Variant

Variant ID Consequence Effect Gene AC AN AF NS NHOM maxEAF
17-73905927-C-T n.4479G>A splice_region FBF1 2 52194 3.83186E-5 26097 0 NA
17-73906769-C-T c.*30+5G>A splice_region FBF1 2 81872 2.44284E-5 40936 0 1.46429E-5
17-73906770-G-A c.*30+4C>T splice_region FBF1 9 81888 1.09906E-4 40944 0 6.26566E-4
17-73906805-C-T p.Ter1148Ter splice_region FBF1 3 82104 3.6539E-5 41052 0 4.22304E-6
17-73906815-G-A p.His1131Tyr missense FBF1 2 82200 2.43309E-5 41100 0 3.18634E-5
17-73906835-C-T p.Gly1124Glu missense FBF1 4 82180 4.86736E-5 41090 0 1.19893E-4
17-73906851-C-T p.Glu1119Lys missense FBF1 3 82040 3.65675E-5 41020 0 0.00100705
17-73906861-C-A p.Gln1115His missense FBF1 2 82000 2.43902E-5 41000 0 NA
17-73906866-C-T p.Glu1114Lys missense FBF1 2 81986 2.43944E-5 40993 0 NA
17-73906872-C-T p.Glu1112Lys missense FBF1 2 81878 2.44266E-5 40939 0 NA
17-73906872-C-A p.Glu1112* stop_gained FBF1 1 81878 1.22133E-5 40939 0 1.25578E-5
17-73906878-AGTCACGGTCCTGCAAGGCAGGTTTGGATGGGCG-A p.Asp1107_Phe1110del splice_acceptor FBF1 1 81838 1.22193E-5 40919 0 4.18274E-6
17-73906884-G-A p.Arg1108Cys missense FBF1 1 81724 1.22363E-5 40862 0 4.26185E-6
17-73906889-T-C c.3319-2A>G splice_acceptor FBF1 4 81610 4.90136E-5 40805 0 1.91278E-4
17-73906890-G-GCTCTGC c.3319-4_3319-3insGCAGAG splice_region FBF1 5 81570 6.1297E-5 40785 2 NA
17-73906894-G-A c.3319-7C>T splice_region FBF1 1 81484 1.22723E-5 40742 0 NA
17-73908281-C-T p.Ala1104Thr missense FBF1 1 80876 1.23646E-5 40438 0 8.38743E-6
17-73908295-A-C p.Leu1099Arg missense FBF1 2 81066 2.46713E-5 40533 0 2.37999E-5
17-73908306-G-A p.Ala1095Ala synonymous FBF1 1 81138 1.23247E-5 40569 0 6.36862E-5
17-73908312-G-A p.Leu1093Leu synonymous FBF1 2 81178 2.46372E-5 40589 0 4.28467E-5
17-73908315-G-A p.His1092His synonymous FBF1 58 81156 7.14673E-4 40578 1 0.00319494
17-73908322-G-A p.Pro1090Leu missense FBF1 2 81228 2.46221E-5 40614 0 NA
17-73908337-C-T p.Gly1085Asp missense FBF1 3 81212 3.69404E-5 40606 0 4.12453E-6
17-73908345-C-A p.Pro1082Pro synonymous FBF1 2 81220 2.46245E-5 40610 0 6.37064E-5
17-73908345-C-T p.Pro1082Pro synonymous FBF1 1 81220 1.23122E-5 40610 0 1.24967E-4
17-73908347-G-C p.Pro1082Ala missense FBF1 1 81258 1.23065E-5 40629 0 NA
17-73908358-C-G p.Trp1078Ser missense FBF1 141 81236 0.00173568 40618 0 0.00385399
17-73908361-C-T p.Arg1077His missense FBF1 4 81238 4.9238E-5 40619 0 5.48522E-5
17-73908388-G-GCA c.3203-1_3203insTG splice_acceptor FBF1 3 81070 3.70051E-5 40535 1 NA
17-73909559-T-TTC n.590_591dupGA splice_region FBF1 276 14876 0.0185534 7438 9 0.031252
17-73909776-C-T c.3202+7G>A splice_region FBF1 5 72868 6.86172E-5 36434 0 3.79719E-5
17-73909794-G-C p.Ser1064Cys missense FBF1 1 73772 1.35553E-5 36886 0 NA
17-73909800-G-A p.Ala1062Val missense FBF1 1 74088 1.34975E-5 37044 0 1.32746E-5
17-73909808-C-T p.Gln1059Gln synonymous FBF1 4 74508 5.36855E-5 37254 0 5.03525E-4
17-73909819-G-A p.Pro1056Ser missense FBF1 1 75194 1.32989E-5 37597 0 NA
17-73909825-G-A p.Leu1054Leu synonymous FBF1 1 75534 1.32391E-5 37767 0 1.27481E-5
17-73909828-C-T p.Gly1053Ser missense FBF1 5 75624 6.61166E-5 37812 0 1.07082E-5
17-73909847-G-A p.Asp1046Asp synonymous FBF1 5 77146 6.48122E-5 38573 0 4.19509E-5
17-73909851-T-C p.Gln1045Arg missense FBF1 1 77468 1.29086E-5 38734 0 3.18857E-5
17-73909861-G-A p.Arg1042Cys missense FBF1 3 78260 3.83338E-5 39130 0 NA
17-73909862-G-A p.Asp1041Asp synonymous FBF1 1 78402 1.27548E-5 39201 0 NA
17-73909868-T-G p.Gln1039His missense FBF1 2 78842 2.53672E-5 39421 0 NA
17-73909899-TCCTGTCCCCGTTCCCCCAGAAAGAAGGACTCAGCTGTGAGGTGGGAGGCTGGGGGTGCCGGGGGCAGGGGCGCCATACACTCAGGGAGCCTTG-T p.Glu1029fs frameshift FBF1 11 80166 1.37215E-4 40083 4 NA
17-73909905-C-G c.3085-5G>C splice_region FBF1 1 80298 1.24536E-5 40149 0 NA
17-73909987-G-A c.3084+7C>T splice_region FBF1 1 79968 1.2505E-5 39984 0 3.29753E-4
17-73909988-C-A c.3084+6G>T splice_region FBF1 1 80018 1.24972E-5 40009 0 NA
17-73909997-G-C p.His1027Gln missense FBF1 1 79860 1.25219E-5 39930 0 3.348E-4
17-73910009-C-T p.Glu1023Glu synonymous FBF1 4 79624 5.02361E-5 39812 0 9.55718E-5
17-73910025-C-T p.Arg1018Gln missense FBF1 1 79486 1.25808E-5 39743 0 1.90854E-5
17-73910027-C-T p.Glu1017Glu synonymous FBF1 3738 79434 0.0470579 39717 131 0.116109
17-73910030-C-G p.Gln1016His missense FBF1 14 79644 1.75782E-4 39822 0 6.25782E-4
17-73910040-T-G p.Gln1013Pro missense FBF1 19 79484 2.39042E-4 39742 0 5.24109E-4
17-73910042-C-T p.Val1012Val synonymous FBF1 7 79398 8.81634E-5 39699 0 6.25782E-4
17-73910053-A-G p.Leu1009Leu synonymous FBF1 1 79342 1.26037E-5 39671 0 NA
17-73910056-G-A p.Arg1008Trp missense FBF1 1 79356 1.26014E-5 39678 0 2.28368E-5
17-73910058-G-T p.Ala1007Asp missense FBF1 1 79332 1.26053E-5 39666 0 NA
17-73910070-G-A p.Ala1003Val missense FBF1 1 79418 1.25916E-5 39709 0 3.4343E-5
17-73910073-T-A p.Gln1002Leu missense FBF1 1 79464 1.25843E-5 39732 0 NA
17-73910079-T-C p.Gln1000Arg missense FBF1 1 79486 1.25808E-5 39743 0 NA
17-73910087-C-A p.Glu997Asp missense FBF1 1 79498 1.25789E-5 39749 0 NA
17-73910089-C-T p.Glu997Lys missense FBF1 1 79414 1.25922E-5 39707 0 3.18939E-5
17-73910091-C-T p.Arg996His missense FBF1 5 79404 6.29691E-5 39702 0 2.35738E-4
17-73910092-G-A p.Arg996Cys missense FBF1 1 79456 1.25856E-5 39728 0 7.69862E-5
17-73910095-A-G p.Leu995Leu synonymous FBF1 1 79592 1.25641E-5 39796 0 2.43938E-5
17-73910100-C-T p.Arg993Gln missense FBF1 5 79516 6.28804E-5 39758 0 3.23879E-4
17-73910101-G-A p.Arg993Trp missense FBF1 3 79478 3.77463E-5 39739 0 1.136E-4
17-73910101-G-T p.Arg993Arg synonymous FBF1 1 79478 1.25821E-5 39739 0 NA
17-73910103-T-TC p.Glu992fs frameshift FBF1 2 79456 2.51712E-5 39728 0 4.76713E-6
17-73910110-C-A p.Glu990* stop_gained FBF1 1 79566 1.25682E-5 39783 0 NA
17-73910114-G-A p.Tyr988Tyr synonymous FBF1 28 79550 3.5198E-4 39775 0 0.00560652
17-73910119-T-C p.Lys987Glu missense FBF1 4 79606 5.02475E-5 39803 0 7.40741E-5
17-73910120-C-T p.Glu986Glu synonymous FBF1 2 79600 2.51256E-5 39800 0 NA
17-73910122-C-T p.Glu986Lys missense FBF1 3 79534 3.77197E-5 39767 0 NA
17-73910128-CCACCTGCAGGGAGGCCGCCTGGGTCAGGGCTGCCTGGGCTCAGATGCGCCCACGCCCATGTGCCCGAGCAG-C p.Val983_Ala984del splice_acceptor FBF1 7 79420 8.8139E-5 39710 0 NA
17-73910133-T-C c.2947-2A>G splice_acceptor FBF1 2 79506 2.51553E-5 39753 0 NA
17-73910134-G-C c.2947-3C>G splice_region FBF1 1 79484 1.25811E-5 39742 0 NA
17-73910195-A-C c.2946+8T>G splice_region FBF1 21 79802 2.63151E-4 39901 0 1.91241E-4
17-73910198-A-G c.2946+5T>C splice_region FBF1 1 79974 1.25041E-5 39987 0 3.10196E-5
17-73910201-A-G c.2946+2T>C splice_donor FBF1 2 80068 2.49788E-5 40034 0 1.46477E-5
17-73910202-C-T c.2946+1G>A splice_donor FBF1 1 80122 1.2481E-5 40061 0 4.41404E-6
17-73910208-T-C p.Ser981Gly missense FBF1 1 80218 1.2466E-5 40109 0 4.37871E-6
17-73910224-C-G p.Glu975Asp missense FBF1 3 80318 3.73515E-5 40159 0 1.31174E-5
17-73910227-G-A p.Ala974Ala synonymous FBF1 1 80308 1.24521E-5 40154 0 6.25E-4
17-73910229-C-A p.Ala974Ser missense FBF1 9 80308 1.12069E-4 40154 0 8.76762E-5
17-73910230-GC-AA p.Arg973Leu missense FBF1 1 80366 1.24431E-5 40183 0 NA
17-73910232-G-A p.Arg973Cys missense FBF1 2 80504 2.48435E-5 40252 0 NA
17-73910237-T-A p.Lys971Met missense FBF1 3 80590 3.72255E-5 40295 0 4.37357E-6
17-73910244-G-A p.Arg969Cys missense FBF1 1 80614 1.24048E-5 40307 0 1.49504E-5
17-73910248-G-T p.Ala967Ala synonymous FBF1 2 80676 2.47905E-5 40338 0 NA
17-73910250-C-T p.Ala967Thr missense FBF1 1 80628 1.24026E-5 40314 0 NA
17-73910251-G-A p.Thr966Thr synonymous FBF1 2 80708 2.47807E-5 40354 0 1.79929E-5
17-73910254-G-A p.Ala965Ala synonymous FBF1 1 80736 1.2386E-5 40368 0 4.52776E-6
17-73910279-C-T p.Arg957Gln missense FBF1 2 80778 2.47592E-5 40389 0 1.17798E-4
17-73910279-C-G p.Arg957Pro missense FBF1 2 80778 2.47592E-5 40389 0 1.68282E-5
17-73910288-T-C p.Gln954Arg missense FBF1 1 80952 1.2353E-5 40476 0 NA
17-73910290-C-T p.Arg953Arg synonymous FBF1 1 80896 1.23616E-5 40448 0 6.37146E-5
17-73910291-C-A p.Arg953Leu missense FBF1 1 80890 1.23625E-5 40445 0 NA
17-73910307-C-A p.Ala948Ser missense FBF1 1 80726 1.23876E-5 40363 0 NA
17-73910319-C-T p.Ala944Thr missense FBF1 4 80624 4.9613E-5 40312 1 0.00252781
17-73910322-C-T p.Ala943Thr missense FBF1 4 80560 4.96524E-5 40280 0 7.11288E-5
17-73910324-A-G p.Leu942Pro missense FBF1 1 80576 1.24106E-5 40288 0 NA
17-73910333-T-A p.Glu939Val missense FBF1 1 80458 1.24288E-5 40229 0 4.62009E-6
17-73910337-C-T p.Glu938Lys missense FBF1 1 80306 1.24524E-5 40153 0 NA
17-73910342-C-T p.Arg936Gln missense FBF1 2 80164 2.49489E-5 40082 0 9.24377E-6
17-73910343-G-A p.Arg936Trp missense FBF1 1 80084 1.24869E-5 40042 0 6.37267E-5
17-73910344-G-C p.Leu935Leu synonymous FBF1 2 80086 2.49732E-5 40043 0 NA
17-73910346-G-A p.Leu935Phe missense FBF1 53 80030 6.62252E-4 40015 0 0.00105395
17-73910347-C-T p.Glu934Glu synonymous FBF1 1 80024 1.24963E-5 40012 0 NA
17-73910365-C-T p.Leu928Leu synonymous FBF1 2 79338 2.52086E-5 39669 0 2.231E-4
17-73910367-G-A p.Leu928Leu synonymous FBF1 5 79178 6.31489E-5 39589 0 2.49519E-4
17-73910374-C-G n.2976-1G>C splice_acceptor FBF1 1 79008 1.26569E-5 39504 0 5.33903E-5
17-73910379-C-CTCAGCTTTTG c.2770-1_2770insCAAAAGCTGA splice_acceptor FBF1 1 78700 1.27065E-5 39350 0 NA
17-73910380-C-T c.2770-1G>A splice_acceptor FBF1 2 78666 2.54239E-5 39333 0 2.88861E-4
17-73910380-C-G c.2770-1G>C splice_acceptor FBF1 1 78666 1.2712E-5 39333 0 4.70765E-6
17-73910384-A-G c.2770-5T>C splice_region FBF1 2 78302 2.55421E-5 39151 0 3.18776E-5
17-73910384-A-C c.2770-5T>G splice_region FBF1 2 78302 2.55421E-5 39151 0 3.18776E-5
17-73910832-G-A p.Ala922Val missense FBF1 1 80004 1.24994E-5 40002 0 NA
17-73910838-C-G p.Ser920Thr missense FBF1 1 80350 1.24456E-5 40175 0 NA
17-73910857-G-A p.Arg914Trp missense FBF1 1 80918 1.23582E-5 40459 0 3.0349E-5
17-73910870-C-T p.Gln909Gln synonymous FBF1 1 81226 1.23113E-5 40613 0 2.38005E-5
17-73910879-CCGCTCGGCCTCG-C p.Glu903_Arg906del disruptive_inframe_deletion FBF1 12 81228 1.47732E-4 40614 0 3.51056E-4
17-73910879-C-CCGCTCGGCCTCG p.Arg906_Ala907insGluAlaGluArg disruptive_inframe_insertion FBF1 1 81228 1.2311E-5 40614 0 1.15302E-5
17-73910884-C-T p.Glu905Lys missense FBF1 2 81148 2.46463E-5 40574 0 3.19673E-5
17-73910885-G-C p.Ala904Ala synonymous FBF1 2 78572 2.54544E-5 39286 0 0.168851
17-73910885-G-A p.Ala904Ala synonymous FBF1 1 78732 1.27013E-5 39366 0 NA
17-73910886-G-C p.Ala904Gly missense FBF1 5 78726 6.35114E-5 39363 0 0.054995
17-73910889-T-C p.Glu903Gly missense FBF1 3 78998 3.79756E-5 39499 0 0.0820745
17-73910890-C-G p.Glu903Gln missense FBF1 1 79342 1.26037E-5 39671 0 NA
17-73910891-G-C p.Arg902Arg synonymous FBF1 2 79126 2.52761E-5 39563 0 1.62443E-4
17-73910892-C-T p.Arg902His missense FBF1 1 79458 1.25853E-5 39729 0 1.05354E-5
17-73910901-C-T p.Arg899Gln missense FBF1 1 80504 1.24217E-5 40252 0 3.19509E-5
17-73910924-C-T p.Ala891Ala synonymous FBF1 7 81324 8.60755E-5 40662 0 9.57732E-5
17-73910927-G-A p.Ser890Ser synonymous FBF1 1 81414 1.22829E-5 40707 0 2.47721E-5
17-73910930-G-A p.Phe889Phe synonymous FBF1 1 81462 1.22757E-5 40731 0 4.11526E-6
17-73910932-A-G p.Phe889Leu missense FBF1 15 81438 1.84189E-4 40719 0 1.59908E-4
17-73910933-C-T p.Glu888Glu synonymous FBF1 1 81476 1.22736E-5 40738 0 4.11002E-6
17-73910936-C-T p.Ala887Ala synonymous FBF1 2 81504 2.45387E-5 40752 0 9.65754E-6
17-73910944-C-T p.Glu885Lys missense FBF1 1 81546 1.2263E-5 40773 0 4.08787E-6
17-73910953-G-A p.Leu882Leu synonymous FBF1 1 81636 1.22495E-5 40818 0 NA
17-73910954-GCGC-G p.Arg881del disruptive_inframe_deletion FBF1 1 81590 1.22564E-5 40795 0 4.07511E-6
17-73910955-C-A p.Arg881Leu missense FBF1 3 81574 3.67764E-5 40787 0 NA
17-73910956-G-A p.Arg881Cys missense FBF1 3 81578 3.67746E-5 40789 0 4.07203E-6
17-73910957-C-T p.Arg880Arg synonymous FBF1 1 81628 1.22507E-5 40814 0 NA
17-73910960-C-T p.Arg879Arg synonymous FBF1 1 81686 1.2242E-5 40843 0 1.62551E-5
17-73910963-C-T p.Glu878Glu synonymous FBF1 4 81746 4.89321E-5 40873 1 4.05693E-6
17-73910970-C-A p.Gly876Val missense FBF1 2 81808 2.44475E-5 40904 0 8.68086E-6
17-73910971-C-A p.Gly876Trp missense FBF1 22 81800 2.68949E-4 40900 0 0.00100705
17-73910972-G-A p.Cys875Cys synonymous FBF1 5 81742 6.11681E-5 40871 0 8.66611E-6
17-73910976-T-G p.Lys874Thr missense FBF1 4 81824 4.88854E-5 40912 0 1.37773E-4
17-73910978-G-A p.Leu873Leu synonymous FBF1 8 81816 9.77804E-5 40908 0 8.1057E-5
17-73910983-T-C p.Met872Val missense FBF1 1 81822 1.22217E-5 40911 0 8.57618E-6
17-73910983-T-A p.Met872Leu missense FBF1 1 81822 1.22217E-5 40911 0 4.05045E-6
17-73911013-TCTGGGATGTGGGGGTGAAGGCACGGGGTGAGTGTCCCTGGGCATAATGGCAGGGGCAGGGGCTGAGTGCGGTGGCTTGACTCAC-T c.2583+1_2584-1delGTGAGTCAAGCCACCGCACTCAGCCCCTGCCCCTGCCATTATGCCCAGGGACACTCACCCCGTGCCTTCACCCCCACATCCCAG splice_acceptor FBF1 9 81858 1.09946E-4 40929 2 NA
17-73911015-T-C c.2584-2A>G splice_acceptor FBF1 1 81898 1.22103E-5 40949 0 NA
17-73911020-T-C c.2584-7A>G splice_region FBF1 7 81856 8.5516E-5 40928 0 3.18634E-5
17-73911103-C-T p.Ala860Thr missense FBF1 1 82042 1.21889E-5 41021 0 4.03366E-6
17-73911107-T-C p.Glu858Glu synonymous FBF1 5 82044 6.09429E-5 41022 0 6.25E-4
17-73911109-C-G p.Glu858Gln missense FBF1 1 82050 1.21877E-5 41025 0 4.03252E-6
17-73911109-C-T p.Glu858Lys missense FBF1 1 82050 1.21877E-5 41025 0 1.68308E-5
17-73911120-C-T p.Arg854Lys missense FBF1 1 82080 1.21832E-5 41040 0 4.03135E-6
17-73911121-T-C p.Arg854Gly missense FBF1 1 82056 1.21868E-5 41028 0 NA
17-73911127-T-C p.Met852Val missense FBF1 1 82030 1.21907E-5 41015 0 3.18837E-5
17-73911142-C-A p.Ala847Ser missense FBF1 2 81928 2.44117E-5 40964 0 8.07057E-6
17-73911149-C-T p.Lys844Lys synonymous FBF1 1 81928 1.22058E-5 40964 0 NA
17-73911152-C-T p.Arg843Arg synonymous FBF1 431 81906 0.00526213 40953 3 0.00412656
17-73911158-C-T p.Glu841Glu synonymous FBF1 1 81830 1.22205E-5 40915 0 NA
17-73911170-G-GC p.Ala838fs frameshift FBF1 1 81632 1.22501E-5 40816 0 NA
17-73911178-T-C p.Met835Val missense FBF1 3 81566 3.678E-5 40783 0 3.18979E-5
17-73911185-C-T p.Ala832Ala synonymous FBF1 1 81406 1.22841E-5 40703 0 NA
17-73911199-C-T p.Glu828Lys missense FBF1 1 80898 1.23612E-5 40449 0 2.88168E-5
17-73911200-G-C p.Ala827Ala synonymous FBF1 1 81020 1.23426E-5 40510 0 8.35715E-6
17-73911200-G-A p.Ala827Ala synonymous FBF1 1 81020 1.23426E-5 40510 0 1.67143E-5
17-73911200-G-GGCAGTCACCCGCCAGC p.Glu828fs frameshift FBF1 2 81020 2.46853E-5 40510 0 8.35715E-6
17-73911204-G-A p.Thr826Ile missense FBF1 2 80818 2.4747E-5 40409 0 8.4458E-6
17-73911213-C-T p.Trp823* stop_gained FBF1 1 81552 1.22621E-5 40776 0 NA
17-73911217-G-C p.Arg822Gly missense FBF1 1 81528 1.22657E-5 40764 0 NA
17-73911223-G-GCTCCAGCAGCCGGCTCTGCTCATTCAGCCGTGCCTCCATCTTCCCGA c.2461-4_2461-3insTCGGGAAGATGGAGGCACGGCTGAATGAGCAGAGCCGGCTGCTGGAG splice_region FBF1 4 81512 4.90725E-5 40756 2 NA
17-73911223-G-A c.2461-3C>T splice_region FBF1 1 81512 1.22681E-5 40756 0 3.18695E-5
17-73911226-G-C c.2461-6C>G splice_region FBF1 1 81452 1.22772E-5 40726 0 1.00289E-5
17-73913806-G-A c.2460+7C>T splice_region FBF1 1 68898 1.45142E-5 34449 0 1.65863E-5
17-73913812-C-G c.2460+1G>C splice_donor FBF1 9 70864 1.27004E-4 35432 0 2.26006E-4
17-73913815-G-C p.Gln820Glu missense+splice_region FBF1 1 71546 1.3977E-5 35773 0 NA
17-73913819-C-T p.Leu818Leu synonymous FBF1 1 72366 1.38186E-5 36183 0 4.7293E-6
17-73913826-C-T p.Arg816Gln missense FBF1 2 73864 2.70768E-5 36932 0 NA
17-73913827-G-T p.Arg816Arg synonymous FBF1 71 74078 9.58449E-4 37039 0 0.00219955
17-73913827-G-A p.Arg816Trp missense FBF1 2 74084 2.69964E-5 37042 0 2.18503E-5
17-73913845-G-A p.Arg810Trp missense FBF1 5 76984 6.49486E-5 38492 0 1.32216E-5
17-73913849-C-T p.Glu808Glu synonymous FBF1 1 77676 1.2874E-5 38838 0 3.18715E-5
17-73913853-A-G p.Met807Thr missense FBF1 2 77998 2.56417E-5 38999 0 NA
17-73913860-C-T p.Gly805Arg missense FBF1 1 78520 1.27356E-5 39260 0 4.5438E-5
17-73913861-G-C p.Ile804Met missense FBF1 1 78572 1.27272E-5 39286 0 5.05051E-4
17-73913872-G-GTTGCCGGCTCCGCTCCTCCTC p.Gln800_Gln801insGluGluGluArgSerArgGln conservative_inframe_insertion FBF1 1 79168 1.26314E-5 39584 0 4.10661E-6
17-73913875-G-A p.Gln800* stop_gained FBF1 2 79140 2.52717E-5 39570 0 NA
17-73913877-C-T p.Arg799Gln missense FBF1 46 79210 5.80735E-4 39605 0 2.58945E-4
17-73913881-T-C p.Ser798Gly missense FBF1 2 79208 2.525E-5 39604 0 NA
17-73913883-C-T p.Arg797Gln missense FBF1 1 79340 1.2604E-5 39670 0 1.24888E-5
17-73913886-T-C p.Glu796Gly missense FBF1 2 79312 2.52169E-5 39656 0 4.17861E-6
17-73913887-C-T p.Glu796Lys missense FBF1 2 79508 2.51547E-5 39754 0 NA
17-73913902-G-A p.Arg791Trp missense FBF1 1 79558 1.25694E-5 39779 0 4.27676E-6
17-73913911-G-A p.Gln788* stop_gained FBF1 2 79748 2.5079E-5 39874 0 4.30537E-6
17-73913915-C-T p.Leu786Leu synonymous FBF1 1 80166 1.24741E-5 40083 0 NA
17-73913919-C-T p.Arg785Gln missense FBF1 2 80066 2.49794E-5 40033 0 1.27543E-4
17-73913920-G-A p.Arg785Trp missense FBF1 1 79960 1.25063E-5 39980 0 1.15428E-5
17-73913930-T-A p.Ala781Ala splice_region+synonymous FBF1 1 80060 1.24906E-5 40030 0 NA
17-73913931-GCTGGGGGCAACCCACAGGGTGCTCAGCAGCTGCTCCCCCTTCCCACCAGGAGCCGGGGTGGCTGAGAGGGGAGGGCGTAC-G c.2341+1_2342-1delGTACGCCCTCCCCTCTCAGCCACCCCGGCTCCTGGTGGGAAGGGGGAGCAGCTGCTGAGCACCCTGTGGGTTGCCCCCAG splice_acceptor FBF1 7 80040 8.74563E-5 40020 0 NA
17-73913935-G-C c.2342-4C>G splice_region FBF1 293 79988 0.00366305 39994 2 0.0073808
17-73913938-GC-TT c.2342-8_2342-7delGCinsAA splice_region FBF1 4 79874 5.00789E-5 39937 0 NA
17-73914005-G-A c.2341+7C>T splice_region FBF1 1 80524 1.24187E-5 40262 0 1.39132E-5
17-73914014-C-T p.Arg780Gln missense+splice_region FBF1 16 80952 1.97648E-4 40476 0 0.00100705
17-73914015-G-A p.Arg780Trp missense FBF1 2 80946 2.47078E-5 40473 0 NA
17-73914024-C-T p.Glu777Lys missense FBF1 151 81246 0.00185855 40623 2 0.006875
17-73914027-C-A p.Asp776Tyr missense FBF1 1 81350 1.22926E-5 40675 0 NA
17-73914028-AC-TG p.Arg775Pro missense FBF1 1 81364 1.22904E-5 40682 0 NA
17-73914029-C-T p.Arg775His missense FBF1 13 81390 1.59725E-4 40695 0 0.0015121
17-73914030-G-A p.Arg775Cys missense FBF1 13 81380 1.59744E-4 40690 0 1.59398E-4
17-73914035-C-T p.Arg773Gln missense FBF1 16 81530 1.96247E-4 40765 0 3.50765E-4
17-73914040-C-T p.Gly771Gly synonymous FBF1 1 81664 1.22453E-5 40832 0 6.25E-4
17-73914051-G-A p.Arg768Trp missense FBF1 4 81766 4.89201E-5 40883 0 4.10664E-6
17-73914071-T-G p.His761Pro missense FBF1 1 82004 1.21945E-5 41002 0 NA
17-73914074-G-A p.Ser760Leu missense FBF1 1 82066 1.21853E-5 41033 0 1.21679E-5
17-73914084-C-T p.Val757Met missense FBF1 8 82192 9.73331E-5 41096 0 2.86843E-4
17-73914086-C-T p.Arg756His missense FBF1 4 82206 4.86583E-5 41103 0 4.04829E-5
17-73914086-C-A p.Arg756Leu missense FBF1 1 82206 1.21646E-5 41103 0 NA
17-73914090-A-G p.Ser755Pro missense FBF1 1 82254 1.21575E-5 41127 0 NA
17-73914099-C-T p.Glu752Lys missense FBF1 2 82284 2.43061E-5 41142 0 3.18735E-5
17-73914100-G-A p.His751His synonymous FBF1 32 82278 3.88925E-4 41139 0 5.03525E-4
17-73914100-G-C p.His751Gln missense FBF1 1 82278 1.21539E-5 41139 0 2.42644E-5
17-73914134-A-T p.Ile740Asn missense FBF1 1 82308 1.21495E-5 41154 0 4.06918E-6
17-73914149-GACCTGGAAGAAGACTGGGTCACCCCCTCCTGACGGTCTCGGGGACCTTCCGGCCCCCAACGTCAGGCGGGCATGGTTGGGGCAGCGCACAT-G p.Ser735fs frameshift FBF1 7 82326 8.50278E-5 41163 0 NA
17-73914154-G-C c.2202-3C>G splice_region FBF1 1 82294 1.21516E-5 41147 0 8.54029E-6
17-73914243-C-T p.Arg734Gln missense+splice_region FBF1 1 82058 1.21865E-5 41029 0 9.55475E-5
17-73914244-G-A p.Arg734Trp missense+splice_region FBF1 2 82042 2.43778E-5 41021 0 1.69236E-4
17-73914245-C-T p.Thr733Thr splice_region+synonymous FBF1 1 82044 1.21886E-5 41022 0 1.69199E-5
17-73914246-G-A p.Thr733Met missense FBF1 2 82042 2.43778E-5 41021 0 1.08928E-4
17-73914261-C-G p.Ser728Thr missense FBF1 3 82018 3.65773E-5 41009 0 2.82673E-5
17-73914261-C-T p.Ser728Asn missense FBF1 2 82018 2.43849E-5 41009 0 NA
17-73914262-T-C p.Ser728Gly missense FBF1 1 82012 1.21933E-5 41006 0 NA
17-73914269-C-T p.Ala725Ala synonymous FBF1 110 81928 0.00134264 40964 1 0.00299535
17-73914270-G-A p.Ala725Val missense FBF1 24 81856 2.93198E-4 40928 0 0.0020141
17-73914275-G-A p.Val723Val synonymous FBF1 2 81874 2.44278E-5 40937 0 4.0424E-6
17-73914277-C-A p.Val723Phe missense FBF1 1 81922 1.22067E-5 40961 0 4.26862E-5
17-73914278-C-T p.Glu722Glu synonymous FBF1 1 81926 1.22061E-5 40963 0 4.26497E-5
17-73914282-C-T p.Arg721Gln missense FBF1 4 81944 4.88138E-5 40972 0 6.25E-4
17-73914283-G-A p.Arg721* stop_gained FBF1 1 81904 1.22094E-5 40952 0 8.53563E-6
17-73914293-C-T p.Leu717Leu synonymous FBF1 1 81966 1.22002E-5 40983 0 1.20955E-5
17-73914307-GC-AA p.LeuGln712* stop_gained FBF1 13 81918 1.58695E-4 40959 0 NA
17-73914307-G-A p.Gln713* stop_gained FBF1 1 81918 1.22073E-5 40959 0 6.37349E-5
17-73914320-G-A p.His708His synonymous FBF1 5 81834 6.10993E-5 40917 0 8.06289E-6
17-73914322-G-T p.His708Asn missense FBF1 2 81836 2.44391E-5 40918 0 NA
17-73914326-T-C p.Arg706Arg synonymous FBF1 13 81790 1.58944E-4 40895 0 0.00108812
17-73914330-C-T p.Arg705His missense FBF1 3 81718 3.67116E-5 40859 0 3.18573E-5
17-73914331-G-C p.Arg705Gly missense FBF1 1 81698 1.22402E-5 40849 0 8.67062E-6
17-73914347-C-T p.Ala699Ala synonymous FBF1 4 81374 4.91558E-5 40687 0 4.85751E-5
17-73914348-G-A p.Ala699Val missense+splice_region FBF1 5 81328 6.14794E-5 40664 0 6.37471E-5
17-73915749-C-T p.Arg698Gln missense+splice_region FBF1 4 81028 4.93657E-5 40514 0 6.28931E-4
17-73915749-C-A p.Arg698Leu missense+splice_region FBF1 1 81028 1.23414E-5 40514 0 NA
17-73915750-G-A p.Arg698Trp missense+splice_region FBF1 1 81042 1.23393E-5 40521 0 1.14921E-4
17-73915756-G-A p.Leu696Leu synonymous FBF1 5 81182 6.159E-5 40591 0 5.04032E-4
17-73915756-G-C p.Leu696Val missense FBF1 1 81182 1.2318E-5 40591 0 4.41739E-6
17-73915758-TC-T p.Glu695fs frameshift FBF1 1 81164 1.23207E-5 40582 0 NA
17-73915759-C-T p.Glu695Lys missense FBF1 2 81204 2.46293E-5 40602 0 1.91205E-5
17-73915761-C-T p.Arg694Gln missense FBF1 1 81266 1.23053E-5 40633 0 1.10448E-4
17-73915762-G-A p.Arg694Trp missense FBF1 4 81326 4.91848E-5 40663 0 0.00118885
17-73915779-T-C p.Gln688Arg missense FBF1 1 81724 1.22363E-5 40862 0 4.10263E-6
17-73915788-T-C p.Glu685Gly missense FBF1 1 81864 1.22154E-5 40932 0 6.37511E-5
17-73915793-C-T p.Ala683Ala synonymous FBF1 4 81874 4.88556E-5 40937 0 8.11879E-6
17-73915794-G-A p.Ala683Val missense FBF1 17 81888 2.07601E-4 40944 0 6.25E-4
17-73915798-T-C p.Ile682Val missense FBF1 1 81980 1.21981E-5 40990 0 NA
17-73915802-C-T p.Ala680Ala synonymous FBF1 4 81986 4.87888E-5 40993 0 3.18634E-5
17-73915803-G-A p.Ala680Val missense FBF1 1543 81960 0.0188263 40980 16 0.0230542
17-73915809-C-T p.Arg678His missense FBF1 3 82024 3.65747E-5 41012 0 2.65454E-5
17-73915810-G-A p.Arg678Cys missense FBF1 1 82030 1.21907E-5 41015 0 1.75374E-5
17-73915813-G-A p.Arg677Trp missense FBF1 1 82084 1.21826E-5 41042 0 6.25E-4
17-73915817-G-A p.His675His synonymous FBF1 2 82102 2.43599E-5 41051 0 NA
17-73915820-C-T p.Gln674Gln synonymous FBF1 2 82140 2.43487E-5 41070 0 8.48608E-6
17-73915825-C-T p.Ala673Thr missense FBF1 6 82166 7.30229E-5 41083 0 NA
17-73915826-C-T p.Thr672Thr synonymous FBF1 1 82170 1.21699E-5 41085 0 1.68495E-5
17-73915837-C-T p.Ala669Thr missense FBF1 2 82236 2.43202E-5 41118 0 8.03632E-6
17-73915839-C-T p.Arg668His missense FBF1 3 82242 3.64777E-5 41121 0 3.18573E-4
17-73915842-G-T p.Ala667Asp missense FBF1 1 82272 1.21548E-5 41136 0 6.37186E-5
17-73915849-C-T p.Glu665Lys missense FBF1 2 82310 2.42984E-5 41155 0 6.37227E-5
17-73915853-C-T p.Glu663Glu synonymous FBF1 966 82310 0.0117361 41155 10 0.0100705
17-73915861-A-G p.Cys661Arg missense FBF1 1 82356 1.21424E-5 41178 0 NA
17-73915865-C-T p.Ser659Ser synonymous FBF1 1 82344 1.21442E-5 41172 0 8.31794E-6
17-73915866-G-A p.Ser659Leu missense FBF1 1 82354 1.21427E-5 41177 0 6.37267E-5
17-73915875-C-T p.Arg656Gln missense FBF1 1 82364 1.21412E-5 41182 0 3.18573E-5
17-73915876-G-A p.Arg656Trp missense FBF1 2 82370 2.42807E-5 41185 0 2.49381E-5
17-73915878-G-A p.Ala655Val missense FBF1 1 82380 1.21389E-5 41190 0 1.66237E-5
17-73915880-T-C p.Ser654Ser synonymous FBF1 1 82390 1.21374E-5 41195 0 NA
17-73915883-C-G p.Leu653Leu synonymous FBF1 1 82378 1.21392E-5 41189 0 4.014E-6
17-73915891-C-G p.Glu651Gln missense FBF1 22 82330 2.67217E-4 41165 0 1.68604E-4
17-73915891-C-T p.Glu651Lys missense FBF1 12 82330 1.45755E-4 41165 0 0.00159327
17-73915892-G-A p.Asn650Asn synonymous FBF1 1 82328 1.21465E-5 41164 0 1.66121E-5
17-73915893-TTCTC-T p.Glu649fs frameshift FBF1 1 82332 1.21459E-5 41166 0 NA
17-73915902-C-T p.Arg647Gln missense FBF1 2 82282 2.43067E-5 41141 0 2.00731E-5
17-73915903-G-A p.Arg647Trp missense FBF1 3 82300 3.6452E-5 41150 0 3.21187E-5
17-73915908-C-T p.Arg645Gln missense FBF1 2 82278 2.43078E-5 41139 0 3.18613E-5
17-73915909-G-A p.Arg645Trp missense FBF1 5 82260 6.07829E-5 41130 0 1.27453E-4
17-73915909-G-T p.Arg645Arg synonymous FBF1 1 82260 1.21566E-5 41130 0 NA
17-73915917-C-T p.Arg642Gln missense FBF1 2 82238 2.43197E-5 41119 0 8.30137E-6
17-73915918-G-A p.Arg642Trp missense FBF1 1 82208 1.21643E-5 41104 0 2.49045E-5
17-73915927-A-T p.Tyr639Asn missense FBF1 4 82156 4.86879E-5 41078 0 1.60608E-5
17-73915928-C-T p.Ser638Ser synonymous FBF1 195 82152 0.00237365 41076 3 0.0120846
17-73915929-G-A p.Ser638Leu missense FBF1 1 82152 1.21726E-5 41076 0 1.27397E-4
17-73915931-T-C p.Thr637Thr synonymous FBF1 1 82154 1.21723E-5 41077 0 3.18532E-5
17-73915939-G-A p.Leu635Leu synonymous FBF1 3 82124 3.65301E-5 41062 0 NA
17-73915950-C-G p.Arg631Pro missense FBF1 2 82042 2.43778E-5 41021 0 NA
17-73915950-C-A p.Arg631Leu missense FBF1 6 82042 7.31333E-5 41021 0 5.6271E-5
17-73915951-G-A p.Arg631Cys missense FBF1 12 82034 1.46281E-4 41017 0 8.4376E-5
17-73915963-C-A c.1887-8G>T splice_region FBF1 3 81998 3.65863E-5 40999 0 4.01926E-6
17-73916093-T-C p.Ala627Ala synonymous FBF1 1 82018 1.21924E-5 41009 0 NA
17-73916096-A-G p.Ser626Ser synonymous FBF1 50 81998 6.09771E-4 40999 0 0.00625
17-73916101-C-T p.Glu625Lys missense FBF1 4 81954 4.88079E-5 40977 0 0.00151057
17-73916141-C-T p.Gly611Gly synonymous FBF1 185 81652 0.00226571 40826 0 0.00305187
17-73916142-C-G p.Gly611Ala missense FBF1 1 81668 1.22447E-5 40834 0 4.49378E-6
17-73916143-C-A p.Gly611Trp missense FBF1 1 81682 1.22426E-5 40841 0 NA
17-73916163-G-A p.Ala604Val missense FBF1 1 81534 1.22648E-5 40767 0 9.90874E-6
17-73916163-G-C p.Ala604Gly missense FBF1 2 81534 2.45296E-5 40767 0 NA
17-73916165-C-T p.Arg603Arg synonymous FBF1 6 81544 7.35799E-5 40772 0 0.0015121
17-73916165-C-G p.Arg603Arg synonymous FBF1 12 81542 1.47163E-4 40771 0 2.55167E-4
17-73916166-C-T p.Arg603Gln missense FBF1 29 81552 3.55601E-4 40776 0 0.00504032
17-73916167-G-A p.Arg603Trp missense FBF1 2 81556 2.4523E-5 40778 0 4.01429E-5
17-73916184-C-T p.Arg597Gln missense FBF1 2 81360 2.45821E-5 40680 0 2.15045E-5
17-73916185-G-A p.Arg597Trp missense FBF1 1 81318 1.22974E-5 40659 0 4.07897E-5
17-73916187-A-G p.Val596Ala missense+splice_region FBF1 8 81272 9.84349E-5 40636 0 6.37836E-5
17-73916193-G-GCCTCC c.1786-6_1786-5insGGAGG splice_region FBF1 1 81298 1.23004E-5 40649 0 NA
17-73916195-G-GCTCTGCC c.1786-8_1786-7insGGCAGAG splice_region FBF1 1 81266 1.23053E-5 40633 0 NA
17-73916377-C-T p.Arg588Gln missense FBF1 1 80976 1.23493E-5 40488 0 1.85021E-5
17-73916378-G-A p.Arg588Trp missense FBF1 2 80976 2.46987E-5 40488 0 1.85219E-5
17-73916388-A-G p.His584His synonymous FBF1 2 81148 2.46463E-5 40574 0 2.8422E-5
17-73916390-G-A p.His584Tyr missense FBF1 12 81112 1.47944E-4 40556 0 1.91083E-4
17-73916396-G-A p.Leu582Leu synonymous FBF1 2 81108 2.46585E-5 40554 0 NA
17-73916399-C-T p.Glu581Lys missense FBF1 12 81064 1.48031E-4 40532 0 6.27353E-4
17-73916399-C-G p.Glu581Gln missense FBF1 2 81064 2.46719E-5 40532 0 9.75705E-6
17-73916399-C-A p.Glu581* stop_gained FBF1 1 81064 1.23359E-5 40532 0 NA
17-73916400-G-A p.Ala580Ala synonymous FBF1 1 81030 1.23411E-5 40515 0 2.92649E-5
17-73916414-C-T p.Ala576Thr missense FBF1 1 81042 1.23393E-5 40521 0 8.33229E-6
17-73916423-A-T p.Cys573Ser missense FBF1 7465 80682 0.0925237 40341 512 0.138125
17-73916435-C-A p.Val569Leu missense FBF1 1 80780 1.23793E-5 40390 0 NA
17-73916436-C-T p.Gln568Gln synonymous FBF1 4 80800 4.95049E-5 40400 0 6.37064E-5
17-73916439-T-G p.Ala567Ala synonymous FBF1 1 80756 1.2383E-5 40378 0 NA
17-73916450-G-C p.Leu564Val missense FBF1 1 80590 1.24085E-5 40295 0 1.1845E-5
17-73916453-GC-TT p.LysGln562LysLys missense FBF1 3 80500 3.72671E-5 40250 0 NA
17-73916457-C-T p.Gln561Gln synonymous FBF1 1 80468 1.24273E-5 40234 0 1.19138E-5
17-73916472-C-T p.Pro556Pro synonymous FBF1 5 79532 6.28678E-5 39766 0 2.87517E-4
17-73916473-G-C p.Pro556Arg missense FBF1 2 79544 2.51433E-5 39772 0 1.213E-5
17-73916485-C-T p.Arg552Gln missense FBF1 10 78244 1.27805E-4 39122 0 0.00201613
17-73916486-G-A p.Arg552Trp missense FBF1 37 78166 4.73352E-4 39083 0 5.04032E-4
17-73916493-G-A p.Ser549Ser synonymous FBF1 1 77376 1.29239E-5 38688 0 NA
17-73916515-A-ACGGGCACGGAAGGCTCTGTGGGTTTCTGGGTGCTC c.1630-6_1630-5insGAGCACCCAGAAACCCACAGAGCCTTCCGTGCCCG splice_region FBF1 2 73110 2.7356E-5 36555 0 NA
17-73916515-A-ACGGGCACGGAAGGCTCTGTGGGTTTCTGGGTGCTCG c.1630-6_1630-5insCGAGCACCCAGAAACCCACAGAGCCTTCCGTGCCCG splice_region FBF1 1 73110 1.3678E-5 36555 0 NA
17-73916516-G-A c.1630-6C>T splice_region FBF1 2 72892 2.74379E-5 36446 0 NA
17-73917324-C-T c.1629+1G>A splice_donor FBF1 3 82300 3.6452E-5 41150 0 2.96033E-5
17-73917325-C-G p.Gln543His missense+splice_region FBF1 1 82326 1.21468E-5 41163 0 NA
17-73917331-G-A p.Pro541Pro synonymous FBF1 1 82344 1.21442E-5 41172 0 2.83238E-5
17-73917336-C-T p.Val540Met missense FBF1 4 82360 4.85673E-5 41180 0 1.62902E-4
17-73917337-G-A p.Ser539Ser synonymous FBF1 7 82366 8.49865E-5 41183 1 0.00100705
17-73917345-CTG-C p.Thr536fs frameshift FBF1 1 82376 1.21395E-5 41188 0 NA
17-73917347-G-A p.Thr536Ile missense FBF1 2 82370 2.42807E-5 41185 0 NA
17-73917360-T-C p.Thr532Ala missense FBF1 1 82366 1.21409E-5 41183 0 NA
17-73917364-C-T p.Pro530Pro synonymous FBF1 3 82356 3.64272E-5 41178 0 0.0020141
17-73917365-G-A p.Pro530Leu missense FBF1 1 82358 1.21421E-5 41179 0 0.00151057
17-73917367-G-A p.Phe529Phe synonymous FBF1 2 82350 2.42866E-5 41175 0 0.00100705
17-73917372-A-G p.Cys528Arg missense FBF1 211 82334 0.00256273 41167 1 0.0107275
17-73917374-G-A p.Thr527Met missense FBF1 8 82340 9.71581E-5 41170 0 7.10854E-4
17-73917379-A-G p.Pro525Pro synonymous FBF1 1 82338 1.21451E-5 41169 0 NA
17-73917556-T-A p.Thr523Ser missense FBF1 3 81868 3.66444E-5 40934 0 NA
17-73917561-G-A p.Ser521Leu missense FBF1 1 81858 1.22163E-5 40929 0 3.18532E-5
17-73917568-C-T p.Asp519Asn missense FBF1 1 81794 1.22258E-5 40897 0 1.03485E-5
17-73917575-G-A p.Ala516Ala synonymous FBF1 1 81818 1.22222E-5 40909 0 NA
17-73917580-T-C p.Thr515Ala missense FBF1 4 81776 4.89141E-5 40888 0 3.18573E-5
17-73917582-C-T p.Gly514Glu missense FBF1 1 81794 1.22258E-5 40897 0 4.07628E-6
17-73917582-C-G p.Gly514Ala missense FBF1 1 81794 1.22258E-5 40897 0 9.97825E-6
17-73917583-C-T p.Gly514Arg missense FBF1 1 81794 1.22258E-5 40897 0 5.03525E-4
17-73917611-T-C p.Ser504Ser synonymous FBF1 1 81614 1.22528E-5 40807 0 6.3743E-5
17-73917631-T-G p.Ter150Cysext*? stop_lost FBF1 5 81258 6.15324E-5 40629 0 0.00100806
17-73917644-G-A c.1482-3C>T splice_region FBF1 1 80872 1.23652E-5 40436 0 4.14563E-6
17-73917646-G-T c.1482-5C>A splice_region FBF1 1 80812 1.23744E-5 40406 0 4.1531E-6
17-73917647-G-A c.1482-6C>T splice_region FBF1 19 80776 2.35218E-4 40388 1 2.23115E-4
17-73918028-C-T p.Arg146Gln missense+splice_region FBF1 5 81620 6.12595E-5 40810 0 6.25E-4
17-73918029-G-A p.Ser493Leu missense FBF1 2 81582 2.45152E-5 40791 0 4.59812E-5
17-73918041-C-T p.Arg489Lys missense FBF1 1 81796 1.22255E-5 40898 0 NA
17-73918049-C-T p.Arg139His missense FBF1 3 81872 3.66426E-5 40936 0 4.55E-5
17-73918050-G-A p.Pro486Leu missense FBF1 3 81882 3.66381E-5 40941 0 3.18715E-5
17-73918060-G-A p.Arg483* stop_gained FBF1 1 82016 1.21927E-5 41008 0 6.37267E-5
17-73918069-T-G p.Thr480Pro missense FBF1 4 82054 4.87484E-5 41027 0 6.37511E-5
17-73918072-C-T p.Gly479Arg missense FBF1 294 82060 0.00358274 41030 3 0.0131894
17-73918077-C-T p.Ser477Asn missense FBF1 1 82072 1.21844E-5 41036 0 4.50613E-5
17-73918084-C-T p.Gly475Arg missense FBF1 1 82108 1.21791E-5 41054 0 NA
17-73918085-A-G p.Leu127Pro missense FBF1 1 82122 1.2177E-5 41061 0 6.32311E-6
17-73918093-C-T p.Ala472Thr missense FBF1 7 82156 8.52038E-5 41078 0 3.18593E-5
17-73918142-C-T p.Arg108His missense FBF1 1 82132 1.21755E-5 41066 0 1.89494E-5
17-73918143-G-A p.Arg108Cys missense FBF1 4 82154 4.8689E-5 41077 0 3.18735E-5
17-73918149-G-T p.Leu106Ile missense FBF1 16 82060 1.94979E-4 41030 0 0.00125
17-73918151-T-C p.His105Arg missense FBF1 44 82026 5.36415E-4 41013 1 8.58451E-4
17-73918153-A-G p.Leu104Leu synonymous FBF1 1 82000 1.21951E-5 41000 0 NA
17-73918156-G-A p.His103His synonymous FBF1 11 81964 1.34205E-4 40982 0 9.55901E-5
17-73918171-G-A p.Thr98Thr synonymous FBF1 3 81606 3.6762E-5 40803 0 6.37511E-5
17-73918172-G-A p.Thr98Ile missense FBF1 1 81554 1.22618E-5 40777 0 NA
17-73918177-G-C p.Ser96Arg missense+splice_region FBF1 4 81378 4.91533E-5 40689 0 NA
17-73918181-G-C c.288-4C>G splice_region FBF1 3 81280 3.69094E-5 40640 0 NA
17-73919264-T-C c.1379+3A>G splice_region FBF1 1 80570 1.24116E-5 40285 0 1.56382E-5
17-73919269-G-C p.Gly459Gly splice_region+synonymous FBF1 1 80760 1.23824E-5 40380 0 NA
17-73919282-T-C p.His455Arg missense FBF1 1 81154 1.23223E-5 40577 0 1.95053E-5
17-73919285-C-A p.Gly454Val missense FBF1 474 81196 0.00583773 40598 5 0.0103802
17-73919287-C-T p.Ala453Ala synonymous FBF1 6 81216 7.38771E-5 40608 0 2.9656E-4
17-73919288-G-A p.Ala453Val missense FBF1 2 81244 2.46172E-5 40622 0 6.46329E-5
17-73919296-C-T p.Ala450Ala synonymous FBF1 1 81426 1.22811E-5 40713 0 1.16306E-4
17-73919297-G-A p.Ala450Val missense FBF1 12 81446 1.47337E-4 40723 0 5.79643E-4
17-73919303-T-C p.His448Arg missense FBF1 44 81542 5.39599E-4 40771 0 5.71118E-4
17-73919307-G-C p.Leu447Val missense FBF1 1 81534 1.22648E-5 40767 0 5.14259E-5
17-73919313-C-CA p.Glu445fs frameshift FBF1 1 81562 1.22606E-5 40781 0 NA
17-73919313-C-T p.Glu445Lys missense FBF1 1 81562 1.22606E-5 40781 0 NA
17-73919319-T-TC p.Thr443fs frameshift FBF1 1 81466 1.22751E-5 40733 0 NA
17-73919336-C-T p.Arg437Lys missense FBF1 1 81460 1.2276E-5 40730 0 1.44603E-5
17-73919360-C-T p.Arg429Gln missense FBF1 3 81324 3.68895E-5 40662 0 6.93289E-5
17-73919361-G-A p.Arg429Trp missense FBF1 4 81332 4.91811E-5 40666 0 1.59905E-4
17-73919371-A-G p.His425His synonymous FBF1 2 81334 2.459E-5 40667 0 3.1841E-5
17-73919382-A-T p.Trp422Arg missense FBF1 2 81360 2.45821E-5 40680 0 6.3678E-5
17-73919408-C-T p.Arg413Gln missense FBF1 1 81472 1.22742E-5 40736 0 2.22954E-5
17-73919429-G-A p.Ala406Val missense FBF1 1 81506 1.2269E-5 40753 0 6.3678E-5
17-73919430-C-T p.Ala406Thr missense FBF1 4 81516 4.90701E-5 40758 0 1.73388E-5
17-73919440-G-A p.Ser402Ser synonymous FBF1 10 81496 1.22705E-4 40748 0 1.91095E-4
17-73919444-C-T p.Gly401Glu missense FBF1 1 81520 1.22669E-5 40760 0 NA
17-73919458-T-C p.Pro396Pro synonymous FBF1 1 81590 1.22564E-5 40795 0 NA
17-73919461-T-C p.Pro395Pro synonymous FBF1 1 81606 1.2254E-5 40803 0 NA
17-73919476-G-C p.Pro390Pro synonymous FBF1 3 81644 3.67449E-5 40822 0 3.18329E-5
17-73919476-G-A p.Pro390Pro synonymous FBF1 5 81644 6.12415E-5 40822 0 2.58588E-4
17-73919477-G-T p.Pro390His missense FBF1 3 81662 3.67368E-5 40831 0 6.36699E-5
17-73919477-G-C p.Pro390Arg missense FBF1 1 81662 1.22456E-5 40831 0 3.1835E-5
17-73919478-G-T p.Pro390Thr missense FBF1 2 81656 2.4493E-5 40828 0 NA
17-73919494-C-T p.Thr384Thr synonymous FBF1 299 81648 0.00366206 40824 3 0.00799669
17-73919509-C-T p.Ala379Ala synonymous FBF1 2 81704 2.44786E-5 40852 0 1.26901E-5
17-73919510-G-T p.Ala379Glu missense FBF1 10 81668 1.22447E-4 40834 0 4.45803E-4
17-73919512-A-G p.Pro378Pro synonymous FBF1 1 81708 1.22387E-5 40854 0 NA
17-73919519-G-C p.Pro376Arg missense FBF1 4 81738 4.89368E-5 40869 0 5.05051E-4
17-73919521-C-T p.Val375Val synonymous FBF1 4258 81642 0.0521545 40821 163 0.105
17-73919528-G-A p.Pro373Leu missense FBF1 4 81760 4.89237E-5 40880 0 1.27348E-4
17-73919530-C-T p.Thr372Thr synonymous FBF1 1 81738 1.22342E-5 40869 0 0.00151668
17-73919530-C-A p.Thr372Thr synonymous FBF1 2 81738 2.44684E-5 40869 0 4.199E-6
17-73919531-G-A p.Thr372Met missense FBF1 6 81768 7.33783E-5 40884 0 6.25E-4
17-73919538-G-A p.Pro370Ser missense FBF1 7843 81664 0.0960399 40832 527 0.165
17-73919545-A-T p.Ser367Arg missense FBF1 2 81794 2.44517E-5 40897 0 1.59297E-4
17-73919552-C-T p.Arg365Gln missense FBF1 6 81758 7.33873E-5 40879 0 6.25E-4
17-73919553-G-A p.Arg365Trp missense FBF1 8 81748 9.78617E-5 40874 0 2.11829E-4
17-73919553-G-C p.Arg365Gly missense FBF1 3 81746 3.6699E-5 40873 0 2.35366E-5
17-73919565-T-C p.Arg361Gly missense FBF1 1 81768 1.22297E-5 40884 0 3.1841E-5
17-73919566-G-A p.Thr360Thr synonymous FBF1 1 81772 1.22291E-5 40886 0 3.57041E-5
17-73919570-G-C p.Pro359Arg missense FBF1 1 81760 1.22309E-5 40880 0 NA
17-73919577-C-G p.Ala357Pro missense FBF1 1 81752 1.22321E-5 40876 0 NA
17-73919599-G-A p.Asp349Asp synonymous FBF1 8 81726 9.78881E-5 40863 0 6.37024E-5
17-73919614-C-A p.Trp344Cys missense FBF1 2 81728 2.44714E-5 40864 0 4.29623E-6
17-73919619-C-A p.Asp343Tyr missense FBF1 1 81734 1.22348E-5 40867 0 4.27274E-6
17-73919621-G-A p.Ala342Val missense FBF1 1 81720 1.22369E-5 40860 0 NA
17-73919623-T-A p.Gly341Gly synonymous FBF1 492 81694 0.00602247 40847 11 0.0134094
17-73919628-C-T p.Gly340Arg missense FBF1 1 81762 1.22306E-5 40881 0 4.2193E-6
17-73919657-A-T p.Met330Lys missense FBF1 1 81716 1.22375E-5 40858 0 4.12606E-6
17-73919658-T-A p.Met330Leu missense FBF1 2 81718 2.44744E-5 40859 0 NA
17-73919662-A-G p.Pro328Pro synonymous FBF1 1 81690 1.22414E-5 40845 0 3.18593E-5
17-73919669-T-C p.Gln326Arg missense FBF1 1 81616 1.22525E-5 40808 0 NA
17-73919675-G-A p.Ser324Phe missense FBF1 1 81496 1.22705E-5 40748 0 4.12844E-6
17-73919681-G-A p.Pro322Leu missense FBF1 1 81386 1.22871E-5 40693 0 NA
17-73919685-C-T p.Glu321Lys missense FBF1 1 81328 1.22959E-5 40664 0 3.18431E-5
17-73919691-T-C p.Lys319Glu missense FBF1 1 81246 1.23083E-5 40623 0 1.28986E-5
17-73919699-G-C p.Ala316Gly missense FBF1 1 80946 1.23539E-5 40473 0 NA
17-73919700-C-T p.Ala316Thr missense FBF1 1 80876 1.23646E-5 40438 0 1.39194E-5
17-73919701-G-A p.Gly315Gly synonymous FBF1 1 80822 1.23729E-5 40411 0 4.33288E-5
17-73919708-T-G p.Asp313Ala missense FBF1 1 80682 1.23943E-5 40341 0 1.51144E-5
17-73919709-C-G p.Asp313His missense FBF1 1 80706 1.23907E-5 40353 0 1.54212E-5
17-73919712-C-T p.Ala312Thr missense FBF1 3 80514 3.72606E-5 40257 0 6.37105E-5
17-73919712-C-G p.Ala312Pro missense FBF1 2 80514 2.48404E-5 40257 0 6.36862E-5
17-73919719-C-A p.Arg309Ser missense+splice_region FBF1 147 80330 0.00182995 40165 1 0.00170984
17-73919719-C-T p.Arg309Arg splice_region+synonymous FBF1 2 80334 2.48961E-5 40167 0 3.18573E-5
17-73919730-A-G c.927-8T>C splice_region FBF1 4 80028 4.99825E-5 40014 0 6.05987E-4
17-73921424-T-C c.926+4A>G splice_region FBF1 11 82162 1.33882E-4 41081 0 6.26566E-4
17-73921440-C-T p.Arg305Gln missense FBF1 70 82284 8.50712E-4 41142 0 0.00433149
17-73921441-G-A p.Arg305Trp missense FBF1 3 82302 3.64511E-5 41151 0 8.63006E-5
17-73921443-C-T p.Arg304His missense FBF1 123 82304 0.00149446 41152 0 0.0012422
17-73921444-G-A p.Arg304Cys missense FBF1 3 82322 3.64423E-5 41161 0 2.42303E-5
17-73921446-G-C p.Ser303Cys missense FBF1 1 82318 1.2148E-5 41159 0 3.18492E-5
17-73921449-T-G p.Gln302Pro missense FBF1 1 82338 1.21451E-5 41169 0 4.03639E-5
17-73921452-C-T p.Arg301Gln missense FBF1 1 82346 1.21439E-5 41173 0 6.25E-4
17-73921453-G-A p.Arg301Trp missense FBF1 2 82336 2.42907E-5 41168 0 6.25E-4
17-73921468-C-A p.Val296Phe missense FBF1 4 82400 4.85437E-5 41200 0 0.00125
17-73921472-A-G p.Thr294Thr synonymous FBF1 1 82402 1.21356E-5 41201 0 NA
17-73921478-C-A p.Gln292His missense FBF1 2 82402 2.42713E-5 41201 0 NA
17-73921484-G-A p.Ala290Ala synonymous FBF1 15 82426 1.81981E-4 41213 0 1.00756E-4
17-73921487-T-A p.Gly289Gly synonymous FBF1 1 82426 1.21321E-5 41213 0 NA
17-73921488-C-G p.Gly289Ala missense FBF1 2 82420 2.4266E-5 41210 0 NA
17-73921494-G-C p.Thr287Ser missense FBF1 1 82420 1.2133E-5 41210 0 NA
17-73921504-C-T p.Glu284Lys missense FBF1 2 82394 2.42736E-5 41197 0 8.77378E-6
17-73921505-G-A p.Asp283Asp synonymous FBF1 2 82394 2.42736E-5 41197 0 0.00100806
17-73921509-C-T p.Gly282Asp missense FBF1 3 82406 3.64051E-5 41203 0 3.18512E-5
17-73921515-A-G p.Met280Thr missense FBF1 1 82410 1.21345E-5 41205 0 NA
17-73921519-C-T p.Asp279Asn missense FBF1 1 82388 1.21377E-5 41194 0 NA
17-73921523-A-G p.Ser277Ser synonymous FBF1 2 82382 2.42771E-5 41191 0 NA
17-73921525-T-A p.Ser277Cys missense+splice_region FBF1 1 82376 1.21395E-5 41188 0 NA
17-73922101-GCCT-G c.826+7_826+9delAGG splice_region FBF1 3 80114 3.74466E-5 40057 0 5.74306E-5
17-73922103-C-T c.826+8G>A splice_region FBF1 2 80258 2.49196E-5 40129 0 NA
17-73922113-T-C p.Gln275Arg missense+splice_region FBF1 1 80594 1.24079E-5 40297 0 NA
17-73922115-T-C p.Pro274Pro synonymous FBF1 3 80662 3.71922E-5 40331 0 NA
17-73922116-G-C p.Pro274Arg missense FBF1 2 80684 2.47881E-5 40342 0 NA
17-73922138-G-A p.Leu267Leu synonymous FBF1 2 81330 2.45912E-5 40665 0 6.29723E-4
17-73922157-C-A p.Gly260Gly synonymous FBF1 16 81726 1.95776E-4 40863 0 6.27353E-4
17-73922160-G-A p.Thr259Thr synonymous FBF1 1 81782 1.22276E-5 40891 0 3.68507E-5
17-73922161-G-C p.Thr259Ser missense FBF1 1 81812 1.22231E-5 40906 0 3.18593E-5
17-73922166-C-T p.Pro257Pro synonymous FBF1 4 81818 4.8889E-5 40909 0 1.21468E-4
17-73922167-G-C p.Pro257Arg missense FBF1 30 81858 3.66488E-4 40929 0 0.0020141
17-73922167-G-A p.Pro257Leu missense FBF1 4 81858 4.88651E-5 40929 0 4.70049E-5
17-73922169-G-C p.Arg256Arg synonymous FBF1 2 81832 2.44403E-5 40916 0 NA
17-73922170-C-T p.Arg256His missense FBF1 8 81854 9.7735E-5 40927 0 6.25782E-4
17-73922179-A-C p.Leu253Arg missense FBF1 1 81878 1.22133E-5 40939 0 3.18634E-5
17-73922186-T-C p.Thr251Ala missense FBF1 2 81904 2.44188E-5 40952 0 3.18613E-5
17-73922197-C-T p.Arg247Gln missense FBF1 46 81906 5.61619E-4 40953 0 0.00105129
17-73922200-C-G p.Gly246Ala missense FBF1 2 81916 2.44153E-5 40958 0 NA
17-73922202-C-T p.Leu245Leu synonymous FBF1 8 81944 9.76276E-5 40972 0 9.84717E-5
17-73922207-G-C p.Leu244Val missense FBF1 1 81964 1.22005E-5 40982 0 NA
17-73922212-T-G p.Asp242Ala missense FBF1 2 81950 2.44051E-5 40975 0 0.00100806
17-73922212-T-A p.Asp242Val missense FBF1 10 81950 1.22026E-4 40975 0 7.45762E-5
17-73922217-C-T p.Thr240Thr synonymous FBF1 8 81940 9.76324E-5 40970 0 1.91156E-4
17-73922218-G-A p.Thr240Met missense FBF1 1 81982 1.21978E-5 40991 0 4.03779E-5
17-73922219-T-C p.Thr240Ala missense FBF1 2 81984 2.4395E-5 40992 0 NA
17-73922221-G-A p.Ser239Phe missense FBF1 99 81968 0.00120779 40984 0 0.00254874
17-73922224-C-T p.Arg238His missense FBF1 5 81888 6.1059E-5 40944 0 6.37105E-5
17-73922233-C-T p.Arg235His missense FBF1 2 81884 2.44248E-5 40942 0 0.00125
17-73922238-C-T p.Gly233Gly synonymous FBF1 1 81970 1.21996E-5 40985 0 NA
17-73922243-CCCTGCAGGACGGGACACACGGCAGGAACGTGTAGGTATGAGGGGCTCTCGGGAATCCCACAGTACCCGTCCACCAGCTTTTCCCTGAACCTGAGGCAGCAGCCTGGCCTACTCAGGGATCCTTA-C p.Glu232fs frameshift FBF1 2 82108 2.43582E-5 41054 0 NA
17-73922248-C-T c.693-4G>A splice_region FBF1 2 82078 2.43671E-5 41039 0 NA
17-73922378-A-G p.Ile228Thr missense FBF1 2 82438 2.42607E-5 41219 0 3.18593E-5
17-73922384-C-G p.Arg226Thr missense FBF1 1 82484 1.21236E-5 41242 0 NA
17-73922401-G-A p.Ser220Ser synonymous FBF1 1 82540 1.21153E-5 41270 0 NA
17-73922435-T-A p.Asp209Val missense FBF1 4 82586 4.84344E-5 41293 0 2.0896E-5
17-73922441-T-G p.Asp207Ala missense FBF1 1 82596 1.21071E-5 41298 0 NA
17-73922441-T-C p.Asp207Gly missense FBF1 3 82596 3.63214E-5 41298 0 NA
17-73922451-A-G p.Leu204Leu synonymous FBF1 1 82564 1.21118E-5 41282 0 NA
17-73922454-A-C p.Leu203Val missense FBF1 2 82564 2.42236E-5 41282 0 NA
17-73922468-C-T p.Arg198Gln missense FBF1 6 82468 7.27555E-5 41234 0 1.60772E-4
17-73922487-G-T p.Pro192Thr missense FBF1 2 82340 2.42895E-5 41170 0 0.00187735
17-73922489-G-C p.Thr191Ser missense FBF1 3 82344 3.64325E-5 41172 0 9.55718E-5
17-73922501-G-C p.Ser187Cys missense FBF1 1 82232 1.21607E-5 41116 0 NA
17-73922509-T-TTGATCTCTCACTGTGCTGGGGCTCTTGTCA c.554-3_554-2insTGACAAGAGCCCCAGCACAGTGAGAGATCA splice_region FBF1 2 82046 2.43766E-5 41023 1 NA
17-73922509-T-C c.554-2A>G splice_acceptor FBF1 1 82046 1.21883E-5 41023 0 NA
17-73922837-A-G c.553+2T>C splice_donor FBF1 1 82718 1.20893E-5 41359 0 NA
17-73922845-C-G p.Asp183His missense FBF1 2 82754 2.4168E-5 41377 0 3.18431E-5
17-73922845-C-T p.Asp183Asn missense FBF1 1 82754 1.2084E-5 41377 0 1.00018E-5
17-73922858-G-C p.Pro178Pro synonymous FBF1 7 82774 8.45676E-5 41387 0 4.02709E-5
17-73922868-T-C p.Asp175Gly missense FBF1 1 82798 1.20776E-5 41399 0 NA
17-73922895-G-A p.Pro166Leu missense FBF1 2 82802 2.4154E-5 41401 0 4.02382E-6
17-73922897-C-T p.Pro165Pro synonymous FBF1 2 82800 2.41546E-5 41400 0 4.39174E-5
17-73922898-G-A p.Pro165Leu missense FBF1 1 82796 1.20779E-5 41398 0 1.75784E-5
17-73922899-G-A p.Pro165Ser missense FBF1 1 82798 1.20776E-5 41399 0 2.63801E-5
17-73922906-G-A p.Thr162Thr synonymous FBF1 4 82780 4.83208E-5 41390 0 3.62634E-5
17-73922908-T-C p.Thr162Ala missense FBF1 3 82778 3.62415E-5 41389 0 NA
17-73922916-C-T p.Gly159Glu missense FBF1 1 82772 1.20814E-5 41386 0 NA
17-73922929-A-G p.Ser155Pro missense FBF1 11 82764 1.32908E-4 41382 0 6.25E-4
17-73922933-A-G p.Leu153Leu synonymous FBF1 1 82762 1.20828E-5 41381 0 3.18593E-5
17-73922936-T-A p.Gly152Gly synonymous FBF1 4 82754 4.8336E-5 41377 0 NA
17-73922941-T-C p.Arg151Gly missense FBF1 33774 82244 0.410656 41122 7716 0.507049
17-73922946-G-A p.Pro149Leu missense FBF1 1 82726 1.20881E-5 41363 0 NA
17-73922948-G-A p.Asp148Asp synonymous FBF1 69 82722 8.34119E-4 41361 0 3.86329E-4
17-73923530-T-C c.433+6A>G splice_region FBF1 1 82320 1.21477E-5 41160 0 NA
17-73923535-C-A c.433+1G>T splice_donor FBF1 1 82350 1.21433E-5 41175 0 NA
17-73923575-T-G p.Ser132Arg missense FBF1 1 82560 1.21124E-5 41280 0 NA
17-73923579-AGACGGAAGT-A p.Leu128_Ser130del disruptive_inframe_deletion FBF1 27 82546 3.2709E-4 41273 0 0.00143385
17-73923582-C-T p.Pro129Pro synonymous FBF1 7 82540 8.48074E-5 41270 0 1.91156E-4
17-73923583-G-A p.Pro129Leu missense FBF1 8 82542 9.69204E-5 41271 0 1.23649E-4
17-73923584-G-C p.Pro129Ala missense FBF1 1 82542 1.2115E-5 41271 0 3.18715E-5
17-73923610-C-A p.Gly120Val missense FBF1 1 82422 1.21327E-5 41211 0 3.75404E-5
17-73923613-C-T p.Gly119Glu missense+splice_region FBF1 18 82396 2.18457E-4 41198 0 0.00100806
17-73923616-G-A c.356-3C>T splice_region FBF1 6 82350 7.28597E-5 41175 0 1.93783E-5
17-73923620-G-GCTTGGGGTGGTTGGGC c.356-8_356-7insGCCCAACCACCCCAAG splice_region FBF1 2 82300 2.43013E-5 41150 1 NA
17-73924167-G-T p.Pro115Pro synonymous FBF1 13 82434 1.57702E-4 41217 0 1.66631E-5
17-73924197-G-A p.Asp105Asp synonymous FBF1 1 82512 1.21194E-5 41256 0 NA
17-73924216-C-A p.Ser99Ile missense FBF1 2 82516 2.42377E-5 41258 0 NA
17-73924226-A-G p.Ser96Pro missense FBF1 1 82510 1.21197E-5 41255 0 2.49E-5
17-73924263-G-A p.Gly83Gly synonymous FBF1 2 82470 2.42512E-5 41235 0 6.05173E-4
17-73924265-C-T p.Gly83Ser missense FBF1 2 82472 2.42507E-5 41236 0 1.20462E-4
17-73924265-C-G p.Gly83Arg missense FBF1 3 82472 3.6376E-5 41236 0 3.18512E-5
17-73924272-G-A p.Asp80Asp splice_region+synonymous FBF1 1 82448 1.21289E-5 41224 0 NA
17-73926086-C-T p.Ala77Thr missense FBF1 10 80292 1.24545E-4 40146 0 5.4814E-4
17-73926101-G-T p.Gln72Lys missense FBF1 2 80592 2.48164E-5 40296 0 NA
17-73926102-T-C p.Pro71Pro synonymous FBF1 3 80610 3.72162E-5 40305 0 NA
17-73926119-T-C p.Ile66Val missense FBF1 2 80758 2.47653E-5 40379 0 3.5868E-5
17-73926121-C-A p.Gly65Val missense FBF1 15864 79242 0.200197 39621 1447 0.255065
17-73926123-T-A p.Ser64Ser synonymous FBF1 39 80750 4.82972E-4 40375 0 0.00373533
17-73926133-GT-G c.187-6delA splice_region FBF1 1 80734 1.23864E-5 40367 0 NA
17-73926134-T-A c.187-6A>T splice_region FBF1 1 80712 1.23897E-5 40356 0 NA
17-73927302-A-G c.186+8T>C splice_region FBF1 1 80678 1.2395E-5 40339 0 NA
17-73927303-G-A c.186+7C>T splice_region FBF1 1 80678 1.2395E-5 40339 0 5.47999E-6
17-73927304-G-A c.186+6C>T splice_region FBF1 2 80638 2.48022E-5 40319 0 1.80349E-4
17-73927321-C-T p.Ala59Thr missense FBF1 2 80468 2.48546E-5 40234 0 2.36375E-4
17-73927339-T-C p.Met53Val missense FBF1 2 79940 2.50188E-5 39970 0 NA
17-73927341-G-A p.Thr52Ile missense FBF1 7 79866 8.76468E-5 39933 0 9.55718E-5
17-73927346-G-A p.Phe50Phe synonymous FBF1 1 79656 1.2554E-5 39828 0 9.92536E-6
17-73927351-C-A p.Val49Phe missense FBF1 2 79318 2.5215E-5 39659 0 NA
17-73927355-A-G p.Asp47Asp synonymous FBF1 153 79010 0.00193646 39505 1 0.00439911
17-73927359-C-T p.Gly46Asp missense FBF1 4 78788 5.07692E-5 39394 0 9.56084E-5
17-73927373-G-C c.126-3C>G splice_region FBF1 2 77058 2.59545E-5 38529 0 NA
17-73929070-C-T c.125+6G>A splice_region FBF1 1 82042 1.21889E-5 41021 0 1.62082E-5
17-73929084-C-G p.Ala39Ala synonymous FBF1 1 82138 1.21746E-5 41069 0 NA
17-73929084-C-T p.Ala39Ala synonymous FBF1 1 82138 1.21746E-5 41069 0 2.82381E-5
17-73929085-G-A p.Ala39Val missense FBF1 4 82142 4.86962E-5 41071 0 1.006E-4
17-73929086-C-T p.Ala39Thr missense FBF1 2 82166 2.4341E-5 41083 1 NA
17-73929104-T-A p.Met33Leu missense FBF1 1 82302 1.21504E-5 41151 0 7.90958E-5
17-73929118-G-A p.Thr28Ile missense FBF1 77 82362 9.34897E-4 41181 0 0.00219927
17-73929131-T-TA p.Thr24fs frameshift FBF1 4 82362 4.85661E-5 41181 0 1.60805E-5
17-73929135-T-A p.Ser22Ser synonymous FBF1 1 82352 1.2143E-5 41176 0 8.88273E-6
17-73929161-G-A p.Pro14Ser missense FBF1 181 82130 0.00220382 41065 2 0.00412693
17-73929165-T-C p.Thr12Thr synonymous FBF1 4 82026 4.8765E-5 41013 0 2.84102E-5
17-73931715-T-C p.Asp23Gly missense+splice_region FBF1 1 78500 1.27389E-5 39250 0 1.4308E-5
17-73931723-TAGA-T p.Leu20del disruptive_inframe_deletion FBF1 1 78518 1.27359E-5 39259 0 5.71886E-5
17-73931728-G-A p.Leu19Phe missense FBF1 5 78550 6.36537E-5 39275 0 5.71086E-5
17-73931729-G-A p.Asp18Asp synonymous FBF1 3 78542 3.81961E-5 39271 0 NA
17-73931731-C-A p.Asp18Tyr missense FBF1 1 78546 1.27314E-5 39273 0 NA
17-73931743-C-A p.Asp14Tyr missense FBF1 349 78542 0.00444348 39271 0 0.00313451
17-73933655-C-T p.Gly8Glu missense FBF1 2 82546 2.42289E-5 41273 0 9.55536E-5
17-73933669-T-C p.Pro3Pro synonymous FBF1 1 82528 1.21171E-5 41264 0 NA
17-73933671-G-C p.Pro3Ala missense FBF1 1 82534 1.21162E-5 41267 0 NA
17-73933672-T-C p.Ala2Ala splice_region+synonymous FBF1 1 82536 1.21159E-5 41268 0 4.01403E-6
17-73933681-T-C c.4-7A>G splice_region FBF1 33 82500 4.0E-4 41250 0 0.004375
17-73933795-C-T c.*283G>A splice_region FBF1 1 78664 1.27123E-5 39332 0 NA
17-73934081-A-G p.His50His synonymous FBF1 2 79352 2.52042E-5 39676 0 2.24635E-5
17-73934084-C-T p.Trp49* stop_gained FBF1 2 79548 2.51421E-5 39774 0 NA
17-73934097-C-T p.Ser45Asn missense FBF1 428 80596 0.00531044 40298 4 0.00821168
17-73934099-C-T p.Lys44Lys synonymous FBF1 9 80742 1.11466E-4 40371 0 1.91144E-4
17-73934104-C-T p.Glu43Lys missense FBF1 1 80812 1.23744E-5 40406 0 6.28117E-6
17-73934120-G-A p.Thr37Thr synonymous FBF1 1 81248 1.2308E-5 40624 0 4.08864E-5
17-73934122-T-C p.Thr37Ala missense FBF1 1 81186 1.23174E-5 40593 0 3.18492E-5
17-73934129-C-T p.Ala34Ala synonymous FBF1 2 81244 2.46172E-5 40622 0 6.92713E-5
17-73934130-G-A p.Ala34Val missense FBF1 16030 79716 0.201089 39858 1465 0.291782
17-73934133-C-G p.Trp33Ser missense FBF1 1 81276 1.23038E-5 40638 0 2.32148E-5
17-73934135-G-A p.Gly32Gly synonymous FBF1 2 81294 2.46021E-5 40647 0 5.0551E-6
17-73934136-C-T p.Gly32Asp missense FBF1 2 81294 2.46021E-5 40647 0 NA
17-73934136-C-A p.Gly32Val missense FBF1 1 81294 1.2301E-5 40647 0 1.50713E-5
17-73934140-C-T p.Gly31Arg missense FBF1 2 81358 2.45827E-5 40679 0 3.18715E-5
17-73934140-CAG-C p.Ser30fs frameshift FBF1 1 81356 1.22917E-5 40678 0 NA
17-73934145-T-C p.His29Arg missense FBF1 1 81362 1.22908E-5 40681 0 4.7357E-6
17-73934148-T-G p.Gln28Pro missense FBF1 2 81408 2.45676E-5 40704 0 NA
17-73934152-TGCA-T p.Cys26del conservative_inframe_deletion FBF1 2 81456 2.45531E-5 40728 0 1.88345E-5
17-73934155-A-T p.Cys26Ser missense FBF1 1 81472 1.22742E-5 40736 0 NA
17-73934156-G-C p.Asp25Glu missense FBF1 1 81480 1.2273E-5 40740 0 NA
17-73934167-TG-CT p.ProLys21ProGlu missense FBF1 2 81580 2.45158E-5 40790 0 NA
17-73934177-G-T p.Ser18Ser synonymous FBF1 2 81712 2.44762E-5 40856 0 1.28028E-5
17-73934181-G-A p.Pro17Leu missense FBF1 1 81792 1.22261E-5 40896 0 4.1029E-6
17-73934185-G-A p.Leu16Phe missense FBF1 2 81848 2.44355E-5 40924 0 1.93278E-4
17-73934193-C-T p.Arg13Gln missense FBF1 3 81994 3.6588E-5 40997 0 4.05541E-6
17-73934202-T-C p.His10Arg missense FBF1 2 82240 2.43191E-5 41120 0 NA
17-73934209-T-TA p.Lys8fs frameshift FBF1 1 82398 1.21362E-5 41199 0 1.82939E-5
17-73934213-C-T p.Gln6Gln synonymous FBF1 1 82440 1.213E-5 41220 0 1.20762E-5
17-73934235-C-T c.-5G>A 5_prime_UTR_premature_start_codon_gain FBF1 4251 82408 0.0515848 41204 162 0.095625
17-73934236-G-A c.-6C>T 5_prime_UTR_premature_start_codon_gain FBF1 4 82572 4.84426E-5 41286 0 1.59449E-4
17-73934243-G-A c.-13C>T 5_prime_UTR_premature_start_codon_gain FBF1 2 82510 2.42395E-5 41255 0 3.18939E-5
17-73934277-G-A c.-47C>T 5_prime_UTR_premature_start_codon_gain FBF1 1 82004 1.21945E-5 41002 0 NA
17-73936668-C-T n.462+8G>A splice_region FBF1 1 33704 2.96701E-5 16852 0 NA
17-73936947-T-A c.-102A>T 5_prime_UTR_premature_start_codon_gain FBF1 1 43546 2.29642E-5 21773 0 NA
17-73937007-C-A c.-162G>T 5_prime_UTR_premature_start_codon_gain FBF1 1 39714 2.518E-5 19857 0 NA
17-73937038-G-T c.-193C>A 5_prime_UTR_premature_start_codon_gain FBF1 1 32556 3.07163E-5 16278 0 NA
17-73937082-T-A c.-237A>T 5_prime_UTR_premature_start_codon_gain FBF1 1 20354 4.91304E-5 10177 0 1.59408E-4