Variant

Variant ID Consequence Effect Gene AC AN AF NS NHOM maxEAF
3-105085859-C-T c.-394C>T 5_prime_UTR_premature_start_codon_gain ALCAM 1 2422 4.12882E-4 1211 0 0.00140244
3-105085896-A-G c.-357A>G 5_prime_UTR_premature_start_codon_gain ALCAM 5 3812 0.00131165 1906 0 0.00857453
3-105086063-T-C c.-190T>C 5_prime_UTR_premature_start_codon_gain ALCAM 1 58118 1.72064E-5 29059 0 6.40082E-5
3-105086132-C-T c.-121C>T 5_prime_UTR_premature_start_codon_gain ALCAM 2 75166 2.66078E-5 37583 0 NA
3-105086164-C-T c.-89C>T 5_prime_UTR_premature_start_codon_gain ALCAM 5 78266 6.38847E-5 39133 0 1.27608E-4
3-105086214-G-T c.-39G>T 5_prime_UTR_premature_start_codon_gain ALCAM 35 80324 4.35735E-4 40162 0 0.00169016
3-105086222-C-T c.-31C>T 5_prime_UTR_premature_start_codon_gain ALCAM 1 80592 1.24082E-5 40296 0 3.18979E-5
3-105086248-G-T c.-5G>T 5_prime_UTR_premature_start_codon_gain ALCAM 2 80948 2.47072E-5 40474 0 2.49992E-5
3-105086268-G-T p.Ala6Ser missense ALCAM 10 80638 1.24011E-4 40319 0 0.0025
3-105086283-C-G p.Leu11Val missense ALCAM 1 80474 1.24264E-5 40237 0 2.48649E-5
3-105086292-T-C p.Cys14Arg missense ALCAM 1 80356 1.24446E-5 40178 0 NA
3-105086308-C-T p.Ala19Val missense ALCAM 1 80000 1.25E-5 40000 0 2.48897E-5
3-105086312-C-A p.Thr20Thr synonymous ALCAM 2 79958 2.50131E-5 39979 0 9.55718E-5
3-105086318-C-T p.Phe22Phe synonymous ALCAM 1 79812 1.25294E-5 39906 0 NA
3-105086324-A-G p.Pro24Pro splice_region+synonymous ALCAM 1 79728 1.25426E-5 39864 0 NA
3-105086326-G-GCCTTGGATGGTATACTGTAAATTCAGCATATGGAGATACCATTATCA c.73+1_73+2insCCTTGGATGGTATACTGTAAATTCAGCATATGGAGATACCATTATCA splice_donor ALCAM 1 79702 1.25467E-5 39851 0 NA
3-105238903-C-A c.74-8C>A splice_region ALCAM 1 82430 1.21315E-5 41215 0 4.56404E-6
3-105238923-A-G p.Tyr29Cys missense ALCAM 1 83208 1.20181E-5 41604 0 3.99914E-6
3-105238927-T-C p.Thr30Thr synonymous ALCAM 1 83268 1.20094E-5 41634 0 NA
3-105238932-A-G p.Asn32Ser missense ALCAM 2 83286 2.40136E-5 41643 0 2.47141E-5
3-105238939-A-T p.Ala34Ala synonymous ALCAM 1 83316 1.20025E-5 41658 0 3.97994E-6
3-105238951-C-A p.Thr38Thr synonymous ALCAM 21 83338 2.51986E-4 41669 0 7.03775E-4
3-105238957-C-T p.Ile40Ile synonymous ALCAM 1 83350 1.19976E-5 41675 0 3.1953E-5
3-105238962-C-T p.Pro42Leu missense ALCAM 3 83350 3.59928E-5 41675 0 3.19754E-5
3-105238968-G-A p.Arg44Gln missense ALCAM 3 83346 3.59945E-5 41673 0 4.77414E-5
3-105238972-T-G c.-19T>G 5_prime_UTR_premature_start_codon_gain ALCAM 2 83354 2.3994E-5 41677 0 3.97814E-6
3-105238976-G-A p.Val47Ile missense ALCAM 2 83338 2.39987E-5 41669 0 3.29511E-5
3-105238990-C-T p.Leu51Leu synonymous ALCAM 1 83340 1.1999E-5 41670 0 NA
3-105238998-G-C p.Gly54Ala missense ALCAM 1 83326 1.20011E-5 41663 0 NA
3-105239011-T-TGAAAAGCCCGATGGCTCCCCA c.174_174+1insGAAAAGCCCGATGGCTCCCCA splice_donor ALCAM 2 83268 2.40188E-5 41634 1 NA
3-105239012-G-GAAAAGCCCGATGGCTCCCCAGTATTTAT c.174+1_174+2insAAAAGCCCGATGGCTCCCCAGTATTTAT splice_donor ALCAM 2 83256 2.40223E-5 41628 1 NA
3-105243137-A-C p.Lys60Thr missense ALCAM 1 83158 1.20253E-5 41579 0 4.0171E-6
3-105243141-C-T p.Pro61Pro synonymous ALCAM 4 83196 4.80792E-5 41598 0 3.99926E-5
3-105243142-G-A p.Asp62Asn missense ALCAM 3 83202 3.60568E-5 41601 0 1.19808E-5
3-105243160-A-G p.Ile68Val missense ALCAM 2 83278 2.40159E-5 41639 0 1.59179E-5
3-105243181-A-G p.Lys75Glu missense ALCAM 1 83310 1.20034E-5 41655 0 NA
3-105243185-A-G p.Lys76Arg missense ALCAM 1 83312 1.20031E-5 41656 0 8.24933E-6
3-105243194-A-T p.Gln79Leu missense ALCAM 1 83312 1.20031E-5 41656 0 NA
3-105243198-C-T p.Tyr80Tyr synonymous ALCAM 2 83316 2.4005E-5 41658 0 3.18512E-5
3-105243201-C-T p.Asp81Asp synonymous ALCAM 77 83316 9.24192E-4 41658 0 0.0026118
3-105243204-T-C p.Asp82Asp synonymous ALCAM 196 83324 0.00235226 41662 0 0.00173795
3-105243207-A-G p.Val83Val synonymous ALCAM 1 83326 1.20011E-5 41663 0 NA
3-105243209-C-T p.Pro84Leu missense ALCAM 162 83326 0.00194417 41663 2 0.00417543
3-105243211-G-A p.Glu85Lys missense ALCAM 2 83326 2.40021E-5 41663 0 1.59074E-5
3-105243219-A-T p.Lys87Asn missense ALCAM 2 83324 2.40027E-5 41662 0 NA
3-105243227-T-C p.Leu90Ser missense ALCAM 20 83322 2.40033E-4 41661 0 0.00100705
3-105243230-A-G p.Asn91Ser missense ALCAM 5 83330 6.00024E-5 41665 0 2.22887E-4
3-105243238-G-A p.Glu94Lys missense ALCAM 1 83324 1.20013E-5 41662 0 1.19301E-5
3-105243256-A-G p.Ile100Val missense ALCAM 3 83322 3.60049E-5 41661 0 6.58979E-5
3-105243260-G-T p.Ser101Ile missense ALCAM 1 83320 1.20019E-5 41660 0 NA
3-105243275-G-C p.Ser106Thr missense ALCAM 1 83320 1.20019E-5 41660 0 NA
3-105243306-A-T p.Val116Val synonymous ALCAM 2 83314 2.40056E-5 41657 0 1.19308E-5
3-105243318-C-T p.Asn120Asn synonymous ALCAM 3 83292 3.60179E-5 41646 0 4.37484E-5
3-105243319-G-A p.Val121Met missense ALCAM 2 83286 2.40136E-5 41643 0 1.6475E-5
3-105243322-T-C p.Phe122Leu missense ALCAM 51 83282 6.12377E-4 41641 0 0.0020141
3-105243341-T-C p.Val128Ala missense ALCAM 1 83220 1.20163E-5 41610 0 8.24715E-6
3-105250847-G-A p.Lys132Lys splice_region+synonymous ALCAM 2 82358 2.42842E-5 41179 0 3.98616E-6
3-105250855-C-A p.Ser135Tyr missense ALCAM 1 82372 1.214E-5 41186 0 NA
3-105250869-G-A p.Val140Ile missense ALCAM 4 82318 4.8592E-5 41159 0 3.1839E-5
3-105250873-G-A p.Ser141Asn missense ALCAM 2 82304 2.43002E-5 41152 0 3.98613E-6
3-105250884-T-G p.Phe145Val missense ALCAM 1 82252 1.21578E-5 41126 0 6.3674E-5
3-105250889-C-T p.Leu146Leu synonymous ALCAM 2 82168 2.43404E-5 41084 0 8.24933E-6
3-105250890-G-A p.Glu147Lys missense ALCAM 5 82174 6.08465E-5 41087 0 3.98788E-6
3-105250899-C-A p.Gln150Lys missense ALCAM 2 82058 2.4373E-5 41029 0 4.1263E-5
3-105250904-A-G p.Leu151Leu synonymous ALCAM 2 81994 2.4392E-5 40997 0 3.18573E-5
3-105250914-A-C c.459+4A>C splice_region ALCAM 15 81808 1.83356E-4 40904 0 9.55353E-5
3-105250917-A-AT c.459+7_459+8insT splice_region ALCAM 1 81736 1.22345E-5 40868 0 NA
3-105252449-G-C p.Leu1? start_lost ALCAM 1 82852 1.20697E-5 41426 0 NA
3-105252455-C-G p.Asp156Glu missense ALCAM 1 82886 1.20648E-5 41443 0 9.55901E-5
3-105252464-A-G p.Ser159Ser synonymous ALCAM 1 82956 1.20546E-5 41478 0 3.18613E-5
3-105252470-CA-C p.Ser162fs frameshift ALCAM 1 82996 1.20488E-5 41498 0 NA
3-105252481-A-T p.Asp165Val missense ALCAM 5 83054 6.02018E-5 41527 0 9.55718E-5
3-105252498-T-A p.Tyr171Asn missense ALCAM 1 83080 1.20366E-5 41540 0 NA
3-105252539-G-A c.547+5G>A splice_region ALCAM 1 82990 1.20496E-5 41495 0 NA
3-105253503-T-C c.548-4T>C splice_region ALCAM 1 83118 1.20311E-5 41559 0 6.37146E-5
3-105253507-C-T p.Ala183Val missense+splice_region ALCAM 4 83132 4.81162E-5 41566 0 7.5652E-5
3-105253508-G-A p.Ala183Ala splice_region+synonymous ALCAM 2 83148 2.40535E-5 41574 0 3.30224E-5
3-105253508-G-T c.-25G>T 5_prime_UTR_premature_start_codon_gain ALCAM 1 83148 1.20267E-5 41574 0 2.47668E-5
3-105253516-T-G p.Ile186Arg missense ALCAM 1 83202 1.20189E-5 41601 0 6.25E-4
3-105253517-A-G p.Ile186Met missense ALCAM 1 83198 1.20195E-5 41599 0 NA
3-105253521-T-C p.Phe188Leu missense ALCAM 1 83220 1.20163E-5 41610 0 8.24837E-6
3-105253528-A-G p.Lys190Arg missense ALCAM 1 83228 1.20152E-5 41614 0 9.55536E-5
3-105253533-A-G p.Met1? start_lost ALCAM 3 83242 3.60395E-5 41621 0 2.47337E-5
3-105253534-T-G p.Met1? start_lost ALCAM 23 83252 2.7627E-4 41626 0 6.25E-4
3-105253536-G-T p.Asp193Tyr missense ALCAM 1 83252 1.20117E-5 41626 0 NA
3-105253539-C-T p.Pro194Ser missense ALCAM 1 83264 1.201E-5 41632 0 1.59186E-5
3-105253541-A-G p.Pro194Pro synonymous ALCAM 30 83270 3.60274E-4 41635 0 0.00117872
3-105253555-A-T p.Tyr199Phe missense ALCAM 1 83266 1.20097E-5 41633 0 NA
3-105253560-A-G p.Met201Val missense ALCAM 1 83266 1.20097E-5 41633 0 8.24198E-6
3-105253562-G-A p.Met201Ile missense ALCAM 1 83252 1.20117E-5 41626 0 3.97934E-6
3-105253574-G-C p.Leu205Leu synonymous ALCAM 5 83252 6.00586E-5 41626 0 5.57121E-5
3-105253594-C-G p.Ala212Gly missense ALCAM 1 83240 1.20135E-5 41620 0 3.97924E-6
3-105253601-A-G p.Ile214Met missense ALCAM 3 83242 3.60395E-5 41621 0 3.97991E-6
3-105253615-C-G p.Thr219Ser missense ALCAM 1 83210 1.20178E-5 41605 0 NA
3-105253621-C-T p.Ser221Leu missense ALCAM 3 83180 3.60664E-5 41590 0 1.19432E-5
3-105253622-G-A p.Ser221Ser synonymous ALCAM 1 83164 1.20244E-5 41582 0 6.37267E-5
3-105253631-T-C p.Tyr224Tyr synonymous ALCAM 130 83164 0.00156318 41582 1 0.00277052
3-105253636-G-C p.Gly226Ala missense ALCAM 1 83148 1.20267E-5 41574 0 NA
3-105253645-G-A p.Gly229Asp missense ALCAM 41 83102 4.9337E-4 41551 0 0.00375
3-105253669-A-G p.Gln237Arg missense ALCAM 1 82968 1.20528E-5 41484 0 NA
3-105253689-T-TATCCTACAGAGCAG c.730_730+1insATCCTACAGAGCAG splice_donor ALCAM 4 82706 4.83641E-5 41353 2 NA
3-105253689-T-TATCCTACAGAGCAGGTGACAATACAAGTGCTGCCACCAAAAAGTGCCATCAAAGAAGG c.730_730+1insATCCTACAGAGCAGGTGACAATACAAGTGCTGCCACCAAAAAGTGCCATCAAAGAAGG splice_donor ALCAM 2 82706 2.4182E-5 41353 1 NA
3-105258827-G-A p.Glu247Lys missense ALCAM 2 82874 2.4133E-5 41437 1 NA
3-105258829-G-A p.Glu247Glu synonymous ALCAM 2 82880 2.41313E-5 41440 0 8.27075E-6
3-105258833-G-A p.Val249Met missense ALCAM 1 82892 1.20639E-5 41446 0 4.13367E-5
3-105258842-C-A p.Gln252Lys missense ALCAM 1 82892 1.20639E-5 41446 0 NA
3-105258845-G-A p.Val253Met missense ALCAM 7 82908 8.44309E-5 41454 0 1.27518E-4
3-105258850-G-A p.Leu254Leu synonymous ALCAM 121 82902 0.00145955 41451 0 0.00303108
3-105258851-C-G p.Pro255Ala missense ALCAM 1 82896 1.20633E-5 41448 0 NA
3-105258855-C-CA p.Asn258fs frameshift ALCAM 1 82910 1.20613E-5 41455 0 NA
3-105258861-A-G p.Asn258Ser missense ALCAM 11621 82610 0.140673 41305 923 0.175
3-105258879-A-G p.Asp264Gly missense ALCAM 2 82946 2.41121E-5 41473 0 2.47517E-5
3-105258884-A-G p.Ile266Val missense ALCAM 3 82958 3.61629E-5 41479 0 8.24974E-6
3-105258887-A-T p.Thr267Ser missense ALCAM 2 82954 2.41097E-5 41477 0 6.37755E-5
3-105258912-A-G p.Asn275Ser missense ALCAM 1 82886 1.20648E-5 41443 0 NA
3-105258913-C-T p.Asn275Asn synonymous ALCAM 1 82892 1.20639E-5 41446 0 5.58436E-5
3-105258921-C-G p.Pro278Arg missense ALCAM 2 82878 2.41319E-5 41439 0 3.99112E-6
3-105258921-C-A p.Pro278Gln missense ALCAM 1 82878 1.20659E-5 41439 0 NA
3-105258925-G-A p.Glu279Glu synonymous ALCAM 1 82836 1.2072E-5 41418 0 3.99434E-6
3-105258929-T-A p.Phe281Ile missense ALCAM 1 82816 1.2075E-5 41408 0 1.1558E-4
3-105258934-G-A p.Leu282Leu synonymous ALCAM 2 82778 2.4161E-5 41389 0 3.19468E-5
3-105258935-T-A p.Phe283Ile missense ALCAM 1 82780 1.20802E-5 41390 0 1.91663E-4
3-105258945-C-T p.Pro286Leu missense+splice_region ALCAM 1 82658 1.2098E-5 41329 0 3.99655E-6
3-105258946-A-G p.Pro286Pro splice_region+synonymous ALCAM 89 82648 0.00107686 41324 0 0.00229548
3-105258950-A-C c.858+4A>C splice_region ALCAM 1 82576 1.21101E-5 41288 0 2.39927E-5
3-105258951-GTGCTTAAGTAT-G c.858+6_858+16delTGCTTAAGTAT splice_region ALCAM 1 82558 1.21127E-5 41279 0 1.15948E-4
3-105260469-A-G c.859-8A>G splice_region ALCAM 12 81500 1.47239E-4 40750 0 1.51202E-4
3-105260483-C-T p.Pro289Ser missense ALCAM 1 81632 1.22501E-5 40816 0 NA
3-105260486-G-A p.Glu290Lys missense ALCAM 2 81686 2.4484E-5 40843 0 6.37836E-5
3-105260491-A-C p.Gly291Gly synonymous ALCAM 1 81762 1.22306E-5 40881 0 1.20247E-5
3-105260498-A-G p.Ser294Gly missense ALCAM 1 81800 1.22249E-5 40900 0 NA
3-105260499-G-T p.Ser294Ile missense ALCAM 8 81780 9.78234E-5 40890 0 0.00100705
3-105260510-T-G p.Tyr298Asp missense ALCAM 1 81834 1.22199E-5 40917 0 NA
3-105260516-C-T p.Leu300Leu synonymous ALCAM 4 81834 4.88794E-5 40917 0 4.00231E-6
3-105260518-G-A p.Leu300Leu synonymous ALCAM 19285 81448 0.236777 40724 2362 0.26284
3-105260518-G-C p.Leu300Leu synonymous ALCAM 1 81834 1.22199E-5 40917 0 8.00891E-6
3-105260520-C-T p.Thr301Met missense ALCAM 7504 81672 0.0918797 40836 403 0.089337
3-105260521-G-A p.Thr301Thr synonymous ALCAM 7 81840 8.55327E-5 40920 0 1.27559E-4
3-105260522-G-C p.Asp302His missense ALCAM 1 81854 1.22169E-5 40927 0 3.20113E-5
3-105260522-G-T p.Asp302Tyr missense ALCAM 1 81854 1.22169E-5 40927 0 NA
3-105260524-T-C p.Asp302Asp synonymous ALCAM 732 81852 0.00894297 40926 4 0.019375
3-105260526-T-G p.Val303Gly missense ALCAM 1 81866 1.22151E-5 40933 0 8.27554E-6
3-105260527-G-C p.Val303Val synonymous ALCAM 1 81874 1.22139E-5 40937 0 8.27609E-6
3-105260567-G-A p.Asp317Asn missense ALCAM 1 81932 1.22052E-5 40966 0 8.26569E-6
3-105260569-CA-C p.Ser320fs frameshift ALCAM 1 81936 1.22046E-5 40968 0 NA
3-105260572-A-T p.Lys318Asn missense ALCAM 22 81982 2.68352E-4 40991 0 6.25E-4
3-105260581-G-A p.Met321Ile missense ALCAM 1 82014 1.2193E-5 41007 0 3.59824E-5
3-105260585-G-T p.Ala323Ser missense ALCAM 2 82012 2.43867E-5 41006 0 1.65254E-5
3-105260593-A-T p.Thr325Thr synonymous ALCAM 2 82068 2.437E-5 41034 0 0.00100705
3-105260594-G-A p.Ala326Thr missense ALCAM 1 82060 1.21862E-5 41030 0 5.59736E-5
3-105260596-T-C p.Ala326Ala synonymous ALCAM 79048 80384 0.98338 40192 38922 0.996875
3-105260600-A-G p.Thr328Ala missense ALCAM 1 82092 1.21815E-5 41046 0 NA
3-105264025-C-T n.1121-8C>T splice_region ALCAM 7017 80746 0.0869021 40373 237 0.0906393
3-105264080-C-T p.Ser335Ser synonymous ALCAM 3 82330 3.64387E-5 41165 0 6.38325E-4
3-105264086-C-T p.Asn337Asn synonymous ALCAM 145 82390 0.00175992 41195 0 0.001875
3-105264099-G-C p.Val342Leu missense ALCAM 1 82410 1.21345E-5 41205 0 3.99284E-5
3-105264120-G-A p.Ala349Thr missense ALCAM 12 82510 1.45437E-4 41255 0 6.25E-4
3-105264129-G-A p.Val352Met missense ALCAM 35 82510 4.24191E-4 41255 0 3.96773E-4
3-105264132-T-C p.Ser353Pro missense ALCAM 1 82532 1.21165E-5 41266 0 NA
3-105264149-T-C p.Ala358Ala synonymous ALCAM 1 82514 1.21192E-5 41257 0 3.99355E-6
3-105264155-G-T p.Arg360Ser missense ALCAM 166 82514 0.00201178 41257 0 0.00382828
3-105264163-C-A p.Thr363Asn missense ALCAM 1 82474 1.2125E-5 41237 0 8.27212E-6
3-105264174-A-ACTGGAACGGAATCAATCCGAC p.Met367delinsThrGlyThrGluSerIleArgLeu disruptive_inframe_insertion ALCAM 1 82366 1.21409E-5 41183 0 NA
3-105264176-G-T p.Met367Ile missense ALCAM 3500 82198 0.0425801 41099 98 0.0558912
3-105264180-G-GA c.1104+1_1104+2insA splice_donor ALCAM 2 82282 2.43067E-5 41141 1 NA
3-105265986-T-C c.1105-7T>C splice_region ALCAM 2 81500 2.45399E-5 40750 0 NA
3-105265999-A-G p.Ile371Val missense ALCAM 1 81982 1.21978E-5 40991 0 NA
3-105266009-G-A p.Arg374Gln missense ALCAM 3 81826 3.66632E-5 40913 0 1.6905E-5
3-105266013-T-C p.Ser375Ser synonymous ALCAM 2 81804 2.44487E-5 40902 0 1.67749E-5
3-105266019-G-A p.Pro377Pro synonymous ALCAM 2 81758 2.44624E-5 40879 0 8.27506E-6
3-105266032-C-G p.Leu382Val missense ALCAM 2 81688 2.44834E-5 40844 0 4.07415E-6
3-105266058-T-C p.Tyr390Tyr synonymous ALCAM 1 81626 1.2251E-5 40813 0 NA
3-105266064-C-T p.Cys392Cys synonymous ALCAM 1 81614 1.22528E-5 40807 0 3.19387E-5
3-105266072-C-T p.Ala395Val missense ALCAM 1 81648 1.22477E-5 40824 0 1.66124E-5
3-105266106-G-C p.Glu406Asp missense ALCAM 4 81672 4.89764E-5 40836 0 7.11369E-5
3-105266114-C-T p.Thr409Ile missense ALCAM 1 81644 1.22483E-5 40822 0 NA
3-105266122-G-A p.Val412Ile missense ALCAM 1 81668 1.22447E-5 40834 0 NA
3-105266126-AAGGTAATAAAATACTTGGGCACTAATTCAAATTGTTCTTTGAGAATTTTTTACCTGGTTTCTTTTATGATCTCAGTTCAACATCTTATTTTAATTGTAATATTTC-A p.Gly414fs frameshift ALCAM 14 81646 1.71472E-4 40823 7 NA
3-105266231-C-T c.1241-3C>T splice_region ALCAM 1 82018 1.21924E-5 41009 0 3.19305E-5
3-105266254-A-G p.Thr421Ala missense ALCAM 2 82262 2.43126E-5 41131 0 1.22851E-5
3-105266258-A-G p.Lys422Arg missense ALCAM 4 82300 4.86027E-5 41150 0 4.88249E-5
3-105266266-G-A p.Asp425Asn missense ALCAM 1 82334 1.21457E-5 41167 0 NA
3-105266274-T-C p.Ser427Ser synonymous ALCAM 9751 82226 0.118588 41113 651 0.1625
3-105266278-C-G p.Leu429Val missense ALCAM 1 82398 1.21362E-5 41199 0 NA
3-105266280-A-G p.Leu429Leu synonymous ALCAM 1 82406 1.2135E-5 41203 0 NA
3-105266290-A-G p.Ile433Val missense ALCAM 1 82458 1.21274E-5 41229 0 NA
3-105266292-A-C p.Ile433Ile synonymous ALCAM 1 82466 1.21262E-5 41233 0 NA
3-105266329-C-G p.Gln446Glu missense ALCAM 2 82638 2.42019E-5 41319 0 1.65464E-5
3-105266331-A-G p.Gln446Gln synonymous ALCAM 7573 82496 0.0917984 41248 407 0.08928
3-105266338-A-G p.Ile449Val missense ALCAM 1 82660 1.20978E-5 41330 0 3.19244E-5
3-105266347-A-G p.Ser452Gly missense ALCAM 2 82686 2.41879E-5 41343 0 2.0079E-5
3-105266355-C-T p.Ser454Ser synonymous ALCAM 174 82704 0.00210389 41352 0 0.00236165
3-105266356-G-A p.Val455Ile missense ALCAM 2 82714 2.41797E-5 41357 0 8.28377E-5
3-105268968-C-T c.1375-3C>T splice_region ALCAM 4 82044 4.87543E-5 41022 0 3.34778E-5
3-105268971-A-G p.Thr459Ala missense+splice_region ALCAM 1 82120 1.21773E-5 41060 0 8.34613E-6
3-105268983-C-A p.Pro463Thr missense ALCAM 1 82362 1.21415E-5 41181 0 3.19591E-5
3-105268984-C-A p.Pro463His missense ALCAM 1 82374 1.21398E-5 41187 0 4.0857E-6
3-105268988-T-C p.Tyr464Tyr synonymous ALCAM 1 82452 1.21283E-5 41226 0 8.30399E-6
3-105269016-A-G p.Ile474Val missense ALCAM 1 82690 1.20934E-5 41345 0 4.00943E-6
3-105269023-C-T p.Ser476Phe missense ALCAM 1 82716 1.20896E-5 41358 0 NA
3-105269037-G-A p.Val481Ile missense ALCAM 4 82798 4.83103E-5 41399 0 9.57977E-5
3-105269056-C-G p.Ala487Gly missense ALCAM 1 82830 1.20729E-5 41415 0 NA
3-105269103-A-AATGAAAACAGAGAAAAG c.1507_1507+1insATGAAAACAGAGAAAAG splice_donor ALCAM 2 82612 2.42096E-5 41306 0 NA
3-105271001-A-G p.Glu507Glu synonymous ALCAM 1 82140 1.21743E-5 41070 0 4.14577E-6
3-105271004-C-T p.His508His synonymous ALCAM 392 82100 0.00477466 41050 0 0.00514156
3-105271005-G-A p.Asp509Asn missense ALCAM 1 82090 1.21818E-5 41045 0 NA
3-105271016-C-T p.Asp512Asp synonymous ALCAM 6 82068 7.31101E-5 41034 0 1.2818E-4
3-105271026-G-GATGAAAACAGAGAAAAGGTGAATGACCAGGCAAAACTAATT c.1546_1546+1insATGAAAACAGAGAAAAGGTGAATGACCAGGCAAAACTAATT splice_donor ALCAM 1 82102 1.218E-5 41051 0 NA
3-105271033-A-T c.1546+7A>T splice_region ALCAM 1 82016 1.21927E-5 41008 0 NA
3-105271034-C-T c.1546+8C>T splice_region ALCAM 2 82016 2.43855E-5 41008 0 NA
3-105271321-G-C p.Arg519Thr missense ALCAM 1 82130 1.21758E-5 41065 0 3.99431E-6
3-105271337-C-T p.Asp524Asp synonymous ALCAM 1 82168 1.21702E-5 41084 0 3.99402E-6
3-105271342-C-A p.Ala526Glu missense ALCAM 1 82186 1.21675E-5 41093 0 3.9932E-6
3-105271361-C-T p.Ile532Ile synonymous ALCAM 1 82382 1.21386E-5 41191 0 8.24946E-6
3-105271362-G-A p.Val533Ile missense ALCAM 2 82416 2.42671E-5 41208 0 2.39509E-5
3-105271366-T-C p.Val534Ala missense ALCAM 3 82432 3.63936E-5 41216 0 3.99065E-5
3-105271368-G-A p.Gly535Ser missense ALCAM 3 82456 3.6383E-5 41228 0 NA
3-105271377-C-T p.Leu538Phe missense ALCAM 2 82518 2.42371E-5 41259 0 NA
3-105271400-C-T p.Val545Val synonymous ALCAM 1 82640 1.21007E-5 41320 0 6.25E-4
3-105271401-G-A p.Val546Ile missense ALCAM 10 82642 1.21004E-4 41321 0 2.23243E-4
3-105271430-G-GAC c.1664+1_1664+2insAC splice_donor ALCAM 2 82728 2.41756E-5 41364 1 NA
3-105290746-A-C p.Lys572Thr missense ALCAM 1 83178 1.20224E-5 41589 0 3.98321E-6
3-105290782-A-G p.Ter584Ter stop_retained ALCAM 2 83006 2.40946E-5 41503 0 3.1837E-5
3-105290806-C-A c.*23C>A splice_region ALCAM 3 82640 3.6302E-5 41320 0 1.22518E-5
3-105290808-G-GAGATAAAAATCATATAGACCAATTGAAGCATGAAC c.*25_*25+1insAGATAAAAATCATATAGACCAATTGAAGCATGAAC splice_donor ALCAM 6 82630 7.26128E-5 41315 3 NA
3-105290815-A-AGTCT c.*25+7_*25+8insGTCT splice_region ALCAM 8 82442 9.70379E-5 41221 0 4.66366E-5
3-105295743-C-T c.*2448C>T splice_region ALCAM 1 4656 2.14777E-4 2328 0 1.27397E-4