Variant

Variant ID Consequence Effect Gene AC AN AF NS NHOM maxEAF
19-49956444-C-A c.-145C>A 5_prime_UTR_premature_start_codon_gain ALDH16A1 1 33530 2.9824E-5 16765 0 NA
19-49956606-AG-A p.Arg9fs frameshift ALDH16A1 1 70628 1.41587E-5 35314 0 5.43809E-6
19-49956607-G-C p.Gly7Arg missense ALDH16A1 1 70656 1.41531E-5 35328 0 NA
19-49956609-G-A p.Gly7Gly synonymous ALDH16A1 242 70492 0.00343301 35246 2 0.00839289
19-49956612-C-A p.Pro8Pro synonymous ALDH16A1 1 70574 1.41695E-5 35287 0 6.62647E-5
19-49956613-C-A p.Arg9Ser missense ALDH16A1 26 70546 3.68554E-4 35273 0 4.3592E-4
19-49956614-G-A p.Arg9His missense ALDH16A1 1 70446 1.41953E-5 35223 0 NA
19-49956617-C-T p.Ala10Val missense ALDH16A1 2 70510 2.83648E-5 35255 0 5.43993E-6
19-49956621-C-T p.Arg11Arg synonymous ALDH16A1 1 70652 1.41539E-5 35326 0 NA
19-49956625-A-G p.Ile13Val missense ALDH16A1 1 70882 1.4108E-5 35441 0 NA
19-49956632-C-G p.Thr15Ser missense ALDH16A1 6 71008 8.44975E-5 35504 0 6.25E-4
19-49956633-C-T p.Thr15Thr synonymous ALDH16A1 1 70962 1.4092E-5 35481 0 8.50847E-5
19-49956635-C-G p.Ser16Trp missense ALDH16A1 19 70822 2.68278E-4 35411 0 0.00256937
19-49956640-G-T p.Glu18* stop_gained ALDH16A1 3 70676 4.24472E-5 35338 0 NA
19-49956642-G-A p.Glu18Glu synonymous ALDH16A1 1 70640 1.41563E-5 35320 0 5.77161E-6
19-49956646-G-A p.Gly20Arg missense ALDH16A1 2 70176 2.84998E-5 35088 0 8.88968E-5
19-49956646-G-T p.Gly20* stop_gained ALDH16A1 4 70176 5.69995E-5 35088 0 4.44484E-5
19-49956647-G-C p.Gly20Ala missense ALDH16A1 1 70158 1.42535E-5 35079 0 NA
19-49956651-G-C p.Pro21Pro synonymous ALDH16A1 1 69938 1.42984E-5 34969 0 NA
19-49956657-G-C p.Pro23Pro synonymous ALDH16A1 1 69494 1.43897E-5 34747 0 NA
19-49956658-G-A p.Glu24Lys missense ALDH16A1 1 69450 1.43988E-5 34725 0 6.10553E-6
19-49956658-G-C p.Glu24Gln missense ALDH16A1 1 69452 1.43984E-5 34726 0 1.22111E-5
19-49956670-T-A p.Met1? start_lost ALDH16A1 1 68636 1.45696E-5 34318 0 NA
19-49956681-G-C c.90+3G>C splice_region ALDH16A1 3 67534 4.44221E-5 33767 0 6.6632E-5
19-49956683-G-A c.90+5G>A splice_region ALDH16A1 1 67248 1.48703E-5 33624 0 NA
19-49961735-T-TCC c.91-8_91-7insCC splice_region ALDH16A1 1 81348 1.22929E-5 40674 0 NA
19-49961741-A-C c.91-2A>C splice_acceptor ALDH16A1 1 81396 1.22856E-5 40698 0 NA
19-49961758-C-T p.Gln36* stop_gained ALDH16A1 1 81490 1.22714E-5 40745 0 NA
19-49961765-G-A p.Arg38Gln missense ALDH16A1 1 81500 1.22699E-5 40750 0 2.25035E-5
19-49961774-G-A p.Gly41Asp missense ALDH16A1 1 81522 1.22666E-5 40761 0 NA
19-49961780-A-G p.Tyr43Cys missense ALDH16A1 1 81522 1.22666E-5 40761 0 6.37674E-5
19-49961781-T-C p.Tyr43Tyr synonymous ALDH16A1 4 81540 4.90557E-5 40770 0 NA
19-49961790-G-A p.Gly46Gly synonymous ALDH16A1 1 81580 1.22579E-5 40790 0 NA
19-49961801-A-G p.Lys50Arg missense ALDH16A1 2 81588 2.45134E-5 40794 0 NA
19-49961822-T-C p.Val57Ala missense ALDH16A1 1 81590 1.22564E-5 40795 0 1.15937E-5
19-49961837-C-T p.Pro62Leu missense ALDH16A1 1 81530 1.22654E-5 40765 0 NA
19-49961844-AG-A p.Asp61fs frameshift ALDH16A1 2 81498 2.45405E-5 40749 0 NA
19-49961846-GT-G c.193+2delT splice_donor ALDH16A1 6 81480 7.36377E-5 40740 3 NA
19-49961846-G-A c.193+1G>A splice_donor ALDH16A1 2 81484 2.45447E-5 40742 0 3.18674E-5
19-49961849-C-T c.193+4C>T splice_region ALDH16A1 10 81444 1.22784E-4 40722 0 1.29347E-4
19-49961850-G-A c.193+5G>A splice_region ALDH16A1 1 81422 1.22817E-5 40711 0 6.15491E-6
19-49961851-A-AG c.193+6_193+7insG splice_region ALDH16A1 1 81418 1.22823E-5 40709 0 NA
19-49962211-C-T c.194-6C>T splice_region ALDH16A1 1 82978 1.20514E-5 41489 0 8.45809E-6
19-49962211-C-G c.194-6C>G splice_region ALDH16A1 2 82978 2.41028E-5 41489 0 1.60272E-5
19-49962223-A-G p.Asn67Ser missense ALDH16A1 1 83022 1.2045E-5 41511 0 3.18857E-5
19-49962225-T-G p.Leu68Val missense ALDH16A1 1 83028 1.20441E-5 41514 0 1.68362E-5
19-49962238-T-A p.Leu72Gln missense ALDH16A1 4 83014 4.81846E-5 41507 0 1.27445E-4
19-49962242-G-A p.Gln73Gln synonymous ALDH16A1 7 83006 8.43313E-5 41503 1 4.87854E-4
19-49962250-C-T p.Ala76Val missense ALDH16A1 2 82958 2.41086E-5 41479 0 1.11987E-4
19-49962252-G-A p.Glu77Lys missense ALDH16A1 1 82982 1.20508E-5 41491 0 3.36208E-5
19-49962270-G-A p.Val83Met missense ALDH16A1 6 82880 7.23938E-5 41440 0 5.87968E-5
19-49962307-C-T p.Ala95Val missense ALDH16A1 5 82254 6.07873E-5 41127 0 6.26566E-4
19-49962308-G-A p.Ala95Ala synonymous ALDH16A1 15 82178 1.82531E-4 41089 0 5.41712E-4
19-49962314-C-T p.Pro97Pro synonymous ALDH16A1 2 81976 2.43974E-5 40988 0 3.18817E-5
19-49962315-G-A p.Gly98Ser missense ALDH16A1 2 81904 2.44188E-5 40952 0 8.04661E-6
19-49962317-C-T p.Gly98Gly synonymous ALDH16A1 3 81740 3.67017E-5 40870 0 NA
19-49962318-G-A p.Val99Ile missense ALDH16A1 3 81692 3.67233E-5 40846 0 2.54838E-5
19-49962319-T-G p.Val99Gly missense ALDH16A1 1 81576 1.22585E-5 40788 0 1.27486E-4
19-49962320-C-T p.Val99Val synonymous ALDH16A1 2 81560 2.45218E-5 40780 0 NA
19-49962321-G-A p.Val100Ile missense ALDH16A1 3 81430 3.68415E-5 40715 0 3.18715E-5
19-49962324-C-T p.Arg101Trp missense ALDH16A1 1 81340 1.22941E-5 40670 0 NA
19-49962325-G-A p.Arg101Gln missense ALDH16A1 1 81176 1.23189E-5 40588 0 6.37471E-5
19-49962327-G-T p.Ala102Ser missense ALDH16A1 1 80992 1.23469E-5 40496 0 8.0705E-6
19-49962342-A-G p.Arg107Gly missense+splice_region ALDH16A1 2 80434 2.48651E-5 40217 0 NA
19-49962921-C-G c.321-6C>G splice_region ALDH16A1 2 83010 2.40935E-5 41505 0 1.59246E-4
19-49962927-G-A p.Ala31Thr missense+splice_region ALDH16A1 5 83076 6.01859E-5 41538 0 5.34513E-5
19-49962934-G-A p.Glu110Lys missense ALDH16A1 1 83096 1.20343E-5 41548 0 1.51523E-4
19-49962947-A-T p.Lys114Met missense ALDH16A1 2 83158 2.40506E-5 41579 0 8.3538E-6
19-49962948-G-C p.Lys114Asn missense ALDH16A1 2 83148 2.40535E-5 41574 0 NA
19-49962950-A-G p.His115Arg missense ALDH16A1 1 83158 1.20253E-5 41579 0 4.09356E-6
19-49962955-C-T p.Arg117Trp missense ALDH16A1 2 83140 2.40558E-5 41570 0 NA
19-49962956-G-A p.Arg117Gln missense ALDH16A1 6 83136 7.21709E-5 41568 0 9.8355E-5
19-49962957-G-C p.Ala41Pro missense ALDH16A1 2 83142 2.40552E-5 41571 0 4.09776E-6
19-49962960-G-T p.Ala42Ser missense ALDH16A1 5 83096 6.01714E-5 41548 0 1.59256E-4
19-49962963-G-A p.Val43Met missense ALDH16A1 1 83044 1.20418E-5 41522 0 NA
19-49962964-T-C p.Trp120Arg missense ALDH16A1 2 83050 2.40819E-5 41525 0 8.32778E-6
19-49962981-G-A p.Gly49Ser missense ALDH16A1 6 83062 7.22352E-5 41531 0 1.16451E-4
19-49962986-C-G p.Thr127Ser missense ALDH16A1 859 83028 0.0103459 41514 7 0.00970704
19-49962991-C-T p.Arg129Trp missense ALDH16A1 9 83044 1.08376E-4 41522 1 3.18573E-5
19-49962992-G-C p.Arg129Pro missense ALDH16A1 1 83090 1.20351E-5 41545 0 NA
19-49962992-G-A p.Arg129Gln missense ALDH16A1 1 83090 1.20351E-5 41545 0 4.15856E-5
19-49963001-G-A p.Arg132Gln missense ALDH16A1 80 83072 9.6302E-4 41536 0 0.0020141
19-49963009-C-T p.Arg135* stop_gained ALDH16A1 3 83060 3.61185E-5 41530 0 2.49509E-5
19-49963010-G-A p.Arg135Gln missense ALDH16A1 19 83058 2.28756E-4 41529 0 3.50497E-4
19-49963014-C-T p.Arg60Trp missense ALDH16A1 3 83070 3.61141E-5 41535 0 6.25E-4
19-49963015-G-A p.Gly137Arg missense ALDH16A1 40 83088 4.81417E-4 41544 0 6.69472E-4
19-49963020-C-T p.Arg62Cys missense ALDH16A1 4 83034 4.8173E-5 41517 0 NA
19-49963021-G-A p.Val139Ile missense ALDH16A1 37 83028 4.45633E-4 41514 0 0.00100705
19-49963032-C-T p.Pro66Ser missense ALDH16A1 1 83058 1.20398E-5 41529 0 NA
19-49963034-A-G p.Gln143Arg missense ALDH16A1 1 83034 1.20433E-5 41517 0 8.32792E-6
19-49963035-G-A p.Ala67Thr missense ALDH16A1 21 83024 2.52939E-4 41512 0 3.18573E-4
19-49963051-C-T p.His149Tyr missense ALDH16A1 5 82990 6.02482E-5 41495 0 8.34042E-6
19-49963059-C-A p.Pro75Thr missense ALDH16A1 4 82950 4.82218E-5 41475 0 NA
19-49963092-C-T c.-10C>T 5_prime_UTR_premature_start_codon_gain ALDH16A1 2 82668 2.41932E-5 41334 0 4.22576E-5
19-49963096-G-A p.Glu164Lys missense ALDH16A1 1 82640 1.21007E-5 41320 0 4.8168E-5
19-49964075-G-A c.500-4G>A splice_region ALDH16A1 2 72992 2.74003E-5 36496 0 1.673E-5
19-49964078-G-A c.500-1G>A splice_acceptor ALDH16A1 2 73916 2.70577E-5 36958 0 NA
19-49964079-G-A p.Gly167Glu missense+splice_region ALDH16A1 2 74200 2.69542E-5 37100 0 3.99186E-6
19-49964085-T-C p.Ile169Thr missense ALDH16A1 2 75928 2.63407E-5 37964 0 9.57488E-5
19-49964090-C-G p.Leu171Val missense ALDH16A1 1 77004 1.29863E-5 38502 0 NA
19-49964092-C-T p.His95Tyr missense ALDH16A1 3 77182 3.88692E-5 38591 0 5.82566E-5
19-49964104-C-A p.His99Asn missense ALDH16A1 1 78112 1.28021E-5 39056 0 NA
19-49964110-C-T p.Leu101Phe missense ALDH16A1 3 78408 3.82614E-5 39204 0 7.96711E-5
19-49964111-T-C p.Ser178Pro missense ALDH16A1 14 78410 1.78549E-4 39205 0 4.23279E-4
19-49964113-C-T p.Leu102Phe missense ALDH16A1 3 78422 3.82546E-5 39211 0 5.03525E-4
19-49964114-T-G p.Phe179Val missense ALDH16A1 1 78366 1.27606E-5 39183 0 8.29752E-6
19-49964120-G-A p.Glu181Lys missense ALDH16A1 1 78174 1.2792E-5 39087 0 NA
19-49964142-C-T p.Pro188Leu missense ALDH16A1 2 78096 2.56095E-5 39048 0 8.28954E-6
19-49964146-C-T p.Ala189Ala synonymous ALDH16A1 1 77930 1.2832E-5 38965 0 NA
19-49964157-GT-G c.577+2delT splice_donor ALDH16A1 1 77348 1.29286E-5 38674 0 NA
19-49964162-T-C c.577+6T>C splice_region ALDH16A1 1 77110 1.29685E-5 38555 0 1.59469E-4
19-49964883-C-T p.Thr195Thr synonymous ALDH16A1 24 77340 3.10318E-4 38670 0 5.79056E-4
19-49964887-G-T p.Val197Leu missense ALDH16A1 1 77574 1.28909E-5 38787 0 3.20082E-5
19-49964890-G-T p.Ala198Ser missense ALDH16A1 1 77684 1.28727E-5 38842 0 NA
19-49964896-G-A p.Val200Met missense ALDH16A1 2 78032 2.56305E-5 39016 0 6.36943E-4
19-49964900-C-T p.Pro201Leu missense ALDH16A1 1 78356 1.27623E-5 39178 0 NA
19-49964901-C-T p.Pro201Pro synonymous ALDH16A1 1 78416 1.27525E-5 39208 0 NA
19-49964903-C-G p.Pro202Arg missense ALDH16A1 8 78468 1.01952E-4 39234 0 9.59447E-5
19-49964903-C-T p.Pro202Leu missense ALDH16A1 1 78468 1.2744E-5 39234 0 6.08865E-5
19-49964904-G-A p.Pro202Pro synonymous ALDH16A1 1 78498 1.27392E-5 39249 0 2.72779E-5
19-49964905-G-A p.Ala203Thr missense ALDH16A1 2 78520 2.54712E-5 39260 0 NA
19-49964912-C-T p.Pro205Leu missense ALDH16A1 4 78794 5.07653E-5 39397 0 8.65681E-5
19-49964913-G-T p.Pro205Pro synonymous ALDH16A1 2 78758 2.53942E-5 39379 0 3.39847E-5
19-49964913-G-A p.Pro205Pro synonymous ALDH16A1 2 78758 2.53942E-5 39379 0 3.39847E-5
19-49964923-C-G p.Leu209Val missense ALDH16A1 3 79302 3.78301E-5 39651 0 9.58466E-5
19-49964930-C-A p.Ala211Asp missense ALDH16A1 1 79414 1.25922E-5 39707 0 1.40138E-5
19-49964937-G-C p.Leu213Leu synonymous ALDH16A1 1 79558 1.25694E-5 39779 0 NA
19-49964939-C-G p.Ala214Gly missense ALDH16A1 1 79550 1.25707E-5 39775 0 NA
19-49964940-G-C p.Ala214Ala synonymous ALDH16A1 1 79704 1.25464E-5 39852 0 1.32265E-5
19-49964943-G-A p.Gly215Gly synonymous ALDH16A1 4 79766 5.01467E-5 39883 0 2.57911E-5
19-49964950-G-A p.Gly218Ser missense ALDH16A1 1 79964 1.25056E-5 39982 0 1.2462E-5
19-49964951-G-A p.Gly218Asp missense ALDH16A1 2 79966 2.50106E-5 39983 0 8.71753E-5
19-49964953-C-T p.Pro219Ser missense ALDH16A1 1 80086 1.24866E-5 40043 0 NA
19-49964954-C-G p.Pro219Arg missense ALDH16A1 1 80172 1.24732E-5 40086 0 NA
19-49964960-C-T p.Pro221Leu missense ALDH16A1 4 80308 4.98082E-5 40154 0 5.93204E-5
19-49964960-C-G p.Pro221Arg missense ALDH16A1 1 80308 1.24521E-5 40154 0 1.18641E-5
19-49964961-G-A p.Pro221Pro synonymous ALDH16A1 1 80264 1.24589E-5 40132 0 2.35688E-5
19-49964968-C-T p.Leu224Leu synonymous ALDH16A1 15 80576 1.8616E-4 40288 0 0.00252525
19-49964969-T-C p.Leu224Pro missense ALDH16A1 140 80590 0.00173719 40295 0 0.00252332
19-49964973-T-A p.Asn225Lys missense ALDH16A1 1 80652 1.23989E-5 40326 0 6.3861E-5
19-49964974-G-T p.Val226Phe missense ALDH16A1 1 80650 1.23993E-5 40325 0 1.11287E-5
19-49964976-C-G p.Val226Val synonymous ALDH16A1 1 80654 1.23986E-5 40327 0 1.66007E-5
19-49964976-CC-GG p.ValLeu226ValVal missense ALDH16A1 1 80654 1.23986E-5 40327 0 NA
19-49964977-C-G p.Leu227Val missense ALDH16A1 53419 79940 0.668239 39970 18462 0.735621
19-49964977-C-A p.Leu227Ile missense ALDH16A1 1 80672 1.23959E-5 40336 0 3.2041E-5
19-49964983-G-A p.Gly229Ser missense ALDH16A1 11 80742 1.36236E-4 40371 0 1.08816E-4
19-49964983-G-C p.Gly229Arg missense ALDH16A1 1 80742 1.23851E-5 40371 0 NA
19-49964990-C-T p.Ala231Val missense ALDH16A1 3 80786 3.71351E-5 40393 0 3.99505E-5
19-49964993-C-G p.Ser232Cys missense ALDH16A1 2 80846 2.47384E-5 40423 0 NA
19-49965000-G-A p.Val234Val synonymous ALDH16A1 5 80850 6.18429E-5 40425 0 6.6695E-5
19-49965007-C-G p.Leu237Val missense ALDH16A1 1 80880 1.2364E-5 40440 0 NA
19-49965010-G-A p.Ala238Thr missense ALDH16A1 1 80832 1.23713E-5 40416 0 1.00707E-5
19-49965018-G-C p.Gln240His missense ALDH16A1 1 80900 1.23609E-5 40450 0 NA
19-49965027-C-G p.Ile243Met missense ALDH16A1 4 80844 4.9478E-5 40422 0 3.29397E-5
19-49965029-G-A p.Arg244Gln missense ALDH16A1 1 80846 1.23692E-5 40423 0 9.57854E-5
19-49965034-G-GTGGCC p.Phe248fs frameshift ALDH16A1 1 80828 1.2372E-5 40414 0 NA
19-49965037-G-A p.Ala247Thr missense ALDH16A1 1 80756 1.2383E-5 40378 0 1.24041E-5
19-49965040-TT-CA p.Phe248His missense ALDH16A1 1 80782 1.2379E-5 40391 0 NA
19-49965046-G-A p.Gly250Arg missense ALDH16A1 2 80572 2.48225E-5 40286 0 8.43864E-5
19-49965047-G-A p.Gly250Glu missense ALDH16A1 1 80560 1.24131E-5 40280 0 NA
19-49965050-C-G p.Ala251Gly missense ALDH16A1 1 80474 1.24264E-5 40237 0 NA
19-49965051-C-T p.Ala251Ala synonymous ALDH16A1 1 80466 1.24276E-5 40233 0 NA
19-49965053-C-T p.Pro252Leu missense ALDH16A1 2 80454 2.48589E-5 40227 0 9.58466E-5
19-49965054-G-A p.Pro252Pro synonymous ALDH16A1 7 80432 8.703E-5 40216 0 8.5377E-5
19-49965055-GAGGTACCTTCGGGACAGGGGTCGTGGCGGAACGCGGCTGGGGGCCGCAAGGCTCCTCCTGCGGCTGAACTGGGGGGGGTCCCT-G p.Glu254fs frameshift ALDH16A1 7 80398 8.70668E-5 40199 0 NA
19-49965059-T-C c.759+2T>C splice_donor ALDH16A1 1 80342 1.24468E-5 40171 0 NA
19-49965065-C-T c.759+8C>T splice_region ALDH16A1 1 80194 1.24698E-5 40097 0 4.20585E-6
19-49965125-TG-T c.760-8delG splice_region ALDH16A1 551 79534 0.00692785 39767 9 0.00907517
19-49965125-TGGG-T c.760-10_760-8delGGG splice_region ALDH16A1 132 79562 0.00165908 39781 0 0.0039764
19-49965125-T-TG c.760-8dupG splice_region ALDH16A1 63 79556 7.91895E-4 39778 0 9.40616E-4
19-49965132-G-GAC c.760-9_760-8insAC splice_region ALDH16A1 114 79492 0.00143411 39746 0 0.00397921
19-49965133-G-A c.760-8G>A splice_region ALDH16A1 1 79576 1.25666E-5 39788 0 1.59714E-4
19-49965137-C-T c.760-4C>T splice_region ALDH16A1 1 79560 1.25691E-5 39780 0 1.69125E-5
19-49965145-G-A p.Gly255Glu missense ALDH16A1 1 79590 1.25644E-5 39795 0 9.73425E-6
19-49965146-G-A p.Gly255Gly synonymous ALDH16A1 5 79502 6.28915E-5 39751 0 8.70534E-5
19-49965147-C-T p.Arg256Cys missense ALDH16A1 1 79440 1.25881E-5 39720 0 3.54711E-5
19-49965151-C-T p.Ala257Val missense ALDH16A1 1 79388 1.25964E-5 39694 0 4.9686E-6
19-49965156-C-G p.Arg259Gly missense ALDH16A1 1 79254 1.26177E-5 39627 0 1.84067E-5
19-49965157-G-A p.Arg259Gln missense ALDH16A1 2 79216 2.52474E-5 39608 0 5.58867E-5
19-49965158-A-T p.Arg259Arg synonymous ALDH16A1 23 79150 2.90587E-4 39575 1 0.006875
19-49965159-C-T p.Arg260Trp missense ALDH16A1 15 79088 1.89662E-4 39544 0 2.15371E-4
19-49965160-G-A p.Arg260Gln missense ALDH16A1 1 79114 1.264E-5 39557 0 NA
19-49965164-C-G p.Ser261Arg missense ALDH16A1 1 78908 1.2673E-5 39454 0 1.53439E-5
19-49965168-G-A p.Ala263Thr missense ALDH16A1 1 78816 1.26878E-5 39408 0 1.95879E-4
19-49965168-GC-AA p.Ala263Lys missense ALDH16A1 5 78816 6.34389E-5 39408 0 NA
19-49965169-C-A p.Ala263Glu missense ALDH16A1 1 78696 1.27071E-5 39348 0 2.17168E-4
19-49965170-G-A p.Ala263Ala synonymous ALDH16A1 17 78752 2.15868E-4 39376 1 1.1892E-4
19-49965172-G-A p.Gly264Glu missense ALDH16A1 65 78688 8.26047E-4 39344 1 0.00198172
19-49965173-A-T p.Gly264Gly synonymous ALDH16A1 27050 74276 0.364182 37138 4797 0.493125
19-49965176-G-A p.Glu265Glu synonymous ALDH16A1 45 78450 5.73614E-4 39225 0 0.00153531
19-49965178-G-C p.Cys266Ser missense ALDH16A1 1 78352 1.27629E-5 39176 0 NA
19-49965181-C-T p.Ala267Val missense ALDH16A1 5 78024 6.40828E-5 39012 0 1.05893E-5
19-49965181-C-G p.Ala267Gly missense ALDH16A1 1 78024 1.28166E-5 39012 0 3.21481E-5
19-49965182-G-A p.Ala267Ala synonymous ALDH16A1 73 78082 9.34915E-4 39041 0 0.00255624
19-49965183-G-A p.Glu268Lys missense ALDH16A1 1 78018 1.28176E-5 39009 0 NA
19-49965185-G-A p.Glu268Glu synonymous ALDH16A1 257 77816 0.00330266 38908 3 0.00671055
19-49965186-C-G p.Leu269Val missense ALDH16A1 1 77778 1.28571E-5 38889 0 NA
19-49965196-C-T p.Ala272Val missense ALDH16A1 1 76698 1.30381E-5 38349 0 5.48859E-6
19-49965197-G-C p.Ala272Ala synonymous ALDH16A1 2 76600 2.61097E-5 38300 0 6.59044E-5
19-49965198-C-A p.Leu273Met missense ALDH16A1 1 76542 1.30647E-5 38271 0 NA
19-49965206-G-A p.Thr275Thr synonymous ALDH16A1 7 75428 9.28037E-5 37714 0 1.27828E-4
19-49965211-CGCT-C p.Leu281del conservative_inframe_deletion ALDH16A1 1 74492 1.34243E-5 37246 0 8.0469E-5
19-49965211-C-CGCT p.Leu281dup conservative_inframe_insertion ALDH16A1 3 74510 4.02631E-5 37255 0 3.29142E-5
19-49965211-C-T p.Ser277Leu missense ALDH16A1 29 74506 3.8923E-4 37253 0 0.00154799
19-49965212-G-A p.Ser277Ser synonymous ALDH16A1 3 73996 4.05427E-5 36998 0 0.00102881
19-49965226-C-T p.Thr282Met missense ALDH16A1 1 71926 1.39032E-5 35963 0 4.57164E-5
19-49965227-G-T p.Thr282Thr synonymous ALDH16A1 57 71664 7.95378E-4 35832 0 0.00308008
19-49965227-G-A p.Thr282Thr synonymous ALDH16A1 3 71674 4.18562E-5 35837 0 4.5438E-5
19-49965228-G-A p.Asp283Asn missense ALDH16A1 2 71468 2.79846E-5 35734 0 6.33665E-6
19-49965232-C-T p.Thr284Met missense ALDH16A1 3 70170 4.27533E-5 35085 0 9.58589E-5
19-49965236-G-A p.Ala285Ala synonymous ALDH16A1 1 68682 1.45599E-5 34341 0 3.19305E-5
19-49965239-C-T p.Asp286Asp synonymous ALDH16A1 1 67034 1.49178E-5 33517 0 0.00155763
19-49965240-G-A p.Val287Ile missense ALDH16A1 1 66982 1.49294E-5 33491 0 1.33041E-5
19-49965246-T-A p.Ser289Thr missense ALDH16A1 99 65684 0.00150722 32842 0 0.00268442
19-49965248-G-A p.Ser289Ser synonymous ALDH16A1 4 64964 6.15726E-5 32482 0 3.19305E-5
19-49965252-G-A p.Val291Met missense ALDH16A1 99 63882 0.00154973 31941 0 0.00259875
19-49965253-T-C p.Val291Ala missense ALDH16A1 2 63652 3.14209E-5 31826 0 NA
19-49965259-G-T p.Gly293Val missense ALDH16A1 1 62806 1.5922E-5 31403 0 NA
19-49965260-T-TGTCGTGGACGCC p.Val294_Ala297dup disruptive_inframe_insertion ALDH16A1 1 62202 1.60767E-5 31101 0 NA
19-49965263-C-T p.Val294Val synonymous ALDH16A1 1 61324 1.63068E-5 30662 0 6.10054E-5
19-49965264-G-A p.Val295Met missense ALDH16A1 2 61144 3.27097E-5 30572 0 4.21609E-5
19-49965266-G-T p.Val295Val synonymous ALDH16A1 1 60546 1.65164E-5 30273 0 NA
19-49965267-G-A p.Asp296Asn missense ALDH16A1 1 60406 1.65546E-5 30203 0 7.05557E-6
19-49965269-C-T p.Asp296Asp synonymous ALDH16A1 1 59538 1.6796E-5 29769 0 7.06694E-6
19-49965272-C-T p.Ala297Ala synonymous ALDH16A1 2 58334 3.42853E-5 29167 0 7.12454E-6
19-49965275-C-A p.Ala298Ala synonymous ALDH16A1 2 58062 3.44459E-5 29031 0 NA
19-49965281-C-G p.Ser300Ser synonymous ALDH16A1 1 57042 1.75309E-5 28521 0 NA
19-49965281-C-T p.Ser300Ser synonymous ALDH16A1 2 57042 3.50619E-5 28521 0 1.44283E-5
19-49965282-G-A p.Asp301Asn missense ALDH16A1 3 56720 5.28914E-5 28360 0 6.58588E-5
19-49965292-C-T p.Pro304Leu missense+splice_region ALDH16A1 1 53798 1.85881E-5 26899 0 6.8861E-5
19-49965831-G-A p.Gly306Asp missense ALDH16A1 2 82516 2.42377E-5 41258 0 NA
19-49965839-C-G p.Leu309Val missense ALDH16A1 2 82628 2.42049E-5 41314 0 NA
19-49965841-C-T p.Leu309Leu synonymous ALDH16A1 1 82640 1.21007E-5 41320 0 3.99052E-6
19-49965845-A-G p.Ile311Val missense ALDH16A1 1 82658 1.2098E-5 41329 0 3.3189E-5
19-49965858-T-G p.Val315Gly missense ALDH16A1 1 82650 1.20992E-5 41325 0 NA
19-49965860-T-C p.Trp316Arg missense ALDH16A1 1 82670 1.20963E-5 41335 0 9.56457E-5
19-49965861-G-A p.Trp316* stop_gained ALDH16A1 2 82698 2.41844E-5 41349 0 3.18492E-5
19-49965870-C-T p.Ala319Val missense ALDH16A1 36 82676 4.35435E-4 41338 0 4.14333E-4
19-49965878-C-T p.Arg322Trp missense ALDH16A1 3 82626 3.63082E-5 41313 0 1.19557E-5
19-49965880-G-A p.Arg322Arg synonymous ALDH16A1 1 82636 1.21013E-5 41318 0 NA
19-49965883-G-T p.Leu323Leu synonymous ALDH16A1 1 82620 1.21036E-5 41310 0 8.29876E-6
19-49965890-C-T p.Arg326Trp missense ALDH16A1 4 82508 4.84801E-5 41254 0 8.3149E-6
19-49965899-C-T p.Arg329Trp missense ALDH16A1 16 82320 1.94363E-4 41160 0 5.19157E-5
19-49965900-G-A p.Arg329Gln missense ALDH16A1 5 82326 6.07342E-5 41163 0 0.00125471
19-49965906-G-A p.Arg331Gln missense ALDH16A1 1 82198 1.21657E-5 41099 0 1.9992E-5
19-49965908-A-G p.Ser332Gly missense ALDH16A1 1 82140 1.21743E-5 41070 0 8.35575E-6
19-49965914-C-T p.Arg334* stop_gained ALDH16A1 2 82014 2.43861E-5 41007 0 3.18674E-5
19-49965914-C-G p.Arg334Gly missense ALDH16A1 1 82014 1.2193E-5 41007 0 4.00647E-6
19-49965915-G-A p.Arg334Gln missense ALDH16A1 1 82034 1.21901E-5 41017 0 9.55962E-5
19-49965918-G-A p.Gly335Glu missense ALDH16A1 1 82002 1.21948E-5 41001 0 4.01436E-6
19-49965920-C-G p.Leu336Val missense ALDH16A1 4 81896 4.88424E-5 40948 0 8.03497E-6
19-49965931-C-T p.Ala339Ala synonymous ALDH16A1 2 81590 2.45128E-5 40795 0 8.46511E-6
19-49965931-C-G p.Ala339Ala synonymous ALDH16A1 1 81590 1.22564E-5 40795 0 2.53953E-5
19-49965932-G-A p.Val340Met missense ALDH16A1 6 81600 7.35294E-5 40800 0 3.39098E-5
19-49965938-A-G p.Met342Val missense ALDH16A1 2 81382 2.45755E-5 40691 0 1.63155E-5
19-49965944-G-GC p.Arg345fs frameshift ALDH16A1 1 81060 1.23365E-5 40530 0 4.10159E-6
19-49965944-GC-G p.Arg345fs frameshift ALDH16A1 1 81060 1.23365E-5 40530 0 4.51175E-5
19-49965947-C-CG p.Ala347fs frameshift ALDH16A1 1 80810 1.23747E-5 40405 0 8.27205E-6
19-49965947-C-T p.Arg345Trp missense ALDH16A1 1 80810 1.23747E-5 40405 0 8.62768E-6
19-49965948-G-A p.Arg345Gln missense ALDH16A1 8 80932 9.88484E-5 40466 0 8.25341E-5
19-49965948-G-C p.Arg345Pro missense ALDH16A1 5 80932 6.17803E-5 40466 0 4.30344E-5
19-49965948-G-GTGGACAT p.Ala347fs frameshift ALDH16A1 1 80932 1.23561E-5 40466 0 6.37471E-5
19-49965949-G-T p.Arg345Arg synonymous ALDH16A1 1 80900 1.23609E-5 40450 0 6.37227E-5
19-49965950-G-A p.Gly346Arg missense ALDH16A1 1 80888 1.23628E-5 40444 0 8.59609E-6
19-49965952-G-T p.Gly346Gly synonymous ALDH16A1 1 80792 1.23775E-5 40396 0 9.03944E-5
19-49965952-GGCT-G p.Ala348del disruptive_inframe_deletion ALDH16A1 1 80792 1.23775E-5 40396 0 6.37105E-5
19-49965953-G-A p.Ala347Thr missense ALDH16A1 14 80628 1.73637E-4 40314 0 1.56063E-4
19-49965953-GCTGCCGCATGTGACCTGGTCCAGC-G p.Ala347_Arg355delinsGly disruptive_inframe_deletion ALDH16A1 2 80632 2.4804E-5 40316 0 6.59663E-5
19-49965954-C-T p.Ala347Val missense ALDH16A1 5 80600 6.20347E-5 40300 0 NA
19-49965956-G-A p.Ala348Thr missense ALDH16A1 1115 80356 0.0138758 40178 44 0.02884
19-49965961-A-G p.Ala349Ala synonymous ALDH16A1 1 80232 1.24639E-5 40116 0 4.10867E-6
19-49965967-C-T p.Asp351Asp synonymous ALDH16A1 93 79996 0.00116256 39998 0 0.00309094
19-49965969-T-C p.Leu352Pro missense ALDH16A1 1 79996 1.25006E-5 39998 0 8.76824E-6
19-49965971-G-C p.Val353Leu missense ALDH16A1 1 79880 1.25188E-5 39940 0 4.55887E-5
19-49965974-C-T p.Gln354* stop_gained ALDH16A1 1 79764 1.2537E-5 39882 0 NA
19-49965982-T-C p.Phe356Phe synonymous ALDH16A1 1 79304 1.26097E-5 39652 0 8.98731E-6
19-49965986-C-T p.Arg358Cys missense ALDH16A1 3 78812 3.80653E-5 39406 0 NA
19-49965986-C-G p.Arg358Gly missense ALDH16A1 1 78812 1.26884E-5 39406 0 NA
19-49965987-G-A p.Arg358His missense ALDH16A1 11 78872 1.39466E-4 39436 0 1.91217E-4
19-49965994-C-G p.Ala360Ala synonymous ALDH16A1 9 78326 1.14904E-4 39163 0 4.78042E-4
19-49966007-GCA-G p.Gln366fs frameshift ALDH16A1 1 77338 1.29303E-5 38669 0 4.58404E-6
19-49966012-G-A p.Gln366Gln splice_region+synonymous ALDH16A1 1 77060 1.29769E-5 38530 0 NA
19-49967129-G-C p.Val373Leu missense ALDH16A1 2 83222 2.40321E-5 41611 0 1.59565E-5
19-49967136-C-T p.Ser375Leu missense ALDH16A1 7 83226 8.41083E-5 41613 0 2.48979E-5
19-49967136-C-G p.Ser375Trp missense ALDH16A1 1 83226 1.20155E-5 41613 0 NA
19-49967137-G-A p.Ser375Ser synonymous ALDH16A1 2 83226 2.4031E-5 41613 0 1.27853E-4
19-49967141-C-G p.Arg377Gly missense ALDH16A1 1 83234 1.20143E-5 41617 0 NA
19-49967141-C-T p.Arg377Cys missense ALDH16A1 1 83234 1.20143E-5 41617 0 3.19795E-5
19-49967142-G-A p.Arg377His missense ALDH16A1 50 83216 6.00846E-4 41608 0 0.0019826
19-49967157-C-A p.Pro382Gln missense ALDH16A1 1 83236 1.2014E-5 41618 0 NA
19-49967170-C-T p.Ser386Ser synonymous ALDH16A1 1 83224 1.20158E-5 41612 0 2.79488E-5
19-49967179-C-T p.Pro389Pro synonymous ALDH16A1 4 83212 4.807E-5 41606 0 8.02118E-6
19-49967188-C-T p.Ser392Ser synonymous ALDH16A1 1 83168 1.20239E-5 41584 0 NA
19-49967189-C-T p.Pro393Ser missense ALDH16A1 1 83160 1.2025E-5 41580 0 NA
19-49967191-A-G p.Pro393Pro synonymous ALDH16A1 1 83126 1.20299E-5 41563 0 5.03525E-4
19-49967210-A-C c.1194+4A>C splice_region ALDH16A1 1 83004 1.20476E-5 41502 0 NA
19-49967211-G-A c.1194+5G>A splice_region ALDH16A1 1 82992 1.20494E-5 41496 0 3.29416E-5
19-49967378-T-C c.1195-6T>C splice_region ALDH16A1 1 77186 1.29557E-5 38593 0 NA
19-49967380-G-C c.1195-4G>C splice_region ALDH16A1 2 77040 2.59605E-5 38520 0 2.8946E-5
19-49967388-C-T p.Pro400Leu missense ALDH16A1 1 76410 1.30873E-5 38205 0 8.26918E-6
19-49967389-G-A p.Pro400Pro synonymous ALDH16A1 4 76438 5.233E-5 38219 0 3.47494E-5
19-49967396-G-C p.Val403Leu missense ALDH16A1 16 76322 2.09638E-4 38161 0 9.5706E-5
19-49967401-C-T p.Val404Val synonymous ALDH16A1 3 75890 3.95309E-5 37945 0 9.5706E-5
19-49967402-G-A p.Val405Met missense ALDH16A1 2 75758 2.63999E-5 37879 0 2.48614E-5
19-49967404-G-C p.Val405Val synonymous ALDH16A1 242 75754 0.00319455 37877 2 0.00740126
19-49967411-C-T p.Pro408Ser missense ALDH16A1 2 75764 2.63978E-5 37882 0 8.29215E-6
19-49967412-C-G p.Pro408Arg missense ALDH16A1 1 75784 1.31954E-5 37892 0 8.74156E-6
19-49967417-C-T p.Arg410Cys missense ALDH16A1 2 75544 2.64746E-5 37772 0 3.50834E-5
19-49967418-G-C p.Arg410Pro missense ALDH16A1 10 75268 1.32859E-4 37634 0 5.04032E-4
19-49967420-A-G p.Thr411Ala missense ALDH16A1 1 75378 1.32665E-5 37689 0 8.78071E-6
19-49967421-C-T p.Thr411Ile missense ALDH16A1 3 75390 3.97931E-5 37695 0 3.18796E-5
19-49967435-C-T p.Leu416Leu synonymous ALDH16A1 1 75056 1.33234E-5 37528 0 8.33611E-6
19-49967449-C-T p.Asn420Asn synonymous ALDH16A1 25 74532 3.35426E-4 37266 0 5.05051E-4
19-49967454-C-T p.Thr422Met missense ALDH16A1 32 74154 4.31534E-4 37077 0 7.84264E-4
19-49967459-C-T p.Arg424Cys missense ALDH16A1 3 74264 4.03964E-5 37132 0 0.00201816
19-49967460-G-A p.Arg424His missense ALDH16A1 1 74192 1.34785E-5 37096 0 1.7003E-5
19-49967460-G-T p.Arg424Leu missense ALDH16A1 1 74192 1.34785E-5 37096 0 NA
19-49967461-C-A p.Arg424Arg synonymous ALDH16A1 1 74252 1.34677E-5 37126 0 NA
19-49967462-G-A p.Gly425Arg missense ALDH16A1 3 74386 4.03302E-5 37193 0 2.97076E-5
19-49967470-C-T p.Ser427Ser synonymous ALDH16A1 1 74230 1.34716E-5 37115 0 8.49834E-6
19-49967481-G-A p.Trp431* stop_gained ALDH16A1 1 74830 1.33636E-5 37415 0 NA
19-49967484-G-A p.Ser432Asn missense ALDH16A1 8 74640 1.07181E-4 37320 0 6.38447E-5
19-49967485-C-T p.Ser432Ser synonymous ALDH16A1 1 74446 1.34326E-5 37223 0 4.26058E-6
19-49967497-G-A p.Gly436Gly synonymous ALDH16A1 1073 74442 0.0144139 37221 44 0.0287455
19-49967502-C-T p.Ala438Val missense ALDH16A1 1 73272 1.36478E-5 36636 0 3.18959E-5
19-49967503-G-A p.Ala438Ala synonymous ALDH16A1 3 73578 4.07731E-5 36789 0 3.19081E-5
19-49967518-T-C p.Tyr443Tyr splice_region+synonymous ALDH16A1 3 74848 4.00812E-5 37424 0 3.1902E-5
19-49967520-G-C p.Gly444Ala missense+splice_region ALDH16A1 1 74892 1.33526E-5 37446 0 7.45865E-5
19-49967523-C-T c.1331+3C>T splice_region ALDH16A1 1 74770 1.33743E-5 37385 0 4.67281E-5
19-49967680-G-A p.Gln446Gln synonymous ALDH16A1 31516 81124 0.388492 40562 6432 0.494375
19-49967686-C-T p.Gly448Gly synonymous ALDH16A1 2 82076 2.43677E-5 41038 0 3.18654E-5
19-49967690-G-C p.Val450Leu missense ALDH16A1 5 82158 6.08583E-5 41079 0 6.37389E-5
19-49967694-G-A p.Trp451* stop_gained ALDH16A1 4 82200 4.86618E-5 41100 0 3.18613E-5
19-49967701-C-T p.Asn453Asn synonymous ALDH16A1 1 82248 1.21584E-5 41124 0 4.66211E-5
19-49967702-G-A p.Ala454Thr missense ALDH16A1 14 82240 1.70233E-4 41120 0 6.3743E-5
19-49967704-C-G p.Ala454Ala synonymous ALDH16A1 1 82284 1.2153E-5 41142 0 NA
19-49967707-C-T p.His455His synonymous ALDH16A1 244 82308 0.00296447 41154 1 0.00665944
19-49967713-CAG-C p.Asp459fs frameshift ALDH16A1 2 82364 2.42825E-5 41182 0 NA
19-49967718-A-T p.Asp459Val missense ALDH16A1 379 82360 0.00460175 41180 0 0.00458861
19-49967721-C-T p.Pro460Leu missense ALDH16A1 2 82394 2.42736E-5 41197 0 NA
19-49967725-G-C p.Ser461Ser synonymous ALDH16A1 1 82360 1.21418E-5 41180 0 NA
19-49967725-G-A p.Ser461Ser synonymous ALDH16A1 2 82360 2.42836E-5 41180 0 6.37592E-5
19-49967735-GGCGGCT-G p.Gly466_Cys467del conservative_inframe_deletion ALDH16A1 1 82428 1.21318E-5 41214 0 NA
19-49967747-G-A p.Glu469Lys missense ALDH16A1 2 82506 2.42407E-5 41253 1 3.18796E-5
19-49967757-G-A p.Cys472Tyr missense ALDH16A1 2 82488 2.4246E-5 41244 0 4.00622E-6
19-49967767-C-T p.His475His synonymous ALDH16A1 3 82492 3.63672E-5 41246 0 1.64084E-4
19-49967778-A-G p.Asp479Gly missense+splice_region ALDH16A1 36 82464 4.36554E-4 41232 0 8.93541E-4
19-49967779-C-T p.Asp479Asp splice_region+synonymous ALDH16A1 19 82468 2.30392E-4 41234 0 0.0020141
19-49967779-CGTGAGTACATCCCCTCCCCGTCACCAGCCCCCCCGCCGCCCCATGCCCTTGACACTCGCATCCGGCCTCGCGTGCCCCTTGCATCCTCTTGACACCGTCCCTCTCACAG-C c.1437+1_1438-1del splice_acceptor ALDH16A1 7 82466 8.48835E-5 41233 2 NA
19-49967780-G-A c.1437+1G>A splice_donor ALDH16A1 1 82472 1.21253E-5 41236 0 3.18878E-5
19-49967784-G-A c.1437+5G>A splice_region ALDH16A1 1 82474 1.2125E-5 41237 0 7.59558E-5
19-49967886-CAG-C c.1438-2_1438-1delAG splice_acceptor ALDH16A1 1 83128 1.20296E-5 41564 0 8.2409E-6
19-49967891-G-T p.Gly480Gly splice_region+synonymous ALDH16A1 3 83162 3.60742E-5 41581 0 NA
19-49967907-C-T p.Arg486Trp missense ALDH16A1 5 83152 6.01308E-5 41576 0 3.18735E-4
19-49967908-G-T p.Arg486Leu missense ALDH16A1 2 83146 2.40541E-5 41573 0 7.95399E-6
19-49967908-G-A p.Arg486Gln missense ALDH16A1 4 83146 4.81081E-5 41573 0 3.18857E-5
19-49967912-C-T p.Pro487Pro synonymous ALDH16A1 16 83156 1.92409E-4 41578 0 6.25E-4
19-49967913-T-A p.Ser488Thr missense ALDH16A1 138 83148 0.00165969 41574 1 0.00267823
19-49967917-G-A p.Gly489Glu missense ALDH16A1 1 83148 1.20267E-5 41574 0 3.9769E-6
19-49967926-C-G p.Ala492Gly missense ALDH16A1 1 83118 1.20311E-5 41559 0 1.19303E-5
19-49967928-C-T p.Arg493Trp missense ALDH16A1 36 83114 4.3314E-4 41557 0 4.45888E-4
19-49967929-G-A p.Arg493Gln missense ALDH16A1 9 83104 1.08298E-4 41552 0 2.80121E-4
19-49967929-G-T p.Arg493Leu missense ALDH16A1 1 83104 1.20331E-5 41552 0 6.37349E-5
19-49967930-G-T p.Arg493Arg synonymous ALDH16A1 1 83096 1.20343E-5 41548 0 3.18613E-5
19-49967935-C-T p.Ser495Phe missense ALDH16A1 4 83114 4.81267E-5 41557 0 1.64772E-5
19-49967951-C-A p.Asn500Lys missense ALDH16A1 1 83086 1.20357E-5 41543 0 3.97655E-6
19-49967958-T-C p.Tyr503His missense ALDH16A1 1 83050 1.20409E-5 41525 0 3.18654E-5
19-49967963-CA-C p.Thr505fs frameshift ALDH16A1 1 83038 1.20427E-5 41519 0 3.97665E-6
19-49967975-C-T p.Leu508Leu synonymous ALDH16A1 1 82982 1.20508E-5 41491 0 1.64777E-5
19-49967976-G-A p.Ala509Thr missense ALDH16A1 6 82954 7.23292E-5 41477 0 1.034E-4
19-49967980-T-C p.Val510Ala missense ALDH16A1 2 82910 2.41225E-5 41455 0 2.47174E-5
19-49967981-T-G p.Val510Val synonymous ALDH16A1 25703 82320 0.312233 41160 4171 0.340886
19-49967990-C-G p.Thr513Thr synonymous ALDH16A1 2 82864 2.41359E-5 41432 0 NA
19-49967995-C-T p.Pro515Leu missense ALDH16A1 1 82744 1.20855E-5 41372 0 5.96882E-5
19-49967996-G-A p.Pro515Pro synonymous ALDH16A1 1226 82676 0.014829 41338 50 0.0308158
19-49968000-G-A p.Gly517Arg missense ALDH16A1 1 82602 1.21062E-5 41301 0 4.09947E-4
19-49968002-G-A p.Gly517Gly synonymous ALDH16A1 57 82604 6.90039E-4 41302 0 0.00187735
19-49968014-G-A p.Gly521Gly synonymous ALDH16A1 1 82496 1.21218E-5 41248 0 9.55657E-5
19-49968018-A-G p.Ser523Gly missense+splice_region ALDH16A1 1 82424 1.21324E-5 41212 0 3.18573E-5
19-49968019-G-GCCCA c.1568_1568+1insCCCA splice_donor ALDH16A1 1 82474 1.2125E-5 41237 0 NA
19-49968020-G-GCACCCCCCTA c.1568+1_1568+2insCACCCCCCTA splice_donor ALDH16A1 1 82468 1.21259E-5 41234 0 NA
19-49968022-G-A c.1568+3G>A splice_region ALDH16A1 1 82464 1.21265E-5 41232 0 8.26925E-6
19-49968989-CT-C c.1569-5delT splice_region ALDH16A1 4 82308 4.8598E-5 41154 0 NA
19-49968999-G-A p.Ala525Thr missense ALDH16A1 3 82386 3.6414E-5 41193 0 NA
19-49969001-A-G p.Ala525Ala synonymous ALDH16A1 1 82320 1.21477E-5 41160 0 3.39322E-5
19-49969002-C-A p.Pro526Thr missense ALDH16A1 1 82436 1.21306E-5 41218 0 NA
19-49969005-C-T p.Pro527Ser missense ALDH16A1 1 82436 1.21306E-5 41218 0 8.44666E-6
19-49969006-C-G p.Pro527Arg missense ALDH16A1 90 82424 0.00109191 41212 0 0.00261296
19-49969007-CT-C p.Tyr528fs frameshift ALDH16A1 1 82408 1.21347E-5 41204 0 1.99995E-5
19-49969009-A-T p.Tyr528Phe missense ALDH16A1 4 82418 4.85331E-5 41209 0 1.68404E-5
19-49969018-T-G p.Phe531Cys missense ALDH16A1 2 82414 2.42677E-5 41207 0 NA
19-49969020-G-A p.Val532Ile missense ALDH16A1 130 82410 0.00157748 41205 1 0.00255387
19-49969023-G-A p.Gly533Arg missense ALDH16A1 2 82484 2.42471E-5 41242 0 NA
19-49969024-G-A p.Gly533Glu missense ALDH16A1 1 82492 1.21224E-5 41246 0 NA
19-49969030-G-A p.Arg535His missense ALDH16A1 10 82518 1.21186E-4 41259 0 3.3315E-5
19-49969036-A-G n.1758-2A>G splice_acceptor ALDH16A1 1 82532 1.21165E-5 41266 0 8.32044E-6
19-49969050-C-T p.Arg542* stop_gained ALDH16A1 1 82522 1.2118E-5 41261 0 5.04032E-4
19-49969051-G-A p.Arg542Gln missense ALDH16A1 3 82538 3.63469E-5 41269 0 6.37267E-5
19-49969057-C-T p.Ser544Phe missense ALDH16A1 2 82588 2.42166E-5 41294 0 NA
19-49969060-G-C p.Arg545Thr missense ALDH16A1 2 82594 2.42148E-5 41297 0 3.18674E-5
19-49969068-C-T p.Arg548Trp missense ALDH16A1 12 82618 1.45247E-4 41309 0 0.0025
19-49969069-G-A p.Arg548Gln missense ALDH16A1 3 82614 3.63135E-5 41307 0 0.00100806
19-49969075-C-T p.Ser550Leu missense ALDH16A1 1 82644 1.21001E-5 41322 0 2.23058E-4
19-49969076-G-C p.Ser550Ser synonymous ALDH16A1 2 82646 2.41996E-5 41323 0 4.37989E-5
19-49969076-G-A p.Ser550Ser synonymous ALDH16A1 10 82646 1.20998E-4 41323 0 9.12545E-5
19-49969085-C-T p.Asn553Asn synonymous ALDH16A1 25830 82260 0.314004 41130 4240 0.336858
19-49969088-C-G p.Leu554Leu synonymous ALDH16A1 1 82684 1.20942E-5 41342 0 NA
19-49969091-T-G p.His555Gln missense ALDH16A1 1 82670 1.20963E-5 41335 0 8.33834E-6
19-49969097-C-T p.Tyr557Tyr synonymous ALDH16A1 1 82644 1.21001E-5 41322 0 2.78898E-5
19-49969098-G-A p.Val558Met missense ALDH16A1 2 82654 2.41973E-5 41327 0 3.34152E-5
19-49969110-G-A p.Gly562Arg missense ALDH16A1 1 82670 1.20963E-5 41335 0 3.18715E-5
19-49969114-C-A p.Ala563Asp missense ALDH16A1 1 82676 1.20954E-5 41338 0 NA
19-49969126-G-A p.Arg116Gln missense+splice_region ALDH16A1 1 82658 1.2098E-5 41329 0 2.54001E-5
19-49969126-G-C p.Arg116Pro missense+splice_region ALDH16A1 1 82658 1.2098E-5 41329 0 1.69334E-5
19-49969139-G-C p.Glu571Asp missense ALDH16A1 33 82584 3.99593E-4 41292 0 9.5645E-5
19-49969142-C-G p.Ala572Ala synonymous ALDH16A1 2 82522 2.4236E-5 41261 0 NA
19-49969143-G-A p.Ala573Thr missense ALDH16A1 4 82484 4.84943E-5 41242 0 5.03525E-4
19-49969165-A-C c.1736+3A>C splice_region ALDH16A1 2 82238 2.43197E-5 41119 0 8.09009E-6
19-49969168-G-A c.1736+6G>A splice_region ALDH16A1 486 82216 0.00591126 41108 11 0.010934
19-49969336-C-T c.1737-3C>T splice_region ALDH16A1 1 73658 1.35763E-5 36829 0 6.98139E-6
19-49969344-C-T p.Ala581Val missense ALDH16A1 1 72700 1.37552E-5 36350 0 2.0E-4
19-49969345-G-A p.Arg119Gln missense ALDH16A1 3 72834 4.11896E-5 36417 0 6.60764E-5
19-49969356-C-T p.Gln123* stop_gained ALDH16A1 5 72388 6.90722E-5 36194 0 1.59439E-4
19-49969359-G-A p.Gly586Glu missense ALDH16A1 5 72220 6.92329E-5 36110 0 6.39059E-5
19-49969365-G-A p.Arg588Gln missense ALDH16A1 1 71688 1.39493E-5 35844 0 1.32996E-5
19-49969378-G-A p.Cys130Tyr missense ALDH16A1 3 71464 4.19792E-5 35732 0 NA
19-49969382-G-C p.Ala594Pro missense ALDH16A1 5 71202 7.02227E-5 35601 0 0.00174657
19-49969390-G-A p.Arg134Gln missense ALDH16A1 78 70826 0.00110129 35413 0 0.00338075
19-49969393-T-C p.Leu135Pro missense ALDH16A1 1 70944 1.40956E-5 35472 0 6.23729E-6
19-49969397-C-T p.Leu599Leu synonymous ALDH16A1 3 70900 4.23131E-5 35450 0 1.1815E-4
19-49969403-C-T p.Arg601Cys missense ALDH16A1 12 70344 1.7059E-4 35172 0 0.0027448
19-49969404-G-A p.Arg601His missense ALDH16A1 1 70126 1.426E-5 35063 0 5.55432E-5
19-49969407-G-A p.Arg602Gln missense ALDH16A1 12 70486 1.70247E-4 35243 0 1.09661E-4
19-49969425-C-G p.Ser608Trp missense ALDH16A1 1 69508 1.43868E-5 34754 0 6.03187E-6
19-49969425-C-A p.Ser608* stop_gained ALDH16A1 1 69508 1.43868E-5 34754 0 NA
19-49969425-C-T p.Arg146* stop_gained ALDH16A1 1 69508 1.43868E-5 34754 0 0.00154004
19-49969426-G-C p.Arg146Pro missense ALDH16A1 1 69668 1.43538E-5 34834 0 NA
19-49969441-G-A p.Arg151Lys missense ALDH16A1 1 68956 1.4502E-5 34478 0 NA
19-49969447-G-A p.Arg153Gln missense ALDH16A1 3 67894 4.41865E-5 33947 0 3.18837E-5
19-49969459-T-TGCGGAG p.Ala622_Glu623dup disruptive_inframe_insertion ALDH16A1 1 67576 1.47982E-5 33788 0 6.83742E-6
19-49969461-C-T p.Ala620Val missense ALDH16A1 42 67070 6.26211E-4 33535 0 0.00125156
19-49969462-G-A p.Arg158Gln missense ALDH16A1 8 67200 1.19048E-4 33600 0 2.68673E-4
19-49969467-C-T p.Ala622Val missense ALDH16A1 3 66224 4.53008E-5 33112 0 NA
19-49969468-G-A p.Arg160Gln missense ALDH16A1 160 66256 0.00241488 33128 5 0.0116405
19-49969471-G-C p.Glu623Asp missense ALDH16A1 1 65856 1.51846E-5 32928 0 NA
19-49969484-G-A p.Ala628Thr missense ALDH16A1 2 64026 3.12373E-5 32013 0 3.25712E-5
19-49969491-G-A p.Arg630Gln missense ALDH16A1 2 62528 3.19857E-5 31264 0 9.12076E-5
19-49969496-C-T p.Arg632Trp missense ALDH16A1 1 61194 1.63415E-5 30597 0 1.86105E-5
19-49969501-G-A p.Ala633Ala synonymous ALDH16A1 778 59398 0.0130981 29699 22 0.03926
19-49969503-G-C p.Trp634Ser missense ALDH16A1 1 59220 1.68862E-5 29610 0 NA
19-49969504-G-A p.Trp634* stop_gained ALDH16A1 2 59110 3.38352E-5 29555 0 NA
19-49969507-G-T p.Gly635Gly synonymous ALDH16A1 1 58222 1.71756E-5 29111 0 3.19823E-5
19-49969512-G-A p.Arg637Gln missense ALDH16A1 2 56964 3.51099E-5 28482 0 1.42917E-4
19-49969516-G-A p.Val638Val synonymous ALDH16A1 1 55826 1.79128E-5 27913 0 NA
19-49969522-C-T p.Ala640Ala synonymous ALDH16A1 277 54594 0.00507382 27297 4 0.0176826
19-49971630-C-T c.1939-8C>T splice_region ALDH16A1 216 81322 0.00265611 40661 0 0.00661469
19-49971646-G-A p.Gly649Gly synonymous ALDH16A1 2 81636 2.4499E-5 40818 0 4.18564E-6
19-49971657-C-CTGTGCTGCGCCTGCGGGAGCCGCTGGG p.Arg656_Leu664dup conservative_inframe_insertion ALDH16A1 5 81958 6.10069E-5 40979 0 1.17051E-4
19-49971666-G-A p.Arg656His missense ALDH16A1 2 81962 2.44016E-5 40981 0 3.19673E-5
19-49971670-G-A p.Leu657Leu synonymous ALDH16A1 1 82094 1.21812E-5 41047 0 1.24752E-5
19-49971671-C-T p.Arg658Trp missense ALDH16A1 3 82098 3.65417E-5 41049 0 5.00818E-5
19-49971677-C-A p.Pro660Thr missense ALDH16A1 1 82186 1.21675E-5 41093 0 8.33528E-6
19-49971679-G-A p.Pro660Pro synonymous ALDH16A1 2 82292 2.43037E-5 41146 0 3.333E-5
19-49971689-C-T p.Leu664Leu synonymous ALDH16A1 1 82462 1.21268E-5 41231 0 8.31573E-6
19-49971693-C-T p.Ala665Val missense ALDH16A1 1 82560 1.21124E-5 41280 0 NA
19-49971704-C-T p.Pro669Ser missense ALDH16A1 1 82650 1.20992E-5 41325 0 NA
19-49971705-C-T p.Pro669Leu missense ALDH16A1 2 82680 2.41896E-5 41340 0 3.19693E-5
19-49971706-G-A p.Pro669Pro synonymous ALDH16A1 1 82684 1.20942E-5 41342 0 3.19468E-5
19-49971710-G-A p.Glu671Lys missense ALDH16A1 4 82728 4.83512E-5 41364 0 3.1953E-5
19-49971714-G-C p.Trp672Ser missense ALDH16A1 1 82782 1.20799E-5 41391 0 NA
19-49971714-G-GTGCTGGGT p.Trp672fs frameshift ALDH16A1 1 82782 1.20799E-5 41391 0 NA
19-49971715-GCCCC-G p.Pro673fs frameshift ALDH16A1 1 82762 1.20828E-5 41381 0 NA
19-49971728-T-C p.Phe677Leu missense ALDH16A1 1 82858 1.20688E-5 41429 0 NA
19-49971730-C-T p.Phe677Phe synonymous ALDH16A1 15 82874 1.80998E-4 41437 0 6.53779E-4
19-49971730-C-G p.Phe677Leu missense ALDH16A1 3 82876 3.61987E-5 41438 0 8.27568E-6
19-49971737-C-T p.Leu680Leu synonymous ALDH16A1 6 82910 7.23676E-5 41455 0 3.28367E-5
19-49971743-G-A p.Ala682Thr missense ALDH16A1 2 82862 2.41365E-5 41431 0 NA
19-49971748-C-T p.Pro683Pro synonymous ALDH16A1 1 82864 1.2068E-5 41432 0 3.30666E-5
19-49971749-G-A p.Ala684Thr missense ALDH16A1 1 82804 1.20767E-5 41402 0 8.26665E-6
19-49971757-C-T p.Ala686Ala synonymous ALDH16A1 2 82780 2.41604E-5 41390 0 3.19224E-5
19-49971759-A-G p.Tyr687Cys missense ALDH16A1 1 82776 1.20808E-5 41388 0 5.78512E-5
19-49971761-G-A p.Gly688Ser missense ALDH16A1 5 82760 6.04157E-5 41380 0 5.32259E-5
19-49971777-T-C p.Met693Thr missense ALDH16A1 1 82726 1.20881E-5 41363 0 2.45445E-5
19-49971779-G-A p.Val694Met missense ALDH16A1 1 82696 1.20925E-5 41348 0 3.19244E-5
19-49971790-G-A p.Ala697Ala synonymous ALDH16A1 2 82612 2.42096E-5 41306 0 1.63846E-5
19-49971797-C-T p.Pro700Ser missense ALDH16A1 1 82528 1.21171E-5 41264 0 NA
19-49971815-G-T p.Val706Phe missense ALDH16A1 1 82148 1.21732E-5 41074 0 4.96763E-5
19-49971816-T-C p.Val706Ala missense ALDH16A1 111 82084 0.00135227 41042 0 8.02278E-4
19-49971827-T-C c.2124+4T>C splice_region ALDH16A1 1 81890 1.22115E-5 40945 0 NA
19-49971830-C-A c.2124+7C>A splice_region ALDH16A1 1 81738 1.22342E-5 40869 0 8.30717E-6
19-49972115-C-A c.2125-6C>A splice_region ALDH16A1 1 82886 1.20648E-5 41443 0 NA
19-49972118-TA-T c.2125-2delA splice_acceptor ALDH16A1 1 82890 1.20642E-5 41445 0 NA
19-49972122-A-T p.Asp709Val missense+splice_region ALDH16A1 1 82942 1.20566E-5 41471 0 8.26897E-6
19-49972125-T-C p.Met710Thr missense ALDH16A1 1 82986 1.20502E-5 41493 0 3.18776E-5
19-49972128-C-T p.Ala711Val missense ALDH16A1 1 83016 1.20459E-5 41508 0 NA
19-49972133-G-A p.Val713Met missense ALDH16A1 2 83032 2.40871E-5 41516 0 1.65074E-5
19-49972146-G-A p.Gly717Asp missense ALDH16A1 1 83094 1.20346E-5 41547 0 NA
19-49972157-G-A p.Val721Met missense ALDH16A1 3 83116 3.60941E-5 41558 0 9.54889E-5
19-49972160-G-A p.Val722Met missense ALDH16A1 4 83138 4.81128E-5 41569 0 1.40128E-4
19-49972172-C-T p.Arg726Trp missense ALDH16A1 43 83150 5.17138E-4 41575 1 0.00114701
19-49972173-G-A p.Arg726Gln missense ALDH16A1 1 83152 1.20262E-5 41576 0 2.47251E-5
19-49972175-G-T p.Asp727Tyr missense ALDH16A1 1 83180 1.20221E-5 41590 0 NA
19-49972183-G-T p.Leu729Leu synonymous ALDH16A1 1 83176 1.20227E-5 41588 0 NA
19-49972198-C-G p.Ala734Ala synonymous ALDH16A1 1 83198 1.20195E-5 41599 0 8.24511E-6
19-49972203-A-C p.His736Pro missense ALDH16A1 1 83196 1.20198E-5 41598 0 NA
19-49972206-A-G p.Gln737Arg missense ALDH16A1 1 83214 1.20172E-5 41607 0 NA
19-49972211-G-A p.Val739Ile missense ALDH16A1 2 83208 2.40361E-5 41604 0 1.6503E-5
19-49972213-C-T p.Val739Val synonymous ALDH16A1 2 83212 2.4035E-5 41606 0 3.98226E-6
19-49972231-C-T p.Phe745Phe synonymous ALDH16A1 1 83206 1.20184E-5 41603 0 8.28569E-6
19-49972232-G-A p.Gly746Arg missense ALDH16A1 1 83206 1.20184E-5 41603 0 1.6573E-5
19-49972243-G-A p.Gln749Gln splice_region+synonymous ALDH16A1 1 83172 1.20233E-5 41586 0 3.18492E-5
19-49973563-G-T p.Gly750Cys missense+splice_region ALDH16A1 2 82880 2.41313E-5 41440 0 1.66135E-5
19-49973571-G-GTT p.Val754fs frameshift ALDH16A1 1 82876 1.20662E-5 41438 0 NA
19-49973571-G-C p.Gln752His missense ALDH16A1 1 82876 1.20662E-5 41438 0 NA
19-49973577-C-T p.Val754Val synonymous ALDH16A1 5 82842 6.03559E-5 41421 0 1.66248E-5
19-49973578-G-A p.Glu755Lys missense ALDH16A1 21 82848 2.53476E-4 41424 0 7.01128E-4
19-49973585-C-T p.Ala757Val missense ALDH16A1 1 82816 1.2075E-5 41408 0 4.1596E-5
19-49973588-C-T p.Ser758Leu missense ALDH16A1 1 82790 1.20788E-5 41395 0 8.32362E-6
19-49973589-G-A p.Ser758Ser synonymous ALDH16A1 1 82796 1.20779E-5 41398 0 6.37674E-5
19-49973608-G-T p.Val765Leu missense ALDH16A1 1 82540 1.21153E-5 41270 0 NA
19-49973609-T-C p.Val765Ala missense ALDH16A1 1 82474 1.2125E-5 41237 0 4.01868E-6
19-49973614-G-A p.Ala767Thr missense ALDH16A1 1 82428 1.21318E-5 41214 0 1.67572E-5
19-49973615-C-T p.Ala767Val missense ALDH16A1 3 82370 3.6421E-5 41185 0 5.03525E-4
19-49973619-C-T p.Ser768Ser synonymous ALDH16A1 1 82338 1.21451E-5 41169 0 3.18878E-5
19-49973621-G-A p.Arg769Lys missense ALDH16A1 3 82366 3.64228E-5 41183 0 3.36508E-5
19-49973625-C-CT p.Cys771fs frameshift ALDH16A1 1 82274 1.21545E-5 41137 0 NA
19-49973631-G-A p.Pro772Pro synonymous ALDH16A1 2 82146 2.43469E-5 41073 0 3.37941E-5
19-49973632-C-T p.Arg773Trp missense ALDH16A1 12 82124 1.4612E-4 41062 0 9.56694E-5
19-49973632-C-A p.Arg773Arg synonymous ALDH16A1 2 82128 2.43522E-5 41064 0 1.69033E-5
19-49973633-G-A p.Arg773Gln missense ALDH16A1 1 82134 1.21752E-5 41067 0 3.37958E-5
19-49973633-G-T p.Arg773Leu missense ALDH16A1 2 82134 2.43505E-5 41067 0 2.53468E-5
19-49973638-TG-T p.Asp776fs frameshift ALDH16A1 2 82056 2.43736E-5 41028 0 1.21292E-5
19-49973650-G-T p.Ala779Ser missense ALDH16A1 1 81882 1.22127E-5 40941 0 NA
19-49973653-G-A p.Glu780Lys missense ALDH16A1 1 81816 1.22225E-5 40908 0 3.18878E-5
19-49973680-C-T p.Arg789* stop_gained ALDH16A1 3 81360 3.68732E-5 40680 0 9.2675E-6
19-49973681-G-A p.Arg789Gln missense ALDH16A1 9 81402 1.10562E-4 40701 0 5.43642E-5
19-49973687-C-T p.Ala791Val missense ALDH16A1 1 81178 1.23186E-5 40589 0 3.80836E-5
19-49973688-G-A p.Ala791Ala synonymous ALDH16A1 5 81142 6.16204E-5 40571 0 6.391E-5
19-49973689-C-T p.Arg792Trp missense ALDH16A1 3 81052 3.70133E-5 40526 0 0.00100806
19-49973689-C-G p.Arg792Gly missense ALDH16A1 2 81052 2.46755E-5 40526 0 3.19693E-5
19-49973690-G-A p.Arg792Gln missense ALDH16A1 3 81092 3.6995E-5 40546 0 1.69037E-5
19-49973695-A-G p.Lys794Glu missense ALDH16A1 3 80872 3.70957E-5 40436 0 1.00319E-5
19-49973711-C-G p.Pro799Arg missense ALDH16A1 1 79616 1.25603E-5 39808 0 2.41068E-5
19-49973713-A-G p.Met800Val missense ALDH16A1 1 79350 1.26024E-5 39675 0 NA
19-49973714-T-C p.Met800Thr missense ALDH16A1 1 79262 1.26164E-5 39631 0 NA
19-49973841-A-G c.*117A>G splice_region ALDH16A1 3 43556 6.88768E-5 21778 0 3.86947E-4