Variant

Variant ID Consequence Effect Gene AC AN AF NS NHOM maxEAF
9-116150581-C-T p.Ter314Ter stop_retained ALAD 1 82554 1.21133E-5 41277 0 1.64766E-5
9-116150583-T-C p.Glu313Glu synonymous ALAD 1 82516 1.21189E-5 41258 0 1.19692E-5
9-116150610-C-T p.Pro304Pro synonymous ALAD 6 82406 7.28102E-5 41203 0 9.59762E-5
9-116150613-T-C p.Thr303Thr synonymous ALAD 7 82420 8.49308E-5 41210 0 1.59307E-4
9-116150614-G-A p.Thr303Ile missense ALAD 3 82398 3.64087E-5 41199 0 3.18532E-5
9-116150621-A-G p.Tyr301His missense ALAD 2 82364 2.42825E-5 41182 0 NA
9-116150633-T-C p.Ile297Val missense ALAD 10 82206 1.21646E-4 41103 0 3.36649E-4
9-116150649-G-T c.881-8C>A splice_region ALAD 1 82136 1.21749E-5 41068 0 3.18654E-5
9-116151251-G-A c.880+6C>T splice_region ALAD 2 82644 2.42002E-5 41322 0 3.99131E-6
9-116151264-G-C p.Arg291Arg synonymous ALAD 1 82650 1.20992E-5 41325 0 NA
9-116151266-G-A p.Arg291Cys missense ALAD 1 82660 1.20978E-5 41330 0 2.50627E-5
9-116151277-A-G p.Met287Thr missense ALAD 7 82622 8.47232E-5 41311 0 3.18451E-4
9-116151287-G-A p.Leu284Leu synonymous ALAD 7 82518 8.483E-5 41259 0 1.66909E-5
9-116151311-C-A p.Ala276Ser missense ALAD 1 82176 1.2169E-5 41088 0 6.36943E-5
9-116151314-C-T p.Gly275Arg missense ALAD 19 82124 2.31357E-4 41062 0 5.03525E-4
9-116151315-G-A p.Ala274Ala synonymous ALAD 5 82064 6.09281E-5 41032 0 0.00151057
9-116151318-C-T p.Gln273Gln synonymous ALAD 1 82048 1.2188E-5 41024 0 5.00434E-5
9-116151324-T-C p.Gly271Gly synonymous ALAD 1 82008 1.21939E-5 41004 0 NA
9-116151325-C-T p.Gly271Glu missense ALAD 4 81994 4.87841E-5 40997 0 NA
9-116151327-A-G p.His270His synonymous ALAD 1 81986 1.21972E-5 40993 0 NA
9-116151335-G-A p.Leu268Leu synonymous ALAD 48 81866 5.86324E-4 40933 0 0.00121035
9-116151342-A-G p.Phe265Phe synonymous ALAD 2 81782 2.44553E-5 40891 0 NA
9-116151368-C-T p.Ala257Thr missense ALAD 1 80902 1.23606E-5 40451 0 3.99463E-6
9-116151369-G-A p.Leu256Leu synonymous ALAD 1 80962 1.23515E-5 40481 0 3.18431E-5
9-116151379-T-A p.Asp253Val missense ALAD 1 80648 1.23996E-5 40324 0 4.20359E-5
9-116151722-T-C p.Asp249Gly missense ALAD 1 82834 1.20723E-5 41417 0 1.65423E-5
9-116151735-G-A p.Arg245Trp missense ALAD 2 83064 2.40778E-5 41532 0 9.55536E-5
9-116151739-G-T p.Ile243Ile synonymous ALAD 1 83148 1.20267E-5 41574 0 3.57955E-5
9-116151741-T-C p.Ile243Val missense ALAD 1 83158 1.20253E-5 41579 0 7.95412E-6
9-116151744-C-A p.Asp242Tyr missense ALAD 2 83166 2.40483E-5 41583 0 3.97709E-6
9-116151745-C-T p.Leu241Leu synonymous ALAD 2 83188 2.40419E-5 41594 0 NA
9-116151748-G-A p.Tyr240Tyr synonymous ALAD 8 83192 9.61631E-5 41596 0 5.03525E-4
9-116151749-T-C p.Tyr240Cys missense ALAD 25 83200 3.00481E-4 41600 1 1.35215E-4
9-116151751-G-A p.Pro239Pro synonymous ALAD 1 83210 1.20178E-5 41605 0 NA
9-116151752-G-A p.Pro239Leu missense ALAD 1 83212 1.20175E-5 41606 0 3.977E-6
9-116151755-A-G p.Met238Thr missense ALAD 1 83218 1.20166E-5 41609 0 NA
9-116151760-C-T p.Pro236Pro synonymous ALAD 3 83236 3.60421E-5 41618 0 6.36902E-5
9-116151771-T-C p.Met233Val missense ALAD 1 83238 1.20137E-5 41619 0 8.2496E-6
9-116151795-C-T p.Val225Ile missense ALAD 19 83244 2.28245E-4 41622 0 0.0015121
9-116151800-C-T p.Arg223Gln missense ALAD 3 83234 3.6043E-5 41617 0 8.24974E-6
9-116151803-TCCTAAGGGATGAGGGTATAATGTGGGTGGTGCCTAGGAGGGGGCTGAGGGTGGGGCTCAAGTCCTAGTCACTCA-T p.Asp222fs frameshift ALAD 11 83202 1.32208E-4 41601 4 NA
9-116151810-G-C c.664-6C>G splice_region ALAD 1 83188 1.2021E-5 41594 0 NA
9-116151875-TC-T c.663+3delG splice_region ALAD 1 82940 1.20569E-5 41470 0 3.98054E-6
9-116151878-C-T c.663+1G>A splice_donor ALAD 1 82958 1.20543E-5 41479 0 NA
9-116151901-C-T p.Arg214Gln missense ALAD 2 82960 2.4108E-5 41480 0 1.15441E-4
9-116151902-G-A p.Arg214* stop_gained ALAD 1 82960 1.2054E-5 41480 0 3.98089E-6
9-116151912-G-A p.Pro210Pro synonymous ALAD 1 83000 1.20482E-5 41500 0 3.98073E-6
9-116151915-C-A p.Leu209Leu synonymous ALAD 10 82978 1.20514E-4 41489 0 3.18451E-4
9-116151927-G-C p.Arg205Arg synonymous ALAD 2 82964 2.41068E-5 41482 0 NA
9-116151928-C-T p.Arg205His missense ALAD 3 82956 3.61638E-5 41478 0 1.99197E-5
9-116151929-G-A p.Arg205Cys missense ALAD 3 82974 3.61559E-5 41487 0 2.48447E-5
9-116151932-G-A p.Arg204Cys missense ALAD 2 82952 2.41103E-5 41476 0 3.18451E-5
9-116151937-C-T p.Gly202Glu missense ALAD 1 82952 1.20552E-5 41476 0 NA
9-116151942-A-C p.Ala200Ala synonymous ALAD 2 82992 2.40987E-5 41496 0 3.18613E-5
9-116151949-C-T p.Ser198Asn missense ALAD 4 82988 4.81997E-5 41494 0 1.65766E-5
9-116151954-C-T p.Lys196Lys synonymous ALAD 1 83022 1.2045E-5 41511 0 NA
9-116151955-T-C p.Lys196Arg missense ALAD 1 83028 1.20441E-5 41514 0 NA
9-116151965-CCCTGCAAAGCAGAGTCATCAGGGTGGGCTCCAGCTTTGGGCCAAAGGGCCAGGGATTCACAGCAGACCCCTGCCCACCCCTGCTCA-C p.Asp193fs frameshift ALAD 7 83060 8.42764E-5 41530 0 NA
9-116152072-A-G p.Cys186Arg missense ALAD 4 83320 4.80077E-5 41660 0 1.64978E-5
9-116152090-T-G p.Ser180Arg missense ALAD 3 83310 3.60101E-5 41655 0 1.27397E-4
9-116152103-C-T p.Ser175Ser synonymous ALAD 1 83288 1.20065E-5 41644 0 2.47852E-5
9-116152104-G-A p.Ser175Leu missense ALAD 3 83288 3.60196E-5 41644 0 8.26378E-6
9-116152107-A-G p.Val174Ala missense+splice_region ALAD 4 83278 4.80319E-5 41639 0 6.25E-4
9-116152112-T-C c.520-4A>G splice_region ALAD 1 83250 1.2012E-5 41625 0 NA
9-116152114-GGGAGACA-G c.520-13_520-7delTGTCTCC splice_region ALAD 1 83248 1.20123E-5 41624 0 NA
9-116152678-C-A c.519+7G>T splice_region ALAD 52 83106 6.25707E-4 41553 0 0.00165732
9-116152678-C-G c.519+7G>C splice_region ALAD 1 83106 1.20328E-5 41553 0 3.18715E-5
9-116152687-T-C p.Arg173Gly missense+splice_region ALAD 1 83168 1.20239E-5 41584 0 3.97962E-6
9-116152688-G-A p.Asn172Asn synonymous ALAD 1 83164 1.20244E-5 41582 0 1.65673E-5
9-116152710-A-G p.Leu165Pro missense ALAD 3 83224 3.60473E-5 41612 0 3.19101E-5
9-116152710-AG-A p.Leu165fs frameshift ALAD 1 83224 1.20158E-5 41612 0 NA
9-116152716-T-C p.Glu163Gly missense ALAD 1 83228 1.20152E-5 41614 0 NA
9-116152728-T-C p.Glu159Gly missense ALAD 12 83220 1.44196E-4 41610 0 5.03525E-4
9-116152732-C-T p.Val158Met missense ALAD 2 83208 2.40361E-5 41604 0 3.18613E-5
9-116152733-G-A p.Arg157Arg synonymous ALAD 1 83184 1.20215E-5 41592 0 1.19367E-5
9-116152734-C-T p.Arg157His missense ALAD 2 83190 2.40414E-5 41595 0 3.18634E-5
9-116152735-G-A p.Arg157Cys missense ALAD 2 83184 2.40431E-5 41592 0 2.48036E-5
9-116152751-C-T p.Ser151Ser synonymous ALAD 1 83162 1.20247E-5 41581 0 8.27938E-6
9-116152754-C-T p.Pro150Pro synonymous ALAD 6 83142 7.21657E-5 41571 0 6.37267E-5
9-116152756-G-A p.Pro150Ser missense ALAD 2 83148 2.40535E-5 41574 0 NA
9-116152772-TCCTGGGGGGCAGAGGGTGGCCTTCAGAACTCTGGGGCCCTCCTAGCCACTCTGCCACCTCCTGACCCAGAGGTGCCCATCCCTGCTGGTGGTTCACTCA-T p.Gly144fs frameshift ALAD 10 83026 1.20444E-4 41513 3 NA
9-116152777-G-C c.431-4C>G splice_region ALAD 1 83016 1.20459E-5 41508 0 NA
9-116152876-C-T p.Ala143Thr missense ALAD 1 82968 1.20528E-5 41484 0 NA
9-116152878-T-C p.Lys142Arg missense ALAD 1 82978 1.20514E-5 41489 0 5.58717E-5
9-116152886-C-T p.Ala139Ala synonymous ALAD 336 82960 0.00405014 41480 1 0.00391758
9-116152887-G-A p.Ala139Val missense ALAD 2 82944 2.41127E-5 41472 0 3.19576E-5
9-116152888-C-T p.Ala139Thr missense ALAD 2 82978 2.41028E-5 41489 0 NA
9-116152891-A-G p.Leu138Leu synonymous ALAD 6553 82850 0.0790948 41425 295 0.0928735
9-116152895-C-T p.Val136Val synonymous ALAD 17 82986 2.04854E-4 41493 0 1.09714E-4
9-116152914-C-T p.Arg130His missense ALAD 1 83018 1.20456E-5 41509 0 5.04032E-4
9-116152915-G-A p.Arg130Cys missense ALAD 3 83006 3.6142E-5 41503 0 6.78199E-5
9-116152929-C-T p.Arg125Gln missense ALAD 2 82950 2.41109E-5 41475 0 1.71435E-4
9-116152930-G-A p.Arg125Trp missense ALAD 2 82926 2.41179E-5 41463 0 6.37024E-5
9-116152931-G-A p.Phe124Phe synonymous ALAD 2 82928 2.41173E-5 41464 0 2.57096E-5
9-116152940-G-A p.Asn121Asn synonymous ALAD 6002 82672 0.0726002 41336 248 0.0894918
9-116152947-C-T p.Ser119Asn missense ALAD 1 82848 1.20703E-5 41424 0 NA
9-116152958-T-C c.347-2A>G splice_acceptor ALAD 1 82758 1.20834E-5 41379 0 NA
9-116153077-C-T c.346+1G>A splice_donor ALAD 1 79650 1.25549E-5 39825 0 NA
9-116153078-C-A p.Gly116Trp missense+splice_region ALAD 1 79570 1.25676E-5 39785 0 NA
9-116153079-G-A p.Cys115Cys splice_region+synonymous ALAD 2 79526 2.5149E-5 39763 0 1.26112E-5
9-116153086-C-A p.Gly113Val missense ALAD 1 79602 1.25625E-5 39801 0 NA
9-116153088-A-G p.His112His synonymous ALAD 5 79704 6.27321E-5 39852 0 4.10583E-6
9-116153115-A-G p.Asp103Asp synonymous ALAD 65 79400 8.1864E-4 39700 1 0.00197578
9-116153116-T-A p.Asp103Val missense ALAD 2 79380 2.51953E-5 39690 0 NA
9-116153122-G-T p.Ala101Asp missense ALAD 1 79304 1.26097E-5 39652 0 NA
9-116153124-C-T p.Val100Val synonymous ALAD 2 79242 2.52391E-5 39621 0 NA
9-116153139-G-A p.Phe95Phe synonymous ALAD 1 79140 1.26358E-5 39570 0 3.5878E-5
9-116153145-C-A p.Lys93Asn missense ALAD 12 79054 1.51795E-4 39527 0 3.8236E-4
9-116153156-G-C p.Leu90Val missense ALAD 1 79068 1.26473E-5 39534 0 3.9814E-6
9-116153163-T-G p.Ala87Ala synonymous ALAD 3 79004 3.79728E-5 39502 0 9.55285E-5
9-116153186-C-T p.Glu80Lys missense ALAD 1 78680 1.27097E-5 39340 0 1.65733E-5
9-116153187-G-A n.561C>T splice_region ALAD 1 78730 1.27016E-5 39365 0 1.59398E-4
9-116153188-G-A p.Ser79Phe missense ALAD 1 78744 1.26994E-5 39372 0 3.18613E-5
9-116153198-C-T p.Ala76Thr missense ALAD 15 78446 1.91214E-4 39223 0 2.32038E-4
9-116153199-G-A p.Ser75Ser synonymous ALAD 7 78592 8.90676E-5 39296 0 6.25E-4
9-116153200-G-A p.Ser75Phe missense ALAD 1 78568 1.27278E-5 39284 0 NA
9-116153206-C-T p.Arg73Gln missense ALAD 2 78220 2.55689E-5 39110 0 3.31576E-5
9-116153207-G-A p.Arg73Trp missense ALAD 1 78044 1.28133E-5 39022 0 3.98235E-6
9-116153210-C-T p.Glu72Lys missense ALAD 1 77904 1.28363E-5 38952 0 8.28981E-6
9-116153211-G-A p.Asp71Asp splice_region+synonymous ALAD 3 77916 3.8503E-5 38958 0 1.59347E-4
9-116153217-G-C c.211-4C>G splice_region ALAD 1 77828 1.28488E-5 38914 0 NA
9-116153800-T-C c.210+7A>G splice_region ALAD 2 83022 2.409E-5 41511 0 1.6578E-5
9-116153801-C-G c.210+6G>C splice_region ALAD 11 83032 1.32479E-4 41516 0 2.38724E-5
9-116153817-C-T p.Arg67Lys missense ALAD 11 83126 1.32329E-4 41563 0 3.18492E-4
9-116153827-C-T p.Val64Ile missense ALAD 3 83142 3.60828E-5 41571 0 8.75058E-5
9-116153828-G-A p.Gly63Gly synonymous ALAD 1 83144 1.20273E-5 41572 0 4.13066E-5
9-116153831-A-G p.Phe62Phe synonymous ALAD 1 83164 1.20244E-5 41582 0 1.65183E-5
9-116153847-C-T p.Arg57His missense ALAD 3 83178 3.60672E-5 41589 0 3.30338E-5
9-116153848-G-A p.Arg57Cys missense ALAD 4 83184 4.80862E-5 41592 0 2.47746E-5
9-116153849-T-C p.Leu56Leu synonymous ALAD 4 83180 4.80885E-5 41590 0 1.27413E-4
9-116153851-G-A p.Leu56Leu synonymous ALAD 1 83160 1.2025E-5 41580 0 NA
9-116153855-C-T p.Glu54Glu synonymous ALAD 1 83158 1.20253E-5 41579 0 8.25818E-6
9-116153889-C-T p.Arg43Gln missense ALAD 4 82812 4.83022E-5 41406 0 6.36851E-5
9-116153891-C-G p.Lys42Asn missense ALAD 6955 82522 0.0842806 41261 367 0.121875
9-116153900-A-G p.Tyr39Tyr synonymous ALAD 26996 81504 0.331223 40752 4640 0.378321
9-116153900-AT-GC p.Tyr39Cys missense+splice_region ALAD 1 82654 1.20986E-5 41327 0 NA
9-116154409-C-A p.Gly52* stop_gained ALAD 1 81254 1.23071E-5 40627 0 0.0015213
9-116154422-G-A p.Ile47Ile synonymous ALAD 105 81446 0.0012892 40723 1 0.00283439
9-116154428-C-G p.Gln45His missense ALAD 2 81494 2.45417E-5 40747 0 2.00024E-5
9-116154431-T-C p.Ile44Met missense ALAD 1 81528 1.22657E-5 40764 0 NA
9-116154437-A-T p.Asp42Glu missense ALAD 3 81550 3.67872E-5 40775 0 9.56145E-5
9-116154437-A-G p.Asp42Asp synonymous ALAD 1 81550 1.22624E-5 40775 0 8.6792E-6
9-116154613-G-A n.223C>T splice_region ALAD 1 82686 1.20939E-5 41343 0 1.02655E-5
9-116154616-C-G n.221-1G>C splice_acceptor ALAD 1 82594 1.21074E-5 41297 0 NA
9-116154619-A-AC n.221-5_221-4insG splice_region ALAD 1 82576 1.21101E-5 41288 0 NA
9-116154619-AAAT-A n.221-7_221-5delATT splice_region ALAD 1 82576 1.21101E-5 41288 0 NA
9-116154621-A-AAGATGGGGTAGATGAGGTTGGAGGCATTGAGGG n.221-7_221-6insCCCTCAATGCCTCCAACCTCATCTACCCCATCT splice_region ALAD 1 82592 1.21077E-5 41296 0 NA
9-116155726-C-T c.113+1G>A splice_donor ALAD 1 83068 1.20383E-5 41534 0 NA
9-116155740-G-T p.Pro34Thr missense ALAD 1 83166 1.20241E-5 41583 0 9.55779E-5
9-116155747-G-A p.Leu31Leu synonymous ALAD 1 83192 1.20204E-5 41596 0 8.2813E-6
9-116155749-G-A p.Leu31Phe missense ALAD 1 83194 1.20201E-5 41597 0 8.28116E-6
9-116155752-T-C p.Asn30Asp missense ALAD 1 83192 1.20204E-5 41596 0 3.97988E-6
9-116155760-T-C p.Asn27Ser missense ALAD 4 83198 4.80781E-5 41599 0 7.95988E-6
9-116155768-G-A p.Thr24Thr synonymous ALAD 78 83176 9.37771E-4 41588 0 0.009375
9-116155769-G-A p.Thr24Ile missense ALAD 1 83156 1.20256E-5 41578 0 7.96096E-6
9-116155770-T-C p.Thr24Ala missense ALAD 2 83152 2.40523E-5 41576 0 NA
9-116155790-C-T p.Arg17Gln missense ALAD 2 83018 2.40912E-5 41509 0 0.0025
9-116155791-G-A p.Arg17Trp missense ALAD 3 83016 3.61376E-5 41508 0 5.97491E-5
9-116155804-G-C p.Phe12Leu missense ALAD 4 82930 4.82335E-5 41465 0 3.31873E-5
9-116155804-G-A p.Phe12Phe synonymous ALAD 1 82930 1.20584E-5 41465 0 8.29683E-6
9-116155811-C-G p.Gly10Ala missense ALAD 16 82898 1.93008E-4 41449 1 1.49402E-4
9-116155812-C-T p.Gly10Ser missense ALAD 4 82894 4.82544E-5 41447 0 4.15027E-5
9-116155824-C-T p.Val6Ile missense ALAD 6 82770 7.249E-5 41385 0 6.37806E-5
9-116155825-G-A p.Ser14Ser splice_region+synonymous ALAD 71 82756 8.57944E-4 41378 0 0.00171909
9-116155834-C-T p.Gln2Gln synonymous ALAD 2 82552 2.42272E-5 41276 0 8.31794E-6
9-116155836-G-A p.Gln2* stop_gained ALAD 1 82518 1.21186E-5 41259 0 NA
9-116155842-C-T p.Ala9Thr missense ALAD 1 82306 1.21498E-5 41153 0 NA
9-116155843-G-A c.-4C>T 5_prime_UTR_premature_start_codon_gain ALAD 3 82296 3.64538E-5 41148 0 4.49745E-4
9-116155847-G-A p.Ala7Val missense ALAD 2 82214 2.43268E-5 41107 0 NA
9-116155847-G-GCCA p.Leu6_Ala7insVal conservative_inframe_insertion ALAD 1 82214 1.21634E-5 41107 0 6.66411E-5
9-116155854-G-A p.Pro5Ser missense ALAD 2 82018 2.43849E-5 41009 0 3.9931E-6
9-116155858-CA-C p.Leu3fs frameshift ALAD 1 81848 1.22178E-5 40924 0 NA
9-116155859-AG-A p.Leu3fs frameshift ALAD 2 81798 2.44505E-5 40899 0 3.1837E-5
9-116155862-G-A p.Pro2Leu missense ALAD 5 81660 6.12295E-5 40830 0 1.19888E-5
9-116155864-C-T p.Met1? start_lost ALAD 2 81562 2.45212E-5 40781 0 7.99258E-6
9-116155882-G-A c.-43C>T 5_prime_UTR_premature_start_codon_gain ALAD 4 80386 4.97599E-5 40193 0 3.18492E-5
9-116155909-C-A n.75G>T splice_region ALAD 1 77474 1.29076E-5 38737 0 3.18431E-5
9-116155910-T-TA n.74-1_74insT splice_acceptor ALAD 2 77400 2.58398E-5 38700 1 NA
9-116155917-G-GT c.-75-4_-75-3insA splice_region ALAD 1 76090 1.31423E-5 38045 0 NA
9-116155918-T-TG c.-75-5_-75-4insC splice_region ALAD 2 75902 2.63498E-5 37951 0 2.92285E-5
9-116155919-G-T c.-75-5C>A splice_region ALAD 2 75606 2.64529E-5 37803 0 3.18532E-5
9-116163593-G-A c.-177C>T 5_prime_UTR_premature_start_codon_gain ALAD 13 1636 0.00794621 818 0 0.0250255