Variant

Variant ID Consequence Effect Gene AC AN AF NS NHOM maxEAF
10-97366535-T-G p.Gln789Pro missense ALDH18A1 2 83130 2.40587E-5 41565 0 3.18573E-5
10-97366539-G-GTATT p.Pro788fs frameshift ALDH18A1 2 83138 2.40564E-5 41569 0 NA
10-97366539-G-C p.Pro788Ala missense ALDH18A1 1 83138 1.20282E-5 41569 0 3.97928E-6
10-97366546-G-A p.Leu785Leu synonymous ALDH18A1 5 83116 6.01569E-5 41558 0 0.00151057
10-97366557-G-A p.His782Tyr missense ALDH18A1 1 83126 1.20299E-5 41563 0 NA
10-97366572-T-C p.Ser777Gly missense ALDH18A1 47 83118 5.65461E-4 41559 0 2.7457E-4
10-97366577-T-C p.His775Arg missense ALDH18A1 1 83134 1.20288E-5 41567 0 8.2371E-6
10-97366599-C-T p.Val768Met missense ALDH18A1 1 83106 1.20328E-5 41553 0 3.18431E-5
10-97366607-T-C p.Lys765Arg missense ALDH18A1 3 83132 3.60872E-5 41566 0 NA
10-97366613-C-T p.Arg763Gln missense ALDH18A1 1 83134 1.20288E-5 41567 0 1.19391E-5
10-97366628-G-A p.Thr758Ile missense ALDH18A1 1 83142 1.20276E-5 41571 0 3.97959E-6
10-97366631-G-A p.Thr757Ile missense ALDH18A1 2 83150 2.40529E-5 41575 0 3.18492E-5
10-97366654-T-C p.Pro749Pro synonymous ALDH18A1 3 83096 3.61028E-5 41548 0 3.18431E-5
10-97366666-G-A p.His745His synonymous ALDH18A1 2 82938 2.41144E-5 41469 0 5.7711E-5
10-97366675-C-T p.Ser742Ser synonymous ALDH18A1 106 82812 0.00128001 41406 1 0.00152944
10-97366675-C-G p.Ser742Ser synonymous ALDH18A1 2 82816 2.41499E-5 41408 0 1.59255E-5
10-97366676-G-C p.Ser742Trp missense ALDH18A1 1 82750 1.20846E-5 41375 0 5.04541E-4
10-97366684-G-A p.Ile739Ile synonymous ALDH18A1 1 82584 1.21089E-5 41292 0 8.24987E-6
10-97366690-C-T p.Val737Val synonymous ALDH18A1 4 82478 4.84978E-5 41239 0 3.18532E-5
10-97366703-G-A c.2201-3C>T splice_region ALDH18A1 475 82052 0.00578901 41026 3 0.00453053
10-97369958-T-G p.Gly732Gly synonymous ALDH18A1 1 83186 1.20213E-5 41593 0 NA
10-97369965-C-T p.Arg730His missense ALDH18A1 2 83190 2.40414E-5 41595 0 8.24008E-6
10-97369966-G-A p.Arg730Cys missense ALDH18A1 1 83194 1.20201E-5 41597 0 3.18552E-5
10-97369983-C-T p.Arg724His missense ALDH18A1 4 83196 4.80792E-5 41598 0 3.18634E-5
10-97369984-G-A p.Arg724Cys missense ALDH18A1 1 83200 1.20192E-5 41600 0 1.40065E-4
10-97370000-G-A p.Phe718Phe synonymous ALDH18A1 47 83198 5.64917E-4 41599 0 6.25E-4
10-97370007-C-G p.Cys716Ser missense ALDH18A1 1 83188 1.2021E-5 41594 0 4.1197E-5
10-97370017-C-G p.Asp713His missense ALDH18A1 2 83152 2.40523E-5 41576 0 1.19382E-5
10-97370020-C-T p.Val712Ile missense ALDH18A1 1 83150 1.20265E-5 41575 0 2.47231E-5
10-97370021-G-A p.His711His synonymous ALDH18A1 4 83132 4.81162E-5 41566 0 0.00125
10-97370040-G-A p.Ala705Val missense ALDH18A1 2 83044 2.40836E-5 41522 0 1.19421E-5
10-97370044-T-C p.Thr704Ala missense ALDH18A1 2 83032 2.40871E-5 41516 0 1.65161E-5
10-97370050-C-CGTCCTCTGTGACGATGACATCCGTGTGGGAGCTGCCATACTTGTGGATGTGG c.2105-2_2105-1insCCACATCCACAAGTATGGCAGCTCCCACACGGATGTCATCGTCACAGAGGAC splice_acceptor ALDH18A1 4 82976 4.82067E-5 41488 2 NA
10-97370050-C-CGTCCTCTGTGACGATGACATCCGTGTGGGAGCTGCCATACTTG c.2105-2_2105-1insCAAGTATGGCAGCTCCCACACGGATGTCATCGTCACAGAGGAC splice_acceptor ALDH18A1 2 82976 2.41034E-5 41488 1 NA
10-97370050-C-CGTCCTCTGTGACGATGACATCCGTGTGGGAGCTGCCATACT c.2105-2_2105-1insAGTATGGCAGCTCCCACACGGATGTCATCGTCACAGAGGAC splice_acceptor ALDH18A1 2 82976 2.41034E-5 41488 1 NA
10-97371014-G-A p.Asp701Asp splice_region+synonymous ALDH18A1 2 83088 2.40709E-5 41544 0 3.1839E-5
10-97371016-C-T p.Asp701Asn missense ALDH18A1 1 83118 1.20311E-5 41559 0 NA
10-97371025-C-T p.Val698Ile missense ALDH18A1 2 83148 2.40535E-5 41574 0 5.07099E-4
10-97371026-G-A p.Ile697Ile synonymous ALDH18A1 1 83156 1.20256E-5 41578 0 6.25E-4
10-97371028-T-A p.Ile697Phe missense ALDH18A1 2 83172 2.40466E-5 41586 0 NA
10-97371035-C-T p.Thr694Thr synonymous ALDH18A1 2 83178 2.40448E-5 41589 0 2.78527E-5
10-97371044-G-A p.Ser691Ser synonymous ALDH18A1 1 83194 1.20201E-5 41597 0 NA
10-97371056-G-C p.His687Gln missense ALDH18A1 1 83232 1.20146E-5 41616 0 NA
10-97371059-G-T p.Ile686Ile synonymous ALDH18A1 1 83224 1.20158E-5 41612 0 NA
10-97371083-G-A p.Asn678Asn synonymous ALDH18A1 2 83258 2.40217E-5 41629 0 6.25E-4
10-97371115-C-T p.Asp668Asn missense ALDH18A1 1 83352 1.19973E-5 41676 0 8.23642E-6
10-97371122-C-T p.Glu665Glu synonymous ALDH18A1 105 83352 0.00125972 41676 1 0.00311983
10-97371146-G-A p.Ser657Ser synonymous ALDH18A1 2610 83330 0.0313213 41665 55 0.0337362
10-97371170-G-A p.Ala649Ala synonymous ALDH18A1 3 83346 3.59945E-5 41673 0 8.23655E-6
10-97371181-G-A p.Pro646Ser missense ALDH18A1 1 83316 1.20025E-5 41658 0 8.23778E-6
10-97371187-C-G p.Ala644Pro missense ALDH18A1 2 83308 2.40073E-5 41654 0 NA
10-97371192-A-T p.Ile642Asn missense ALDH18A1 1 83296 1.20054E-5 41648 0 8.24171E-6
10-97371196-T-C p.Lys641Glu missense ALDH18A1 1 83274 1.20085E-5 41637 0 NA
10-97371202-G-GTTCCACTCTCAGCATATCAATGATCTGGTCAAATAATGGTGTCCT c.1918-4_1918-3insAGGACACCATTATTTGACCAGATCATTGATATGCTGAGAGTGGAA splice_region ALDH18A1 4 83250 4.8048E-5 41625 1 NA
10-97371202-G-GTTCCACTCTCAGCATATCAATGATCTGGTCAAATAATGGTGTCCTGA c.1918-4_1918-3insTCAGGACACCATTATTTGACCAGATCATTGATATGCTGAGAGTGGAA splice_region ALDH18A1 4 83248 4.80492E-5 41624 2 NA
10-97373516-T-G p.Met634Leu missense ALDH18A1 1 83268 1.20094E-5 41634 0 8.23764E-6
10-97373526-C-T p.Gln630Gln synonymous ALDH18A1 1 83270 1.20091E-5 41635 0 2.47113E-5
10-97373538-T-C p.Pro626Pro synonymous ALDH18A1 1 83316 1.20025E-5 41658 0 3.97735E-6
10-97373555-C-T p.Asp621Asn missense ALDH18A1 5 83334 5.99995E-5 41667 0 0.00151057
10-97373557-C-T p.Arg620Gln missense ALDH18A1 3 83332 3.60006E-5 41666 0 4.11834E-5
10-97373558-G-A p.Arg620Trp missense ALDH18A1 1 83336 1.19996E-5 41668 0 8.23669E-6
10-97373589-G-A p.Ala609Ala synonymous ALDH18A1 1 83320 1.20019E-5 41660 0 NA
10-97373592-A-G p.Ala608Ala synonymous ALDH18A1 1 83316 1.20025E-5 41658 0 NA
10-97373595-T-A p.Pro607Pro synonymous ALDH18A1 2 83310 2.40067E-5 41655 0 8.23655E-6
10-97373608-T-G p.Lys603Thr missense ALDH18A1 1 83280 1.20077E-5 41640 0 NA
10-97373620-ACTGAAAGAAGATGAGCAAAGAATTGTTTCCATTGACATGATCCAGAGCTGCAGAGGATGTAATATTTCTCCGTTGTGAAAGAGAAGACCCCATCCAGCTCAC-A c.1795+1_1796-1del splice_acceptor ALDH18A1 10 83254 1.20114E-4 41627 3 NA
10-97373724-T-C p.Leu598Leu splice_region+synonymous ALDH18A1 1 82948 1.20557E-5 41474 0 3.1839E-5
10-97373735-C-T p.Val595Ile missense ALDH18A1 3 82892 3.61917E-5 41446 0 NA
10-97373735-C-A p.Val595Phe missense ALDH18A1 1 82892 1.20639E-5 41446 0 NA
10-97373736-C-A p.Lys594Asn missense ALDH18A1 2 82890 2.41284E-5 41445 0 8.2371E-6
10-97373747-T-C p.Ser591Gly missense ALDH18A1 1 82858 1.20688E-5 41429 0 3.98134E-6
10-97373753-C-T p.Glu589Lys missense ALDH18A1 1 82852 1.20697E-5 41426 0 1.64739E-5
10-97373754-G-A p.Ser588Ser synonymous ALDH18A1 3321 82816 0.0401009 41408 82 0.0458207
10-97373783-C-T p.Glu579Lys missense ALDH18A1 2 82986 2.41005E-5 41493 0 3.1841E-5
10-97373784-G-A p.Ser578Ser synonymous ALDH18A1 22 82986 2.65105E-4 41493 0 6.36922E-5
10-97373789-G-A p.His577Tyr missense ALDH18A1 1 83004 1.20476E-5 41502 0 NA
10-97373816-C-A p.Ala568Ser missense ALDH18A1 2 83110 2.40645E-5 41555 0 NA
10-97373821-T-C p.Gln566Arg missense ALDH18A1 1 83142 1.20276E-5 41571 0 3.29457E-5
10-97373831-T-C p.Arg563Gly missense ALDH18A1 3 83204 3.6056E-5 41602 0 3.18471E-5
10-97373834-C-T p.Val562Ile missense ALDH18A1 1 83212 1.20175E-5 41606 0 NA
10-97373835-C-T p.Leu561Leu synonymous ALDH18A1 1 83218 1.20166E-5 41609 0 8.23655E-6
10-97373854-G-A p.Pro555Leu missense ALDH18A1 3 83252 3.60352E-5 41626 0 3.1818E-5
10-97373869-A-G p.Ile550Thr missense ALDH18A1 1 83236 1.2014E-5 41618 0 1.1932E-5
10-97373871-C-A p.Met549Ile missense ALDH18A1 1 83234 1.20143E-5 41617 0 NA
10-97373885-G-A p.Arg545Cys missense ALDH18A1 2 83190 2.40414E-5 41595 0 2.78441E-5
10-97373888-A-G p.Cys544Arg missense ALDH18A1 5 83180 6.01106E-5 41590 0 3.18431E-5
10-97373889-A-G p.Leu543Leu synonymous ALDH18A1 3 83174 3.6069E-5 41587 0 8.24185E-5
10-97373891-G-A p.Leu543Phe missense ALDH18A1 3 83180 3.60664E-5 41590 0 8.24239E-6
10-97373893-T-C p.Asp542Gly missense ALDH18A1 1 83170 1.20236E-5 41585 0 2.4737E-5
10-97373900-C-T p.Val540Ile missense ALDH18A1 9 83148 1.08241E-4 41574 0 4.37171E-4
10-97373914-T-A p.Asn535Ile missense ALDH18A1 2 83032 2.40871E-5 41516 0 NA
10-97373919-C-CAGTTGCACGGCCTCCTTGACTCCATGGATTGAGAGAGCCTCCTGGG c.1600-2_1600-1insCCCAGGAGGCTCTCTCAATCCATGGAGTCAAGGAGGCCGTGCAACT splice_acceptor ALDH18A1 2 82972 2.41045E-5 41486 1 NA
10-97376226-G-A c.1599+8C>T splice_region ALDH18A1 1 82190 1.21669E-5 41095 0 NA
10-97376228-A-T c.1599+6T>A splice_region ALDH18A1 2 82186 2.4335E-5 41093 0 NA
10-97376235-A-T p.Leu533Gln missense+splice_region ALDH18A1 15 82260 1.82349E-4 41130 0 1.61316E-4
10-97376242-C-T p.Val531Met missense ALDH18A1 1 82268 1.21554E-5 41134 0 0.0020202
10-97376243-G-A p.Ala530Ala synonymous ALDH18A1 15 82264 1.8234E-4 41132 0 5.01745E-5
10-97376245-C-T p.Ala530Thr missense ALDH18A1 1 82282 1.21533E-5 41141 0 7.57863E-5
10-97376250-T-G p.Lys528Thr missense ALDH18A1 3 82282 3.646E-5 41141 0 3.80923E-5
10-97376259-T-C p.His525Arg missense ALDH18A1 1 82298 1.2151E-5 41149 0 5.33629E-6
10-97376263-T-C p.Ile524Val missense ALDH18A1 7 82318 8.50361E-5 41159 0 1.59347E-4
10-97376271-G-A p.Ala521Val missense ALDH18A1 4 82324 4.85885E-5 41162 0 3.84541E-4
10-97376280-G-C p.Thr518Ser missense ALDH18A1 2 82358 2.42842E-5 41179 0 2.93807E-5
10-97376286-A-G p.Leu516Pro missense ALDH18A1 1 82370 1.21403E-5 41185 0 NA
10-97376297-C-T p.Arg512Arg synonymous ALDH18A1 2 82404 2.42707E-5 41202 0 2.41604E-5
10-97376298-C-T p.Arg512Gln missense ALDH18A1 1 82394 1.21368E-5 41197 0 3.21216E-5
10-97376299-G-A p.Arg512Trp missense ALDH18A1 1 82436 1.21306E-5 41218 0 9.29282E-5
10-97376308-G-A p.His509Tyr missense ALDH18A1 1 82478 1.21244E-5 41239 0 NA
10-97376336-C-T p.Leu499Leu synonymous ALDH18A1 1 82692 1.20931E-5 41346 0 NA
10-97376343-T-C p.Asn497Ser missense ALDH18A1 2 82730 2.4175E-5 41365 0 NA
10-97376353-C-T p.Ala494Thr missense ALDH18A1 1 82708 1.20907E-5 41354 0 8.34516E-6
10-97376353-C-G p.Ala494Pro missense ALDH18A1 1 82708 1.20907E-5 41354 0 NA
10-97376354-G-A p.Ile493Ile synonymous ALDH18A1 4 82708 4.83629E-5 41354 1 6.25E-4
10-97376373-T-TGGGGTAGACAGTCAGGACGAGATTCAAAGATCACCA c.1462-3_1462-2insTGGTGATCTTTGAATCTCGTCCTGACTGTCTACCCC splice_region ALDH18A1 4 82600 4.84262E-5 41300 2 NA
10-97376374-G-GGGGTAGACAGTCAGGACGAGATTCAAAGATCAC c.1462-4_1462-3insGTGATCTTTGAATCTCGTCCTGACTGTCTACCC splice_region ALDH18A1 2 82588 2.42166E-5 41294 1 NA
10-97380781-T-C c.1461+7A>G splice_region ALDH18A1 1 83236 1.2014E-5 41618 0 NA
10-97380790-G-T p.Gln487Lys missense+splice_region ALDH18A1 1 83282 1.20074E-5 41641 0 NA
10-97380794-T-C p.Leu485Leu synonymous ALDH18A1 1 83280 1.20077E-5 41640 0 NA
10-97380799-A-C p.Cys484Gly missense ALDH18A1 1 83308 1.20036E-5 41654 0 NA
10-97380807-C-T p.Arg481His missense ALDH18A1 2 83304 2.40085E-5 41652 0 2.78383E-5
10-97380838-T-C p.Ile471Val missense ALDH18A1 1 83280 1.20077E-5 41640 0 6.37918E-5
10-97380862-C-T p.Glu463Lys missense ALDH18A1 4 83306 4.80158E-5 41653 0 5.76701E-5
10-97380874-C-T p.Ala459Thr missense ALDH18A1 10 83304 1.20042E-4 41652 0 3.52474E-4
10-97380875-G-A p.Ile458Ile synonymous ALDH18A1 9 83300 1.08043E-4 41650 0 0.00151057
10-97380885-C-T p.Arg455His missense ALDH18A1 4 83268 4.80377E-5 41634 0 8.23832E-5
10-97380885-C-A p.Arg455Leu missense ALDH18A1 4 83268 4.80377E-5 41634 0 0.00125
10-97380886-G-A p.Arg455Cys missense ALDH18A1 2 83270 2.40183E-5 41635 0 3.97693E-6
10-97380887-G-A p.Arg454Arg synonymous ALDH18A1 6 83274 7.20513E-5 41637 0 3.29538E-5
10-97380888-C-T p.Arg454His missense ALDH18A1 2 83268 2.40188E-5 41634 0 4.77236E-5
10-97380889-G-A p.Arg454Cys missense ALDH18A1 3 83276 3.60248E-5 41638 0 6.4156E-5
10-97380892-A-G p.Leu453Leu synonymous ALDH18A1 1 83292 1.2006E-5 41646 0 3.20246E-5
10-97380897-C-T p.Arg451His missense ALDH18A1 3 83290 3.60187E-5 41645 0 3.2956E-5
10-97380904-C-T p.Val449Met missense ALDH18A1 1 83270 1.20091E-5 41635 0 3.29582E-5
10-97380918-G-A p.Ser444Phe missense ALDH18A1 1 83252 1.20117E-5 41626 0 3.19836E-5
10-97380920-G-A p.Ala443Ala synonymous ALDH18A1 1 83258 1.20109E-5 41629 0 4.12025E-5
10-97380926-G-A p.Ile441Ile synonymous ALDH18A1 92 83256 0.00110503 41628 1 0.00456198
10-97380928-T-C p.Ile441Val missense ALDH18A1 1 83258 1.20109E-5 41629 0 NA
10-97380933-C-T p.Arg439Gln missense ALDH18A1 2 83254 2.40229E-5 41627 0 NA
10-97380934-G-A p.Arg439* stop_gained ALDH18A1 1 83246 1.20126E-5 41623 0 1.64921E-5
10-97380935-C-T p.Leu438Leu synonymous ALDH18A1 1 83248 1.20123E-5 41624 0 1.19327E-5
10-97380940-C-T p.Gly437Ser missense ALDH18A1 2 83240 2.40269E-5 41620 0 4.37539E-5
10-97380941-G-A p.Ile436Ile synonymous ALDH18A1 33 83230 3.96492E-4 41615 0 4.46514E-4
10-97380947-C-T p.Leu434Leu synonymous ALDH18A1 90 83208 0.00108163 41604 0 0.00133929
10-97380960-T-C p.Lys430Arg missense ALDH18A1 1 83166 1.20241E-5 41583 0 NA
10-97380974-G-A p.Ser425Ser synonymous ALDH18A1 1 83158 1.20253E-5 41579 0 NA
10-97380980-A-G p.Arg423Arg synonymous ALDH18A1 1 83146 1.2027E-5 41573 0 8.86808E-6
10-97380981-C-T p.Arg423His missense ALDH18A1 1 83144 1.20273E-5 41572 0 3.9894E-6
10-97380982-G-A p.Arg423Cys missense ALDH18A1 4 83124 4.81209E-5 41562 0 8.92395E-5
10-97380985-T-C p.Lys422Glu missense ALDH18A1 1 83096 1.20343E-5 41548 0 9.08232E-6
10-97380991-G-C p.Leu420Val missense ALDH18A1 6 83026 7.22665E-5 41513 0 7.61716E-5
10-97381002-A-T p.Leu416His missense ALDH18A1 1 82868 1.20674E-5 41434 0 4.47256E-4
10-97381007-C-T p.Gly414Gly splice_region+synonymous ALDH18A1 2 82804 2.41534E-5 41402 0 3.51617E-4
10-97381016-G-T c.1241-8C>A splice_region ALDH18A1 1 82614 1.21045E-5 41307 0 4.14295E-6
10-97385111-G-T c.1240+8C>A splice_region ALDH18A1 1 82994 1.20491E-5 41497 0 8.23655E-6
10-97385128-C-T p.Glu411Lys missense ALDH18A1 8 83146 9.62163E-5 41573 0 4.11821E-5
10-97385128-C-G p.Glu411Gln missense ALDH18A1 1 83146 1.2027E-5 41573 0 NA
10-97385132-C-A p.Leu409Phe missense ALDH18A1 4 83202 4.80758E-5 41601 0 8.23642E-6
10-97385154-AG-A p.Leu402fs frameshift ALDH18A1 1 83262 1.20103E-5 41631 0 NA
10-97385171-G-A p.Asp396Asp synonymous ALDH18A1 2 83262 2.40206E-5 41631 0 NA
10-97385174-C-T p.Thr395Thr synonymous ALDH18A1 2 83260 2.40211E-5 41630 0 3.18532E-5
10-97385175-G-A p.Thr395Met missense ALDH18A1 1 83262 1.20103E-5 41631 0 3.1815E-5
10-97385214-T-TGCTCAGGTTCCAAGGTGGCCAACATCCTTCCTCC c.1147-3_1147-2insGGAGGAAGGATGTTGGCCACCTTGGAACCTGAGC splice_region ALDH18A1 1 83100 1.20337E-5 41550 0 NA
10-97386450-AGG-A c.1146+8_1146+9delCC splice_region ALDH18A1 2 83166 2.40483E-5 41583 0 1.27437E-4
10-97386486-T-A p.Met374Leu missense ALDH18A1 2 83336 2.39992E-5 41668 0 3.29821E-5
10-97386497-G-T p.Ser370Tyr missense ALDH18A1 1727 83314 0.0207288 41657 29 0.0425
10-97386500-C-T p.Arg369Gln missense ALDH18A1 4 83344 4.79939E-5 41672 0 9.55962E-5
10-97386506-A-G p.Met367Thr missense ALDH18A1 4 83348 4.79916E-5 41674 0 3.18776E-5
10-97386508-T-C p.Glu366Glu synonymous ALDH18A1 1 83350 1.19976E-5 41675 0 3.97659E-6
10-97386510-C-A p.Glu366* stop_gained ALDH18A1 1 83350 1.19976E-5 41675 0 NA
10-97386538-A-AGGCTTTACTTCTGAAAAGAAGGTACCAACTTTCTTCCCCTCC c.1073-6_1073-5insGGAGGGGAAGAAAGTTGGTACCTTCTTTTCAGAAGTAAAGCC splice_region ALDH18A1 4 83286 4.80273E-5 41643 2 NA
10-97387193-A-G c.1072+6T>C splice_region ALDH18A1 7 83260 8.4074E-5 41630 0 NA
10-97387212-T-C p.Glu353Glu synonymous ALDH18A1 1 83268 1.20094E-5 41634 0 3.97712E-6
10-97387221-G-C p.Phe350Leu missense ALDH18A1 1 83258 1.20109E-5 41629 0 NA
10-97387228-C-T p.Gly348Asp missense ALDH18A1 1 83244 1.20129E-5 41622 0 NA
10-97387230-A-C p.Val347Val synonymous ALDH18A1 1 83244 1.20129E-5 41622 0 NA
10-97387248-A-G p.Ile341Ile synonymous ALDH18A1 2007 83174 0.0241301 41587 30 0.0238797
10-97387250-T-C p.Ile341Val missense ALDH18A1 2 83194 2.40402E-5 41597 0 1.1934E-5
10-97387262-C-T p.Val337Ile missense ALDH18A1 1 83180 1.20221E-5 41590 0 3.97836E-6
10-97387263-G-A p.His336His synonymous ALDH18A1 4 83172 4.80931E-5 41586 0 6.3678E-5
10-97387286-T-C p.Thr329Ala missense ALDH18A1 1 83106 1.20328E-5 41553 0 NA
10-97387290-A-G p.Asn327Asn synonymous ALDH18A1 2 83092 2.40697E-5 41546 0 4.12113E-5
10-97387291-T-C p.Asn327Ser missense ALDH18A1 4 83092 4.81394E-5 41546 0 9.55475E-5
10-97387304-C-T p.Val323Ile missense ALDH18A1 4 83046 4.81661E-5 41523 0 1.59215E-4
10-97387308-A-T p.Thr321Thr synonymous ALDH18A1 1 83024 1.20447E-5 41512 0 8.25069E-6
10-97387311-G-A p.Gly320Gly synonymous ALDH18A1 5 82970 6.02627E-5 41485 0 1.89832E-4
10-97387318-T-C p.Gln318Arg missense ALDH18A1 1 82910 1.20613E-5 41455 0 1.59195E-4
10-97387329-G-A p.Leu314Leu synonymous ALDH18A1 6 82768 7.24918E-5 41384 0 1.27462E-4
10-97387332-G-T p.Ala313Ala synonymous ALDH18A1 1 82694 1.20928E-5 41347 0 3.9841E-6
10-97387345-T-TTGGCTTCCATGCCACCCATTCCCACTCTAGACTTGGTTCCA c.928-3_928-2insTGGAACCAAGTCTAGAGTGGGAATGGGTGGCATGGAAGCCA splice_region ALDH18A1 2 82430 2.4263E-5 41215 1 NA
10-97387345-T-TTGGCTTCCATGCCACCCATTCCCACTCTAGACTTGGTTCC c.928-3_928-2insGGAACCAAGTCTAGAGTGGGAATGGGTGGCATGGAAGCCA splice_region ALDH18A1 2 82434 2.42618E-5 41217 1 NA
10-97388151-C-T p.Val301Met missense ALDH18A1 1 83310 1.20034E-5 41655 0 8.23737E-6
10-97388153-C-T p.Arg300Lys missense ALDH18A1 1 83312 1.20031E-5 41656 0 NA
10-97388162-G-A p.Thr297Ile missense ALDH18A1 10102 83158 0.12148 41579 714 0.136455
10-97388179-C-T p.Gln291Gln synonymous ALDH18A1 1 83280 1.20077E-5 41640 0 3.97788E-6
10-97388190-C-T p.Gly288Arg missense ALDH18A1 4 83232 4.80584E-5 41616 0 9.55292E-5
10-97388191-G-A p.Pro287Pro synonymous ALDH18A1 6 83242 7.2079E-5 41621 0 6.37105E-5
10-97388195-T-C p.Tyr286Cys missense ALDH18A1 1 83226 1.20155E-5 41613 0 NA
10-97388202-T-C p.Ile284Val missense ALDH18A1 4 83210 4.80711E-5 41605 0 3.18451E-5
10-97388211-G-A p.Leu281Phe missense ALDH18A1 1 83140 1.20279E-5 41570 0 3.18613E-5
10-97388216-G-A p.Ala279Val missense ALDH18A1 1 83066 1.20386E-5 41533 0 7.96343E-6
10-97388219-T-A p.Asp278Val missense ALDH18A1 4 83032 4.81742E-5 41516 0 3.98197E-6
10-97388230-T-TG p.Gly275fs frameshift ALDH18A1 2 82834 2.41447E-5 41417 0 NA
10-97388231-G-C p.Pro274Arg missense ALDH18A1 1 82826 1.20735E-5 41413 0 NA
10-97388235-G-T p.Pro273Thr missense ALDH18A1 1 82742 1.20858E-5 41371 0 NA
10-97388237-C-T p.Ser272Asn missense ALDH18A1 1 82732 1.20872E-5 41366 0 8.3091E-6
10-97388251-TA-T c.803-3delT splice_region ALDH18A1 1 82568 1.21112E-5 41284 0 8.35268E-6
10-97388252-A-C c.803-3T>G splice_region ALDH18A1 4 82564 4.84473E-5 41282 0 2.50643E-5
10-97388430-A-G n.173+8T>C splice_region ALDH18A1 49 67484 7.26098E-4 33742 0 1.91071E-4
10-97388437-C-T n.173+1G>A splice_donor ALDH18A1 1 65504 1.52662E-5 32752 0 NA
10-97392738-C-T p.Leu260Leu synonymous ALDH18A1 2 83120 2.40616E-5 41560 0 NA
10-97392757-T-C p.Glu254Gly missense ALDH18A1 1 83110 1.20322E-5 41555 0 1.15502E-4
10-97392770-G-A p.Arg250* stop_gained ALDH18A1 1 83078 1.20369E-5 41539 0 8.24851E-6
10-97392782-TA-T p.Asp245fs frameshift ALDH18A1 1 83042 1.20421E-5 41521 0 NA
10-97392799-C-G p.Ser240Thr missense ALDH18A1 1 82924 1.20592E-5 41462 0 NA
10-97392805-A-ACATTTACCC p.Gly237_Val238insGlyValAsn conservative_inframe_insertion ALDH18A1 1 82866 1.20677E-5 41433 0 NA
10-97392805-A-T p.Val238Asp missense+splice_region ALDH18A1 1 82866 1.20677E-5 41433 0 NA
10-97392809-A-G c.712-3T>C splice_region ALDH18A1 1 82792 1.20785E-5 41396 0 6.3678E-5
10-97393253-C-CA p.Val238fs frameshift ALDH18A1 2 82962 2.41074E-5 41481 0 NA
10-97393253-C-A c.711+1G>T splice_donor ALDH18A1 1 82962 1.20537E-5 41481 0 NA
10-97393254-C-A p.Gly237Gly splice_region+synonymous ALDH18A1 2 82972 2.41045E-5 41486 0 NA
10-97393256-C-G p.Gly237Arg missense+splice_region ALDH18A1 5 83008 6.02352E-5 41504 0 3.18471E-5
10-97393272-G-T p.Pro231Pro synonymous ALDH18A1 1 83126 1.20299E-5 41563 0 NA
10-97393287-G-A p.Val226Val synonymous ALDH18A1 5 83176 6.01135E-5 41588 0 8.23873E-5
10-97393312-A-G p.Ile218Thr missense ALDH18A1 1 83240 1.20135E-5 41620 0 NA
10-97393317-G-T p.Val216Val synonymous ALDH18A1 3 83240 3.60404E-5 41620 0 1.19337E-5
10-97393323-G-A p.Asn214Asn synonymous ALDH18A1 2 83238 2.40275E-5 41619 0 NA
10-97393330-C-G p.Arg212Thr missense ALDH18A1 1 83236 1.2014E-5 41618 0 NA
10-97393331-T-C p.Arg212Gly missense ALDH18A1 1 83236 1.2014E-5 41618 0 8.24035E-6
10-97393347-T-C p.Thr206Thr synonymous ALDH18A1 1 83196 1.20198E-5 41598 0 3.97823E-6
10-97393348-G-A p.Thr206Ile missense ALDH18A1 2 83190 2.40414E-5 41595 0 NA
10-97393363-C-T p.Arg201Gln missense ALDH18A1 1 83130 1.20294E-5 41565 0 4.77498E-5
10-97393366-C-T p.Arg200His missense ALDH18A1 2 83102 2.40668E-5 41551 0 6.37227E-5
10-97393367-G-A p.Arg200Cys missense ALDH18A1 1 83106 1.20328E-5 41553 0 1.64891E-5
10-97393376-C-G p.Glu197Gln missense ALDH18A1 13 83084 1.56468E-4 41542 0 1.39281E-4
10-97393413-G-A c.559-7C>T splice_region ALDH18A1 1 82698 1.20922E-5 41349 0 NA
10-97396857-G-A p.Ala184Val missense ALDH18A1 6 82240 7.29572E-5 41120 0 5.03525E-4
10-97396871-C-T p.Gln179Gln synonymous ALDH18A1 2 82562 2.42242E-5 41281 0 3.18471E-5
10-97396896-G-A p.Ala171Val missense ALDH18A1 1 82808 1.20761E-5 41404 0 5.03525E-4
10-97396916-G-A p.Ala164Ala synonymous ALDH18A1 44 82888 5.30837E-4 41444 0 0.00302115
10-97396932-C-T p.Arg159Gln missense ALDH18A1 1 82928 1.20587E-5 41464 0 NA
10-97396953-GCCTGTAATATACCAATGAGACAAGGTGTGGTAGGGAATGAGGGAAGAAGACCTGAAGATCCATTTCAATGTGTGGGGAAGCAGCACTCA-G p.Ala152fs frameshift ALDH18A1 11 83000 1.3253E-4 41500 4 NA
10-97397068-C-T p.Ser143Ser synonymous ALDH18A1 6 83154 7.21553E-5 41577 0 3.18291E-5
10-97397085-G-A p.Arg138Trp missense ALDH18A1 1 83140 1.20279E-5 41570 0 NA
10-97397114-C-T p.Arg128His missense ALDH18A1 4 83090 4.81406E-5 41545 0 3.29598E-5
10-97397114-C-A p.Arg128Leu missense ALDH18A1 1 83090 1.20351E-5 41545 0 NA
10-97397115-G-A p.Arg128Cys missense ALDH18A1 1 83076 1.20372E-5 41538 0 NA
10-97397119-G-A p.Arg126Arg synonymous ALDH18A1 1 83086 1.20357E-5 41543 0 1.59189E-5
10-97397139-C-T p.Val120Ile missense ALDH18A1 1 82958 1.20543E-5 41479 0 NA
10-97397140-G-A p.Ala119Ala synonymous ALDH18A1 6 82952 7.2331E-5 41476 0 6.36943E-5
10-97397143-T-A p.Gly118Gly synonymous ALDH18A1 1 82940 1.20569E-5 41470 0 NA
10-97397155-C-T p.Leu114Leu synonymous ALDH18A1 3 82864 3.62039E-5 41432 0 5.03525E-4
10-97397176-A-G p.Asn107Asn synonymous ALDH18A1 1 82556 1.2113E-5 41278 0 1.65074E-5
10-97397181-G-A p.Gln106* stop_gained ALDH18A1 1 82464 1.21265E-5 41232 0 NA
10-97402751-G-A p.Gln101* stop_gained ALDH18A1 1 82086 1.21823E-5 41043 0 NA
10-97402755-A-G p.Val99Val synonymous ALDH18A1 1 82230 1.2161E-5 41115 0 NA
10-97402785-G-A p.Gly89Gly synonymous ALDH18A1 2 82806 2.41528E-5 41403 0 NA
10-97402788-A-G p.Cys88Cys synonymous ALDH18A1 1 82848 1.20703E-5 41424 0 1.81602E-4
10-97402793-C-T p.Glu87Lys missense ALDH18A1 2 82898 2.4126E-5 41449 0 4.12637E-5
10-97402797-C-A p.Gly85Gly synonymous ALDH18A1 1 82900 1.20627E-5 41450 0 NA
10-97402801-C-T p.Arg84Gln missense ALDH18A1 1 82920 1.20598E-5 41460 0 1.19397E-5
10-97402802-G-A p.Arg84* stop_gained ALDH18A1 1 82918 1.20601E-5 41459 0 NA
10-97402812-G-A p.Ala80Ala synonymous ALDH18A1 2 82972 2.41045E-5 41486 0 1.98975E-5
10-97402820-C-T p.Gly78Ser missense ALDH18A1 1 83032 1.20435E-5 41516 0 1.59165E-5
10-97402832-C-A p.Val74Leu missense ALDH18A1 1 83044 1.20418E-5 41522 0 3.18451E-5
10-97402833-G-A p.Ile73Ile synonymous ALDH18A1 7 83030 8.43069E-5 41515 0 1.27389E-4
10-97402848-C-G p.Lys68Asn missense ALDH18A1 2 83018 2.40912E-5 41509 0 NA
10-97402858-C-A p.Ser65Ile missense ALDH18A1 20 83002 2.40958E-4 41501 0 1.59195E-4
10-97402861-C-T p.Arg64His missense ALDH18A1 3 82978 3.61542E-5 41489 0 3.97991E-6
10-97402862-G-A p.Arg64Cys missense ALDH18A1 2 82978 2.41028E-5 41489 0 2.78631E-5
10-97402869-G-A p.Phe61Phe synonymous ALDH18A1 1 82954 1.20549E-5 41477 0 2.78614E-5
10-97402883-G-T p.His57Asn missense ALDH18A1 1 82908 1.20616E-5 41454 0 4.12419E-5
10-97402888-C-T p.Arg55His missense ALDH18A1 1 82892 1.20639E-5 41446 0 4.12507E-5
10-97402902-A-G p.Thr50Thr synonymous ALDH18A1 1 82762 1.20828E-5 41381 0 3.98184E-6
10-97402904-T-C p.Thr50Ala missense ALDH18A1 5 82744 6.04273E-5 41372 0 9.55536E-5
10-97402911-C-T p.Pro47Pro synonymous ALDH18A1 2 82638 2.42019E-5 41319 0 6.36943E-5
10-97402912-G-A p.Pro47Leu missense ALDH18A1 1 82606 1.21057E-5 41303 0 3.98298E-6
10-97402913-G-T p.Pro47Thr missense ALDH18A1 3 82602 3.63187E-5 41301 0 NA
10-97402930-C-T p.Arg41His missense ALDH18A1 3 82194 3.6499E-5 41097 0 1.32356E-4
10-97402931-G-A p.Arg41Cys missense ALDH18A1 2 82164 2.43416E-5 41082 0 6.61923E-5
10-97402956-G-T p.Ile32Ile synonymous ALDH18A1 4 81292 4.92053E-5 40646 0 6.25E-4
10-97402962-A-G p.His30His splice_region+synonymous ALDH18A1 1 81066 1.23356E-5 40533 0 NA
10-97402963-T-TGAGATCTGAAGACGGTTGTACACTTGACCCAGGGCAGAAGATGTTGGTTGAAGGG c.89-1_89insCCCTTCAACCAACATCTTCTGCCCTGGGTCAAGTGTACAACCGTCTTCAGATCTC splice_acceptor ALDH18A1 2 81000 2.46914E-5 40500 1 NA
10-97413047-G-A p.His30Tyr missense+splice_region ALDH18A1 2 83402 2.39802E-5 41701 0 0.00100705
10-97413049-G-A p.Ser29Phe missense+splice_region ALDH18A1 1 83402 1.19901E-5 41701 0 8.23696E-6
10-97413060-G-A p.Thr25Thr synonymous ALDH18A1 1 83404 1.19898E-5 41702 0 5.03525E-4
10-97413062-T-C p.Thr25Ala missense ALDH18A1 1 83404 1.19898E-5 41702 0 3.9763E-6
10-97413093-G-A p.Asn14Asn synonymous ALDH18A1 2 83422 2.39745E-5 41711 0 3.1957E-5
10-97413108-C-G p.Gly9Gly synonymous ALDH18A1 1 83418 1.19878E-5 41709 0 2.47121E-5
10-97413110-C-A p.Gly9Trp missense ALDH18A1 1 83418 1.19878E-5 41709 0 NA
10-97413113-A-T p.Cys8Ser missense ALDH18A1 1 83414 1.19884E-5 41707 0 NA
10-97413115-C-T p.Arg7His missense ALDH18A1 1 83408 1.19893E-5 41704 0 3.18097E-5
10-97413115-C-G p.Arg7Pro missense ALDH18A1 2 83410 2.39779E-5 41705 0 1.59048E-5
10-97413116-G-A p.Arg7Cys missense ALDH18A1 2 83410 2.39779E-5 41705 0 3.19795E-5
10-97413123-T-C p.Gln4Gln synonymous ALDH18A1 2 83406 2.39791E-5 41703 0 NA
10-97413127-C-T p.Ser3Asn missense ALDH18A1 1 83398 1.19907E-5 41699 0 NA
10-97413131-A-G p.Leu2Leu synonymous ALDH18A1 10 83394 1.19913E-4 41697 0 2.87393E-4
10-97413140-G-A c.-6C>T 5_prime_UTR_premature_start_codon_gain ALDH18A1 1 83390 1.19918E-5 41695 0 1.64788E-5
10-97413150-C-A c.-16G>T 5_prime_UTR_premature_start_codon_gain ALDH18A1 3 83380 3.59799E-5 41690 0 NA
10-97413163-C-CCA c.-28-2_-28-1insTG splice_acceptor ALDH18A1 1 83354 1.1997E-5 41677 0 NA
10-97413164-T-TTCCTCACCACC c.-28-3_-28-2insGGTGGTGAGGA splice_region ALDH18A1 5 83350 5.9988E-5 41675 2 NA
10-97413164-T-TTCCTCACCACCGCCGCCTTCGCCCCCTGGCACTACCGCGGGTCC c.-28-3_-28-2insGGACCCGCGGTAGTGCCAGGGGGCGAAGGCGGCGGTGGTGAGGA splice_region ALDH18A1 2 83350 2.39952E-5 41675 1 NA
10-97413164-T-TGGGCCAGATCCCCGGGCCCCGGCACCTGCTCCG c.-28-3_-28-2insCGGAGCAGGTGCCGGGGCCCGGGGATCTGGCCC splice_region ALDH18A1 1 83348 1.19979E-5 41674 0 NA
10-97413166-C-G c.-28-4G>C splice_region ALDH18A1 2 83330 2.4001E-5 41665 0 NA
10-97413169-A-C c.-28-7T>G splice_region ALDH18A1 1 83312 1.20031E-5 41656 0 3.97814E-6