E-5 40257 0 1.84672E-5
1-19203698-G-T c.1185+4C>A splice_region ALDH4A1 5 82292 6.07592E-5 41146 0 2.52998E-5
1-19203698-G-A c.1185+4C>T splice_region ALDH4A1 4 82292 4.86074E-5 41146 1 1.24965E-5
1-19203699-T-C c.1185+3A>G splice_region ALDH4A1 1 82318 1.2148E-5 41159 0 3.18776E-5
1-19203702-C-A p.Lys395Asn missense+splice_region ALDH4A1 3 82378 3.64175E-5 41189 0 1.00432E-4
1-19203721-GAGA-G p.Phe388del disruptive_inframe_deletion ALDH4A1 2 82390 2.42748E-5 41195 0 1.26897E-5
1-19203725-A-G p.Phe388Leu missense ALDH4A1 1671 82366 0.0202875 41183 31 0.045625
1-19203726-G-A p.Phe387Phe synonymous ALDH4A1 1 82378 1.21392E-5 41189 0 NA
1-19203729-G-A p.Thr386Thr synonymous ALDH4A1 2 82348 2.42872E-5 41174 0 NA
1-19203747-A-G p.Pro380Pro splice_region+synonymous ALDH4A1 1 82160 1.21714E-5 41080 0 5.04032E-4
1-19203751-TGGAGGCAAG-T c.1138-11_1138-3delCTTGCCTCC splice_region ALDH4A1 4 82146 4.86938E-5 41073 0 NA
1-19203753-G-A c.1138-4C>T splice_region ALDH4A1 3 82150 3.65186E-5 41075 0 1.42312E-5
1-19203755-G-A c.1138-6C>T splice_region ALDH4A1 2 82128 2.43522E-5 41064 0 2.84835E-5
1-19203905-C-T c.1137+5G>A splice_region ALDH4A1 1 80640 1.24008E-5 40320 0 NA
1-19203909-C-T c.1137+1G>A splice_donor ALDH4A1 1 80746 1.23845E-5 40373 0 5.51092E-6
1-19203910-G-A p.Asp379Asp splice_region+synonymous ALDH4A1 31 80722 3.84034E-4 40361 0 0.00558943
1-19203913-G-A p.Gly378Gly synonymous ALDH4A1 1 80792 1.23775E-5 40396 0 5.39357E-6
1-19203913-G-T p.Gly378Gly synonymous ALDH4A1 2 80792 2.47549E-5 40396 0 NA
1-19203914-C-T p.Gly378Asp missense ALDH4A1 4 80896 4.94462E-5 40448 0 NA
1-19203921-T-C p.Lys376Glu missense ALDH4A1 6 81102 7.39809E-5 40551 1 1.02524E-5
1-19203926-C-T p.Arg374Gln missense ALDH4A1 1 81166 1.23204E-5 40583 0 5.01595E-6
1-19203927-G-A p.Arg374Trp missense ALDH4A1 1 81174 1.23192E-5 40587 0 3.26264E-5
1-19203947-C-T p.Arg367Gln missense ALDH4A1 1 81370 1.22895E-5 40685 0 2.61794E-5
1-19203949-C-T p.Gly366Gly synonymous ALDH4A1 60 81386 7.37228E-4 40693 0 0.0015213
1-19203951-C-T p.Gly366Arg missense ALDH4A1 260 81378 0.00319497 40689 0 0.015
1-19203954-T-G p.Lys365Gln missense ALDH4A1 4 81368 4.91594E-5 40684 0 2.38107E-5
1-19203961-C-T p.Pro362Pro synonymous ALDH4A1 2371 81350 0.0291457 40675 42 0.0462212
1-19203961-C-G p.Pro362Pro synonymous ALDH4A1 1 81400 1.2285E-5 40700 0 3.18695E-5
1-19203961-C-A p.Pro362Pro synonymous ALDH4A1 1 81400 1.2285E-5 40700 0 NA
1-19203965-C-G p.Trp361Ser missense ALDH4A1 7 81468 8.59233E-5 40734 0 5.07099E-4
1-19203966-A-C p.Trp361Gly missense ALDH4A1 1 81440 1.2279E-5 40720 0 3.18492E-5
1-19203970-C-G p.Ser359Ser synonymous ALDH4A1 6 81436 7.36775E-5 40718 0 5.06586E-4
1-19203974-T-C p.His358Arg missense ALDH4A1 86 81428 0.00105615 40714 3 7.90514E-4
1-19203977-G-A p.Pro357Leu missense ALDH4A1 1 81506 1.2269E-5 40753 0 1.8044E-5
1-19203983-TAG-T p.Tyr355fs frameshift ALDH4A1 1 81580 1.22579E-5 40790 0 1.65893E-5
1-19203985-G-A p.Leu354Leu synonymous ALDH4A1 1 81636 1.22495E-5 40818 0 6.37227E-5
1-19203991-C-T p.Ser352Ser synonymous ALDH4A1 1 81588 1.22567E-5 40794 0 3.18552E-5
1-19203992-G-A p.Ser352Leu missense ALDH4A1 8 81618 9.80176E-5 40809 0 1.91217E-4
1-19203997-C-G p.Ala350Ala synonymous ALDH4A1 56224 81060 0.69361 40530 19667 0.719862
1-19203997-CGC-GGA p.Ala350Ser missense ALDH4A1 4 81678 4.89728E-5 40839 0 NA
1-19203997-CGC-GGT p.Ala350Thr missense ALDH4A1 1 81678 1.22432E-5 40839 0 NA
1-19203999-C-A p.Ala350Ser missense ALDH4A1 5 81658 6.1231E-5 40829 0 1.12602E-4
1-19203999-C-T p.Ala350Thr missense ALDH4A1 3 81658 3.67386E-5 40829 0 3.30677E-5
1-19204000-G-A p.Ser349Ser synonymous ALDH4A1 1 81690 1.22414E-5 40845 0 3.75016E-5
1-19204006-C-T p.Lys347Lys synonymous ALDH4A1 1 81728 1.22357E-5 40864 0 9.40003E-5
1-19204012-G-A p.Gly345Gly synonymous ALDH4A1 1 81676 1.22435E-5 40838 0 4.0708E-6
1-19204018-G-A p.Tyr343Tyr synonymous ALDH4A1 1 81716 1.22375E-5 40858 0 3.18654E-5
1-19204022-T-C p.Glu342Gly missense ALDH4A1 1 81678 1.22432E-5 40839 0 NA
1-19204024-G-T p.Phe341Leu missense ALDH4A1 1 81622 1.22516E-5 40811 0 NA
1-19204024-G-A p.Phe341Phe synonymous ALDH4A1 2 81622 2.45032E-5 40811 0 9.10482E-6
1-19204024-G-C p.Phe341Leu missense ALDH4A1 1 81622 1.22516E-5 40811 0 3.18857E-5
1-19204033-G-C p.Arg338Arg synonymous ALDH4A1 1 81380 1.2288E-5 40690 0 4.03825E-6
1-19204038-G-C p.Leu337Val missense ALDH4A1 1 81278 1.23035E-5 40639 0 4.042E-6
1-19204042-C-G p.Gly335Gly synonymous ALDH4A1 3 81124 3.69804E-5 40562 0 8.97602E-6
1-19204053-C-T p.Val332Met missense ALDH4A1 1 80696 1.23922E-5 40348 0 8.97827E-6
1-19204054-G-A p.Ser331Ser synonymous ALDH4A1 1 80568 1.24119E-5 40284 0 8.97731E-6
1-19204058-T-C p.Glu330Gly missense ALDH4A1 1 80450 1.24301E-5 40225 0 4.05495E-6
1-19204062-C-T p.Val329Met missense ALDH4A1 1 80168 1.24738E-5 40084 0 1.80398E-5
1-19204063-G-A p.Asp328Asp synonymous ALDH4A1 4 79978 5.00138E-5 39989 0 7.31654E-5
1-19204070-G-A p.Ser326Leu missense ALDH4A1 6 79488 7.54831E-5 39744 0 3.20287E-5
1-19204080-C-T p.Val323Met missense ALDH4A1 5 78904 6.33681E-5 39452 0 6.25782E-4
1-19204080-C-A p.Val323Leu missense ALDH4A1 1 78904 1.26736E-5 39452 0 NA
1-19204080-C-G p.Val323Leu missense ALDH4A1 1 78904 1.26736E-5 39452 0 NA
1-19204081-G-A p.Phe322Phe synonymous ALDH4A1 2 78846 2.53659E-5 39423 0 9.61477E-5
1-19204082-AAGTGG-A p.His321fs frameshift ALDH4A1 3 78752 3.80943E-5 39376 0 3.20986E-5
1-19204086-G-T p.His321Asn missense ALDH4A1 3 78574 3.81806E-5 39287 0 3.20287E-5
1-19204099-G-A p.Gly316Gly synonymous ALDH4A1 1 77630 1.28816E-5 38815 0 1.90415E-5
1-19204101-C-T p.Gly316Ser missense ALDH4A1 3 77370 3.87747E-5 38685 0 NA
1-19204104-A-C p.Cys315Gly missense+splice_region ALDH4A1 2 77128 2.59309E-5 38564 0 8.41411E-6
1-19204107-CTACAGGGGTCGGGGGTGGGG-C c.941-21_941-2delCCCCACCCCCGACCCCTGTA splice_acceptor ALDH4A1 4 77048 5.19157E-5 38524 0 NA
1-19204110-C-T c.941-4G>A splice_region ALDH4A1 1 76776 1.30249E-5 38388 0 1.96796E-5
1-19204110-CAGGGGTCGGGGGTGGGG-C c.941-21_941-5delCCCCACCCCCGACCCCT splice_region ALDH4A1 1 76774 1.30252E-5 38387 0 NA
1-19204111-AGGGGTCGGGGGTGGGG-A c.941-21_941-6delCCCCACCCCCGACCCC splice_region ALDH4A1 1 76710 1.30361E-5 38355 0 NA
1-19205805-C-T p.Arg310His missense ALDH4A1 1 81770 1.22294E-5 40885 0 0.00101317
1-19205806-G-A p.Arg310Cys missense ALDH4A1 2 81800 2.44499E-5 40900 0 5.63698E-5
1-19205810-G-A p.Phe308Phe synonymous ALDH4A1 3 81840 3.66569E-5 40920 0 4.14879E-6
1-19205813-G-T p.Thr307Thr synonymous ALDH4A1 1 81834 1.22199E-5 40917 0 NA
1-19205816-G-A p.His306His synonymous ALDH4A1 1 81850 1.22175E-5 40925 0 NA
1-19205827-C-G p.Asp303His missense ALDH4A1 1 81906 1.22091E-5 40953 0 NA
1-19205848-T-C p.Lys296Glu missense ALDH4A1 3 81866 3.66452E-5 40933 0 3.61437E-5
1-19205860-T-G p.Lys292Gln missense ALDH4A1 5 81824 6.11068E-5 40912 0 2.4417E-5
1-19205860-T-C p.Lys292Glu missense ALDH4A1 1 81824 1.22214E-5 40912 0 NA
1-19208191-T-C c.866+3A>G splice_region ALDH4A1 1 82930 1.20584E-5 41465 0 NA
1-19208193-C-T c.866+1G>A splice_donor ALDH4A1 3 82952 3.61655E-5 41476 0 6.76703E-5
1-19208194-G-A p.Pro289Leu missense+splice_region ALDH4A1 1 82944 1.20563E-5 41472 0 0.00125
1-19208208-G-T p.Phe284Leu missense ALDH4A1 1 83052 1.20406E-5 41526 0 8.26282E-6
1-19208218-C-A p.Gly281Val missense ALDH4A1 1 83058 1.20398E-5 41529 0 NA
1-19208225-G-A p.Leu279Phe missense ALDH4A1 1 83076 1.20372E-5 41538 0 NA
1-19208226-G-A p.His278His synonymous ALDH4A1 1 83072 1.20378E-5 41536 0 3.18654E-5
1-19208228-G-A p.His278Tyr missense ALDH4A1 1 83046 1.20415E-5 41523 0 6.37146E-5
1-19208232-T-C p.Ser276Ser synonymous ALDH4A1 1 83064 1.20389E-5 41532 0 7.95748E-6
1-19208232-T-A p.Ser276Ser synonymous ALDH4A1 1 83064 1.20389E-5 41532 0 3.30732E-5
1-19208243-C-T p.Val273Ile missense ALDH4A1 1 83070 1.2038E-5 41535 0 9.55536E-5
1-19208247-G-A p.Asp271Asp synonymous ALDH4A1 2 83050 2.40819E-5 41525 0 1.35288E-4
1-19208256-TA-T p.Leu268fs frameshift ALDH4A1 1 83018 1.20456E-5 41509 0 NA
1-19208260-G-A p.Pro267Leu missense ALDH4A1 6 83002 7.22874E-5 41501 0 1.27413E-4
1-19208273-G-A p.Pro263Ser missense ALDH4A1 2 82996 2.40975E-5 41498 0 1.65826E-5
1-19208290-T-C p.Asn257Ser missense ALDH4A1 3 82976 3.6155E-5 41488 0 4.15207E-5
1-19208293-G-C p.Pro256Arg missense ALDH4A1 13 82992 1.56642E-4 41496 0 2.86606E-4
1-19208297-G-A p.Pro255Ser missense ALDH4A1 1 82956 1.20546E-5 41478 0 8.31463E-6
1-19208311-C-T p.Arg250Gln missense ALDH4A1 4 82942 4.82265E-5 41471 0 2.3903E-5
1-19208312-G-A p.Arg250Trp missense ALDH4A1 3 82946 3.61681E-5 41473 0 6.66544E-5
1-19208315-G-A p.Leu249Phe missense ALDH4A1 1 82974 1.2052E-5 41487 0 NA
1-19208316-G-A p.Ile248Ile synonymous ALDH4A1 662 82930 0.00798264 41465 19 0.016947
1-19208320-C-A p.Arg247Leu missense ALDH4A1 17 82938 2.04972E-4 41469 1 0.00125
1-19208321-G-A p.Arg247Cys missense ALDH4A1 6 82938 7.23432E-5 41469 0 1.00162E-4
1-19208339-C-A p.Ala241Ser missense ALDH4A1 1 82874 1.20665E-5 41437 0 3.9846E-6
1-19208346-G-T p.Ala238Ala synonymous ALDH4A1 3 82840 3.62144E-5 41420 0 6.37227E-5
1-19208348-C-T p.Ala238Thr missense ALDH4A1 7 82812 8.45288E-5 41406 0 3.18552E-5
1-19208361-C-T p.Lys233Lys synonymous ALDH4A1 1 82702 1.20916E-5 41351 0 3.98813E-6
1-19208362-T-C p.Lys233Arg missense ALDH4A1 12 82698 1.45106E-4 41349 0 1.10269E-4
1-19208367-T-C p.Leu231Leu synonymous ALDH4A1 3 82636 3.63038E-5 41318 0 8.55315E-6
1-19208375-C-T p.Val229Met missense ALDH4A1 1 82430 1.21315E-5 41215 0 1.59916E-5
1-19208376-G-A p.Asn228Asn synonymous ALDH4A1 1 82398 1.21362E-5 41199 0 3.18695E-5
1-19208380-C-G p.Gly227Ala missense+splice_region ALDH4A1 2 82244 2.43179E-5 41122 0 8.82784E-6
1-19208387-C-T c.679-6G>A splice_region ALDH4A1 11 81972 1.34192E-4 40986 0 3.18796E-5
1-19208388-G-A c.679-7C>T splice_region ALDH4A1 9 81912 1.09874E-4 40956 0 9.56816E-5
1-19209055-T-G n.484A>C splice_region ALDH4A1 1 52450 1.90658E-5 26225 0 NA
1-19209166-G-T n.373C>A splice_region ALDH4A1 1 52432 1.90723E-5 26216 0 NA
1-19209615-C-T c.678+3G>A splice_region ALDH4A1 501 82188 0.00609578 41094 1 0.005625
1-19209618-C-T p.Met226Ile missense+splice_region ALDH4A1 2 82254 2.43149E-5 41127 0 NA
1-19209624-G-A p.Ala224Ala synonymous ALDH4A1 1 82304 1.21501E-5 41152 0 NA
1-19209629-G-C p.Pro223Ala missense ALDH4A1 3 82360 3.64254E-5 41180 0 6.36943E-5
1-19209636-C-T p.Ala220Ala synonymous ALDH4A1 1 82592 1.21077E-5 41296 0 3.18492E-5
1-19209637-G-A p.Ala220Val missense ALDH4A1 5 82574 6.05517E-5 41287 0 3.61075E-5
1-19209643-T-C p.Asn218Ser missense ALDH4A1 2 82650 2.41984E-5 41325 0 NA
1-19209647-C-T p.Gly217Ser missense ALDH4A1 6 82680 7.25689E-5 41340 0 6.37024E-5
1-19209648-G-A p.Gly216Gly synonymous ALDH4A1 147 82686 0.00177781 41343 2 0.00385449
1-19209650-C-T p.Gly216Ser missense ALDH4A1 2 82706 2.4182E-5 41353 0 8.46253E-6
1-19209651-G-A p.Ile215Ile synonymous ALDH4A1 6 82726 7.25286E-5 41363 0 4.80658E-5
1-19209657-A-G p.Thr213Thr synonymous ALDH4A1 3 82746 3.62555E-5 41373 0 1.20112E-5
1-19209672-C-T p.Ser208Ser synonymous ALDH4A1 4 82642 4.84015E-5 41321 0 3.18532E-5
1-19209673-G-A p.Ser208Leu missense ALDH4A1 3 82688 3.6281E-5 41344 0 2.40414E-5
1-19209681-C-T p.Ala205Ala synonymous ALDH4A1 1 82648 1.20995E-5 41324 0 3.18492E-5
1-19209682-G-A p.Ala205Val missense ALDH4A1 6 82642 7.26023E-5 41321 0 1.09764E-4
1-19209686-C-T p.Val204Met missense ALDH4A1 9 82624 1.08927E-4 41312 0 9.61123E-5
1-19209687-G-A p.Phe203Phe synonymous ALDH4A1 2 82646 2.41996E-5 41323 0 5.03525E-4
1-19209691-CCCTGGGGAAGGAGGCAGCGGTGAGATCAGGCCCATGGCATTGGGCTGCCCCGCCTGCTCGCCCACTGCCTCCTGCAGGTA-C p.Gly202fs frameshift ALDH4A1 11 82608 1.33159E-4 41304 5 NA
1-19209766-C-T c.603+7G>A splice_region ALDH4A1 1 82014 1.2193E-5 41007 0 NA
1-19209780-C-G p.Gly199Ala missense ALDH4A1 2 82118 2.43552E-5 41059 0 4.20048E-5
1-19209780-C-T p.Gly199Asp missense ALDH4A1 3 82118 3.65328E-5 41059 0 5.19763E-5
1-19209783-C-T p.Arg198Gln missense ALDH4A1 6 82136 7.30496E-5 41068 0 5.59696E-5
1-19209784-G-A p.Arg198Trp missense ALDH4A1 1 82120 1.21773E-5 41060 0 4.19992E-5
1-19209786-T-A p.Tyr197Phe missense ALDH4A1 1 82112 1.21785E-5 41056 0 3.99703E-6
1-19209791-C-T p.Thr195Thr synonymous ALDH4A1 1 82204 1.21649E-5 41102 0 8.39335E-6
1-19209792-G-A p.Thr195Met missense ALDH4A1 399 82202 0.0048539 41101 15 0.0084681
1-19209799-T-G p.Asn193His missense ALDH4A1 1 82290 1.21521E-5 41145 0 NA
1-19209804-C-G p.Ser191Thr missense ALDH4A1 1 82302 1.21504E-5 41151 0 3.1835E-5
1-19209806-C-T p.Pro190Pro synonymous ALDH4A1 5 82314 6.0743E-5 41157 0 7.99022E-6
1-19209807-G-A p.Pro190Leu missense ALDH4A1 3 82374 3.64193E-5 41187 0 2.51501E-5
1-19209811-G-A p.Pro189Ser missense ALDH4A1 2 82384 2.42766E-5 41192 0 NA
1-19209814-C-T p.Val188Met missense ALDH4A1 4 82456 4.85107E-5 41228 0 2.79441E-5
1-19209819-A-G p.Ile186Thr missense ALDH4A1 2 82574 2.42207E-5 41287 0 6.36902E-5
1-19209832-C-A p.Gly182Trp missense ALDH4A1 1 82698 1.20922E-5 41349 0 2.50924E-5
1-19209834-T-C p.Glu181Gly missense ALDH4A1 1 82708 1.20907E-5 41354 0 NA
1-19209842-C-T p.Val178Val synonymous ALDH4A1 1 82764 1.20825E-5 41382 0 3.98715E-6
1-19209846-G-A p.Ala177Val missense ALDH4A1 4 82802 4.8308E-5 41401 0 1.33795E-4
1-19209853-TG-T p.Lys175fs frameshift ALDH4A1 1 82862 1.20683E-5 41431 0 NA
1-19209862-A-G p.Phe172Leu missense ALDH4A1 1 82876 1.20662E-5 41438 0 NA
1-19209864-C-T p.Arg171Gln missense ALDH4A1 1 82908 1.20616E-5 41454 0 3.18471E-5
1-19209865-G-A p.Arg171Trp missense ALDH4A1 2 82910 2.41225E-5 41455 0 6.36943E-5
1-19209874-C-T p.Asp168Asn missense ALDH4A1 2 82908 2.41231E-5 41454 0 8.36078E-6
1-19209875-G-A p.Ile167Ile synonymous ALDH4A1 6 82916 7.23624E-5 41458 0 3.34454E-5
1-19209885-G-A p.Ala164Val missense ALDH4A1 4 82886 4.82591E-5 41443 0 6.25E-4
1-19209886-C-G p.Ala164Pro missense ALDH4A1 2 82892 2.41278E-5 41446 0 9.55231E-5
1-19209889-C-T p.Ala163Thr missense ALDH4A1 6 82892 7.23833E-5 41446 0 5.03525E-4
1-19209892-C-T p.Ala162Thr missense ALDH4A1 6 82872 7.24008E-5 41436 0 4.18866E-5
1-19209893-G-A p.Asp161Asp synonymous ALDH4A1 14 82874 1.68931E-4 41437 0 7.17881E-5
1-19209897-A-G p.Ile160Thr missense ALDH4A1 1 82876 1.20662E-5 41438 0 1.67625E-5
1-19209902-C-T p.Ala158Ala synonymous ALDH4A1 3 82846 3.62118E-5 41423 0 4.38855E-5
1-19209913-C-T p.Val155Met missense ALDH4A1 2 82744 2.41709E-5 41372 0 1.19804E-5
1-19209917-C-T p.Lys153Lys synonymous ALDH4A1 1 82692 1.20931E-5 41346 0 2.79676E-5
1-19209925-G-GTCC c.454-4_454-3insGGA splice_region ALDH4A1 2 82546 2.42289E-5 41273 1 NA
1-19211950-GCCCACCAGCACCTCACCTGT-G p.Gln151fs frameshift ALDH4A1 1 74024 1.35091E-5 37012 0 NA
1-19211957-AGCA-CCCC c.453+7_453+10delTGCTinsGGGG splice_region ALDH4A1 1 76072 1.31454E-5 38036 0 NA
1-19211958-G-GCCC c.453+8_453+9insGGG splice_region ALDH4A1 1 76184 1.31261E-5 38092 0 NA
1-19211960-A-C c.453+7T>G splice_region ALDH4A1 4 76306 5.24205E-5 38153 0 4.12754E-5
1-19211961-C-A c.453+6G>T splice_region ALDH4A1 1 76830 1.30157E-5 38415 0 NA
1-19211965-A-C c.453+2T>G splice_donor ALDH4A1 1 77252 1.29446E-5 38626 0 4.73922E-5
1-19211985-G-A p.Ala145Ala synonymous ALDH4A1 1 79338 1.26043E-5 39669 0 NA
1-19211986-G-A p.Ala145Val missense ALDH4A1 2 79394 2.51908E-5 39697 0 NA
1-19211987-C-T p.Ala145Thr missense ALDH4A1 283 79426 0.00356307 39713 5 0.00832241
1-19211988-G-A p.Leu144Leu synonymous ALDH4A1 2 79670 2.51036E-5 39835 0 3.99233E-5
1-19211999-C-T p.Ala141Thr missense ALDH4A1 17 80446 2.11322E-4 40223 0 2.2642E-4
1-19212005-G-A p.Arg139Cys missense ALDH4A1 1 80738 1.23857E-5 40369 0 6.4433E-5
1-19212006-C-T p.Pro138Pro synonymous ALDH4A1 6 80834 7.42262E-5 40417 0 7.7594E-4
1-19212007-G-A p.Pro138Leu missense ALDH4A1 138 80936 0.00170505 40468 1 0.00330352
1-19212008-G-A p.Pro138Ser missense ALDH4A1 1 81032 1.23408E-5 40516 0 4.4482E-6
1-19212010-C-T p.Gly137Glu missense ALDH4A1 1 81214 1.23131E-5 40607 0 NA
1-19212016-A-G p.Leu135Pro missense ALDH4A1 1 81472 1.22742E-5 40736 0 NA
1-19212020-T-G p.Met134Leu missense ALDH4A1 1 81576 1.22585E-5 40788 0 4.25307E-6
1-19212027-C-T p.Ala131Ala synonymous ALDH4A1 1 81654 1.22468E-5 40827 0 3.31148E-5
1-19212028-G-A p.Ala131Val missense ALDH4A1 3 81660 3.67377E-5 40830 0 1.2789E-4
1-19212034-A-C p.Leu129Arg missense ALDH4A1 2 81852 2.44343E-5 40926 0 NA
1-19212049-C-G p.Arg124Pro missense ALDH4A1 1 81986 1.21972E-5 40993 0 NA
1-19212050-G-T p.Arg124Arg synonymous ALDH4A1 1 82006 1.21942E-5 41003 0 3.19E-5
1-19212051-G-C p.Asp123Glu missense ALDH4A1 50 81996 6.09786E-4 40998 0 0.00101215
1-19212053-C-T p.Asp123Asn missense ALDH4A1 1 82044 1.21886E-5 41022 0 NA
1-19212059-T-C p.Ile121Val missense ALDH4A1 1 82124 1.21767E-5 41062 0 2.41101E-5
1-19212079-T-A p.Lys114Ile missense ALDH4A1 1 82166 1.21705E-5 41083 0 4.00545E-6
1-19212082-C-T p.Arg113Gln missense ALDH4A1 3 82156 3.65159E-5 41078 0 6.251E-5
1-19212083-G-A p.Arg113Trp missense ALDH4A1 2 82138 2.43493E-5 41069 0 8.02168E-5
1-19212086-C-T p.Ala112Thr missense ALDH4A1 2 82164 2.43416E-5 41082 0 2.00269E-5
1-19212099-C-T p.Glu107Glu synonymous ALDH4A1 1 82202 1.21652E-5 41101 0 NA
1-19212103-A-G p.Ile106Thr missense ALDH4A1 2 82150 2.43457E-5 41075 0 3.18613E-5
1-19212112-T-C p.Asn103Ser missense ALDH4A1 1 82128 1.21761E-5 41064 0 8.57089E-6
1-19212116-G-T p.Leu102Ile missense ALDH4A1 1 82102 1.218E-5 41051 0 3.18654E-5
1-19212951-C-T c.297+7G>A splice_region ALDH4A1 1 83210 1.20178E-5 41605 0 8.27486E-6
1-19212964-T-C p.Ala97Ala synonymous ALDH4A1 2 83258 2.40217E-5 41629 0 NA
1-19212991-T-C p.Gly88Gly synonymous ALDH4A1 4 83264 4.804E-5 41632 0 NA
1-19212996-G-A p.His87Tyr missense ALDH4A1 1 83256 1.20111E-5 41628 0 NA
1-19213012-G-A c.250-7C>T splice_region ALDH4A1 1 83222 1.20161E-5 41611 0 NA
1-19215861-C-T p.Val82Met missense ALDH4A1 63 81380 7.74146E-4 40690 0 0.00191083
1-19215867-A-G p.Tyr80His missense ALDH4A1 2 81384 2.45749E-5 40692 0 NA
1-19215873-C-T p.Val78Met missense ALDH4A1 15 81366 1.84352E-4 40683 0 0.001875
1-19215877-C-T p.Ser76Ser synonymous ALDH4A1 247 81382 0.00303507 40691 0 0.0027063
1-19215878-G-A p.Ser76Leu missense ALDH4A1 2 81384 2.45749E-5 40692 0 6.37024E-5
1-19215880-C-T p.Thr75Thr synonymous ALDH4A1 157 81388 0.00192903 40694 0 0.00417197
1-19215897-C-T p.Asp70Asn missense ALDH4A1 2 81430 2.4561E-5 40715 0 2.51902E-5
1-19215901-C-T p.Val68Val synonymous ALDH4A1 1 81438 1.22793E-5 40719 0 3.77958E-5
1-19215906-C-T p.Val67Met missense ALDH4A1 42 81410 5.15907E-4 40705 0 6.05018E-4
1-19215907-G-A p.Cys66Cys synonymous ALDH4A1 1 81412 1.22832E-5 40706 0 6.36862E-5
1-19215907-G-T p.Cys66* stop_gained ALDH4A1 1 81412 1.22832E-5 40706 0 6.31098E-6
1-19215910-T-G p.Pro65Pro synonymous ALDH4A1 1 81398 1.22853E-5 40699 0 4.74293E-5
1-19215926-C-T p.Arg60Gln missense ALDH4A1 5 81314 6.149E-5 40657 0 3.93671E-4
1-19215927-G-A p.Arg60Trp missense ALDH4A1 9 81314 1.10682E-4 40657 0 0.00219539
1-19215929-C-A p.Gly59Val missense ALDH4A1 2 81306 2.45984E-5 40653 0 NA
1-19215950-T-TTTTGCA c.157-3_157-2insTGCAAA splice_region ALDH4A1 2 81214 2.46263E-5 40607 1 NA
1-19215953-G-A c.157-5C>T splice_region ALDH4A1 1 81208 1.23141E-5 40604 0 6.39182E-6
1-19216511-G-A p.Gln51* stop_gained ALDH4A1 2 81424 2.45628E-5 40712 0 NA
1-19216512-C-T p.Leu50Leu synonymous ALDH4A1 24 81464 2.94609E-4 40732 0 0.0030303
1-19216522-C-T p.Arg47Gln missense ALDH4A1 3 81648 3.67431E-5 40824 0 8.49576E-5
1-19216523-G-A p.Arg47* stop_gained ALDH4A1 1 81666 1.2245E-5 40833 0 1.23119E-5
1-19216527-A-C p.Pro45Pro synonymous ALDH4A1 33 81732 4.03759E-4 40866 0 0.00108335
1-19216531-C-T p.Ser44Asn missense ALDH4A1 2 81798 2.44505E-5 40899 0 4.06944E-6
1-19216540-G-A p.Thr41Met missense ALDH4A1 2 81904 2.44188E-5 40952 0 6.37105E-5
1-19216552-AC-A p.Val37fs frameshift ALDH4A1 1 82010 1.21936E-5 41005 0 NA
1-19216553-C-T p.Val37Ile missense ALDH4A1 3 82004 3.65836E-5 41002 0 4.03832E-5
1-19216557-C-T p.Glu35Glu synonymous ALDH4A1 2 82008 2.43879E-5 41004 0 2.99461E-5
1-19216558-TCGTTGGCCA-T p.Val32_Asn34del disruptive_inframe_deletion ALDH4A1 1 82002 1.21948E-5 41001 0 4.03916E-6
1-19216559-C-A p.Glu35* stop_gained ALDH4A1 2 81982 2.43956E-5 40991 0 1.21269E-5
1-19216560-G-A c.-79C>T 5_prime_UTR_premature_start_codon_gain ALDH4A1 46 81964 5.61222E-4 40982 0 0.0013703
1-19216569-C-T p.Lys31Lys synonymous ALDH4A1 1 81930 1.22055E-5 40965 0 NA
1-19216575-G-A p.Ser29Ser synonymous ALDH4A1 4 81864 4.88615E-5 40932 0 3.18654E-5
1-19216587-C-T p.Lys25Lys synonymous ALDH4A1 1 81720 1.22369E-5 40860 0 NA
1-19216594-C-T p.Arg23Gln missense ALDH4A1 2 81666 2.449E-5 40833 0 8.20863E-6
1-19216595-G-A p.Arg23Trp missense ALDH4A1 21 81642 2.57221E-4 40821 0 0.00100908
1-19216599-G-T p.Gly21Gly splice_region+synonymous ALDH4A1 2 81594 2.45116E-5 40797 0 1.2382E-5
1-19216599-G-A p.Gly21Gly splice_region+synonymous ALDH4A1 1 81594 1.22558E-5 40797 0 0.00125
1-19216607-A-T c.63-8T>A splice_region ALDH4A1 1 81460 1.2276E-5 40730 0 NA
1-19217180-G-A c.-119+8C>T splice_region ALDH4A1 5 27186 1.83918E-4 13593 0 NA
1-19217187-C-T c.-119+1G>A splice_donor ALDH4A1 4 27186 1.47135E-4 13593 0 3.18451E-5
1-19217188-G-A c.-119C>T splice_region ALDH4A1 2 27186 7.35673E-5 13593 0 NA
1-19217189-C-G c.-120G>C splice_region ALDH4A1 1 27186 3.67836E-5 13593 0 NA
1-19217295-A-G c.-226T>C 5_prime_UTR_premature_start_codon_gain ALDH4A1 273 27210 0.0100331 13605 7 0.0237018
1-19217342-G-C c.-273C>G 5_prime_UTR_premature_start_codon_gain ALDH4A1 1 27216 3.67431E-5 13608 0 NA
1-19228949-C-T c.62+7G>A splice_region ALDH4A1 1 41298 2.42142E-5 20649 0 NA
1-19228955-C-T c.62+1G>A splice_donor ALDH4A1 1 42838 2.33438E-5 21419 0 NA
1-19228971-G-A p.Pro16Leu missense ALDH4A1 1343 46814 0.028688 23407 32 0.0511811
1-19228974-C-A p.Arg15Leu missense ALDH4A1 1 47092 2.1235E-5 23546 0 3.75047E-5
1-19228986-G-A p.Ala11Val missense ALDH4A1 1 50532 1.97894E-5 25266 0 NA
1-19228992-C-G p.Arg9Pro missense ALDH4A1 1 51406 1.9453E-5 25703 0 3.20061E-5
1-19228996-GC-G p.Leu8fs frameshift ALDH4A1 6 52516 1.14251E-4 26258 0 1.27902E-4
1-19229000-GGGCGCC-G p.Ala5_Pro6del disruptive_inframe_deletion ALDH4A1 12 53866 2.22775E-4 26933 0 6.97512E-4
1-19229006-C-G p.Pro4Pro synonymous ALDH4A1 1 55100 1.81488E-5 27550 0 1.11012E-4
1-19229006-C-A p.Pro4Pro synonymous ALDH4A1 1 55100 1.81488E-5 27550 0 NA
1-19229021-G-A c.-4C>T 5_prime_UTR_premature_start_codon_gain ALDH4A1 1 58908 1.69756E-5 29454 0 9.60375E-6
1-19229053-C-A c.-36G>T 5_prime_UTR_premature_start_codon_gain ALDH4A1 11 61860 1.77821E-4 30930 0 0.0025
1-19229058-G-A c.-41C>T 5_prime_UTR_premature_start_codon_gain ALDH4A1 3 61862 4.8495E-5 30931 0 2.0674E-4
1-19229064-G-A c.-47C>T 5_prime_UTR_premature_start_codon_gain ALDH4A1 1 61676 1.62138E-5 30838 0 NA
1-19229078-A-T c.-61T>A 5_prime_UTR_premature_start_codon_gain ALDH4A1 2 61704 3.24128E-5 30852 0 3.2002E-5
1-19229082-C-A c.-65G>T 5_prime_UTR_premature_start_codon_gain ALDH4A1 1 61162 1.635E-5 30581 0 NA
1-19229083-G-A c.-66C>T 5_prime_UTR_premature_start_codon_gain ALDH4A1 1 60614 1.64978E-5 30307 0 NA
1-19229153-G-T c.-136C>A 5_prime_UTR_premature_start_codon_gain ALDH4A1 1 40270 2.48324E-5 20135 0 NA
1-19229165-C-T c.-148G>A 5_prime_UTR_premature_start_codon_gain ALDH4A1 1 36728 2.72272E-5 18364 0 NA
1-19229222-C-A c.-205G>T 5_prime_UTR_premature_start_codon_gain ALDH4A1 1 20416 4.89812E-5 10208 0 6.42674E-4