Variant

Variant ID Consequence Effect Gene AC AN AF NS NHOM maxEAF
19-50372302-T-C c.*872A>G splice_region AKT1S1 2 44814 4.46289E-5 22407 0 NA
19-50373192-C-T p.Lys251Lys synonymous AKT1S1 1 67788 1.47519E-5 33894 0 NA
19-50373193-T-G p.Lys251Thr missense AKT1S1 3 67754 4.42778E-5 33877 0 6.30175E-6
19-50373204-G-A p.Ser247Ser synonymous AKT1S1 2 67456 2.9649E-5 33728 0 NA
19-50373210-G-C p.Asn245Lys missense AKT1S1 1 67718 1.47671E-5 33859 0 NA
19-50373217-C-T p.Arg243Gln missense AKT1S1 1 66932 1.49405E-5 33466 0 NA
19-50373229-AG-TT p.Leu239Lys missense AKT1S1 1 66324 1.50775E-5 33162 0 NA
19-50373240-G-C p.Val235Val synonymous AKT1S1 1 64622 1.54746E-5 32311 0 NA
19-50373243-C-A p.Gln234His missense AKT1S1 2 64704 3.091E-5 32352 0 3.03907E-5
19-50373248-T-C p.Thr233Ala missense AKT1S1 1 63888 1.56524E-5 31944 0 NA
19-50373248-T-A p.Thr233Ser missense AKT1S1 1 63888 1.56524E-5 31944 0 NA
19-50373266-G-A p.Leu227Leu synonymous AKT1S1 2 61712 3.24086E-5 30856 0 8.38012E-5
19-50373286-G-A p.Ala220Val missense AKT1S1 1 58800 1.70068E-5 29400 0 NA
19-50373306-G-T p.Pro213Pro synonymous AKT1S1 1 56034 1.78463E-5 28017 0 3.18634E-5
19-50373309-C-G p.Ser212Ser synonymous AKT1S1 3 55384 5.41673E-5 27692 0 6.11269E-6
19-50373309-C-T p.Ser212Ser synonymous AKT1S1 1 55384 1.80558E-5 27692 0 NA
19-50373322-G-A c.628-5C>T splice_region AKT1S1 12 53694 2.23489E-4 26847 0 2.7195E-4
19-50373324-G-A c.628-7C>T splice_region AKT1S1 3 53388 5.61924E-5 26694 0 3.59396E-4
19-50373324-G-T c.628-7C>A splice_region AKT1S1 1 53388 1.87308E-5 26694 0 7.98658E-5
19-50374796-C-T c.627+8G>A splice_region AKT1S1 1 81826 1.22211E-5 40913 0 NA
19-50374803-C-T c.627+1G>A splice_donor AKT1S1 1 82056 1.21868E-5 41028 0 NA
19-50374804-C-T p.Pro209Pro splice_region+synonymous AKT1S1 1 82078 1.21835E-5 41039 0 9.55779E-5
19-50374805-G-C p.Pro209Arg missense+splice_region AKT1S1 1 82086 1.21823E-5 41043 0 8.27267E-6
19-50374806-G-T p.Pro209Thr missense+splice_region AKT1S1 1 82180 1.21684E-5 41090 0 3.98381E-6
19-50374812-TCTC-T p.Glu206del conservative_inframe_deletion AKT1S1 1 82346 1.21439E-5 41173 0 3.19673E-5
19-50374831-C-T p.Ala200Ala synonymous AKT1S1 3 82634 3.63047E-5 41317 0 4.13326E-5
19-50374841-C-G p.Arg197Thr missense AKT1S1 1 82770 1.20817E-5 41385 0 3.18776E-5
19-50374843-C-CTG p.Lys196fs frameshift AKT1S1 1 82764 1.20825E-5 41382 0 NA
19-50374854-AG-A p.Phe193fs frameshift AKT1S1 1 82730 1.20875E-5 41365 0 NA
19-50374857-C-T p.Gly192Ser missense AKT1S1 2 82720 2.41779E-5 41360 0 8.27719E-6
19-50374863-C-T p.Val190Ile missense AKT1S1 3 82658 3.62941E-5 41329 0 2.23115E-4
19-50374863-C-A p.Val190Phe missense AKT1S1 5 82658 6.04902E-5 41329 0 6.25E-4
19-50374864-G-A p.Pro189Pro synonymous AKT1S1 279 82614 0.00337715 41307 2 0.00631176
19-50374867-C-A p.Val188Val synonymous AKT1S1 1 82616 1.21042E-5 41308 0 NA
19-50374878-G-A p.Pro185Ser missense AKT1S1 1 82566 1.21115E-5 41283 0 3.18634E-5
19-50374891-G-A p.Tyr180Tyr synonymous AKT1S1 37 82458 4.48713E-4 41229 1 0.00100705
19-50374897-C-T p.Gln178Gln synonymous AKT1S1 1 82454 1.2128E-5 41227 0 NA
19-50374899-G-C p.Gln178Glu missense AKT1S1 1 82450 1.21286E-5 41225 0 NA
19-50374908-G-A p.Leu175Leu synonymous AKT1S1 1 82440 1.213E-5 41220 0 NA
19-50374911-C-T p.Ala174Thr missense AKT1S1 1 82338 1.21451E-5 41169 0 6.37389E-5
19-50374911-C-G p.Ala174Pro missense AKT1S1 1 82338 1.21451E-5 41169 0 NA
19-50374920-G-A p.Pro171Ser missense AKT1S1 1 82274 1.21545E-5 41137 0 NA
19-50374922-G-T p.Pro170His missense AKT1S1 7 82210 8.51478E-5 41105 0 6.37389E-5
19-50374924-C-T p.Val169Val synonymous AKT1S1 1 82076 1.21838E-5 41038 0 8.39377E-6
19-50374935-T-TG p.Thr166fs frameshift AKT1S1 4 81850 4.88699E-5 40925 0 8.48824E-5
19-50374936-G-C p.Pro165Pro synonymous AKT1S1 2 81956 2.44033E-5 40978 0 2.5457E-5
19-50374936-G-T p.Pro165Pro synonymous AKT1S1 1 81956 1.22017E-5 40978 0 NA
19-50374937-G-C p.Pro165Arg missense AKT1S1 1 82030 1.21907E-5 41015 0 8.07155E-6
19-50374938-G-A p.Pro165Ser missense AKT1S1 1 82000 1.21951E-5 41000 0 NA
19-50374938-G-T p.Pro165Thr missense AKT1S1 1 82000 1.21951E-5 41000 0 NA
19-50374942-G-A p.Gly163Gly synonymous AKT1S1 2 81806 2.44481E-5 40903 0 1.6969E-5
19-50374943-C-T p.Gly163Asp missense AKT1S1 2 81708 2.44774E-5 40854 0 8.48623E-6
19-50374944-C-T p.Gly163Ser missense AKT1S1 1 81706 1.2239E-5 40853 0 4.0404E-6
19-50374945-G-A p.Ala162Ala synonymous AKT1S1 2 81874 2.44278E-5 40937 0 5.03525E-4
19-50374947-C-T p.Ala162Thr missense AKT1S1 4 81798 4.8901E-5 40899 0 1.69664E-4
19-50374948-G-A p.Pro161Pro synonymous AKT1S1 1 81976 1.21987E-5 40988 0 3.18857E-5
19-50374950-G-A p.Pro161Ser missense AKT1S1 1 81960 1.22011E-5 40980 0 8.46024E-6
19-50374951-G-A p.Thr160Thr synonymous AKT1S1 2 81954 2.44039E-5 40977 0 6.37836E-5
19-50374959-C-T p.Glu158Lys missense AKT1S1 1 81884 1.22124E-5 40942 0 4.01897E-6
19-50374960-G-A p.Ser157Ser synonymous AKT1S1 1 81770 1.22294E-5 40885 0 5.03525E-4
19-50374973-TCTGAAAGAGAGGGTGGACTTCAGCTTCTGTCCCTGCCTTTGTGTCGGCCGTGTGCCTGCCCTCAGGTCGGGAGGGGAACAGCCTGGGACACTCAC-T c.457+1_458-1delGTGAGTGTCCCAGGCTGTTCCCCTCCCGACCTGAGGGCAGGCACACGGCCGACACAAAGGCAGGGACAGAAGCTGAAGTCCACCCTCTCTTTCAG splice_acceptor AKT1S1 14 82162 1.70395E-4 41081 6 NA
19-50375070-A-G p.Asp152Asp splice_region+synonymous AKT1S1 22 82410 2.66958E-4 41205 0 7.46442E-4
19-50375082-G-A p.Pro148Pro synonymous AKT1S1 9 82294 1.09364E-4 41147 0 1.65134E-5
19-50375097-G-A p.Phe143Phe synonymous AKT1S1 1 82282 1.21533E-5 41141 0 4.02486E-6
19-50375100-G-A p.Pro142Pro synonymous AKT1S1 1 82292 1.21518E-5 41146 0 2.81944E-5
19-50375100-G-T p.Pro142Pro synonymous AKT1S1 1 82292 1.21518E-5 41146 0 8.25887E-6
19-50375101-G-C p.Pro142Arg missense AKT1S1 1 82296 1.21513E-5 41148 0 5.78054E-5
19-50375101-G-T p.Pro142His missense AKT1S1 1 82296 1.21513E-5 41148 0 6.37836E-5
19-50375104-G-T p.Pro141His missense AKT1S1 1 82312 1.21489E-5 41156 0 9.57121E-5
19-50375123-C-T p.Ala135Thr missense AKT1S1 4 82282 4.86133E-5 41141 0 1.27608E-4
19-50375124-G-A p.Asp134Asp synonymous AKT1S1 5 82290 6.07607E-5 41145 0 3.1904E-5
19-50375137-A-G p.Val130Ala missense AKT1S1 1 82266 1.21557E-5 41133 0 7.98665E-6
19-50375138-C-T p.Val130Met missense AKT1S1 1 82252 1.21578E-5 41126 0 3.18634E-5
19-50375141-A-T p.Phe129Ile missense AKT1S1 5 82242 6.07962E-5 41121 0 6.37877E-5
19-50376166-C-T c.379+8G>A splice_region AKT1S1 1 78282 1.27743E-5 39141 0 1.21527E-5
19-50376168-T-C c.379+6A>G splice_region AKT1S1 2 78272 2.55519E-5 39136 0 NA
19-50376177-C-T p.Gly126Arg missense AKT1S1 2 78630 2.54356E-5 39315 0 8.61861E-6
19-50376188-A-G p.Ile122Thr missense AKT1S1 2 78820 2.53743E-5 39410 0 6.25E-4
19-50376202-C-A p.Gly117Gly synonymous AKT1S1 85 78908 0.0010772 39454 0 0.00201816
19-50376204-C-T p.Gly117Arg missense AKT1S1 19 78896 2.40823E-4 39448 0 0.0010451
19-50376205-G-A p.Ser116Ser synonymous AKT1S1 248 78852 0.00314513 39426 4 0.0105954
19-50376208-GGTCTCT-G p.Glu114_Thr115del disruptive_inframe_deletion AKT1S1 1 78940 1.26678E-5 39470 0 8.71883E-5
19-50376209-G-A p.Thr115Ile missense AKT1S1 2 78928 2.53396E-5 39464 0 1.29157E-5
19-50376212-T-C p.Glu114Gly missense AKT1S1 4 78996 5.06355E-5 39498 0 1.01389E-4
19-50376214-T-C p.Thr113Thr synonymous AKT1S1 2 79014 2.5312E-5 39507 0 NA
19-50376223-G-A p.Pro110Pro synonymous AKT1S1 1 79050 1.26502E-5 39525 0 NA
19-50376234-C-T p.Glu107Lys missense AKT1S1 8 78994 1.01274E-4 39497 0 1.80083E-5
19-50376237-C-G p.Asp106His missense AKT1S1 189 78998 0.00239247 39499 0 0.00375
19-50376238-C-T p.Glu105Glu synonymous AKT1S1 3 79016 3.7967E-5 39508 0 1.36117E-5
19-50376243-C-T p.Glu104Lys missense AKT1S1 2 78942 2.53351E-5 39471 0 6.25E-4
19-50376246-T-C p.Asn103Asp missense AKT1S1 1 78928 1.26698E-5 39464 0 1.74605E-5
19-50376257-G-A p.Ala99Val missense AKT1S1 4 78730 5.08066E-5 39365 0 1.99274E-4
19-50376262-G-A p.Thr97Thr synonymous AKT1S1 1 78644 1.27155E-5 39322 0 3.18796E-5
19-50376269-C-T p.Arg95Gln missense AKT1S1 1 78348 1.27636E-5 39174 0 3.18898E-5
19-50376270-G-A p.Arg95Trp missense AKT1S1 1 78386 1.27574E-5 39193 0 3.05754E-5
19-50376291-T-A p.Ser88Cys missense AKT1S1 2 77620 2.57666E-5 38810 0 9.5645E-5
19-50376296-G-A p.Pro86Leu missense AKT1S1 50 77374 6.46212E-4 38687 0 0.00205339
19-50376300-G-A p.Gln85* stop_gained AKT1S1 1 77162 1.29597E-5 38581 0 NA
19-50376316-C-A p.Ala79Ala synonymous AKT1S1 204 75698 0.00269492 37849 0 0.00331887
19-50376316-C-T p.Ala79Ala synonymous AKT1S1 3 75722 3.96186E-5 37861 0 1.38454E-4
19-50376317-G-A p.Ala79Val missense AKT1S1 5 75764 6.59944E-5 37882 0 0.00619195
19-50376320-G-A p.Pro78Leu missense AKT1S1 2 75734 2.64082E-5 37867 0 NA
19-50376326-C-T p.Arg76Gln missense AKT1S1 96 74920 0.00128137 37460 0 0.0012993
19-50376327-G-A p.Arg76Trp missense AKT1S1 4 74910 5.33974E-5 37455 0 3.1904E-5
19-50376344-C-T p.Arg70Lys missense AKT1S1 3 73314 4.09199E-5 36657 0 6.47744E-6
19-50376347-T-G p.His69Pro missense AKT1S1 1 72922 1.37133E-5 36461 0 NA
19-50376347-T-C p.His69Arg missense AKT1S1 1 72922 1.37133E-5 36461 0 NA
19-50376355-T-C p.Ala66Ala synonymous AKT1S1 1 72188 1.38527E-5 36094 0 NA
19-50376355-T-A p.Ala66Ala synonymous AKT1S1 2 72188 2.77054E-5 36094 0 6.25E-4
19-50376357-C-T p.Ala66Thr missense AKT1S1 1 71414 1.40029E-5 35707 0 NA
19-50376361-G-A p.Asp64Asp synonymous AKT1S1 5 70990 7.04325E-5 35495 0 0.00156413
19-50376363-C-T p.Asp64Asn missense AKT1S1 1 70206 1.42438E-5 35103 0 1.33094E-5
19-50376364-G-A p.His63His synonymous AKT1S1 27 70050 3.85439E-4 35025 0 0.00178777
19-50376365-T-C p.His63Arg missense AKT1S1 1 69876 1.43111E-5 34938 0 1.59724E-4
19-50376370-G-A p.Cys61Cys synonymous AKT1S1 1 68544 1.45892E-5 34272 0 NA
19-50376374-C-T p.Arg60His missense AKT1S1 2 67264 2.97336E-5 33632 0 5.6319E-5
19-50376375-G-A p.Arg60Cys missense AKT1S1 3 66638 4.50194E-5 33319 0 0.00210748
19-50376375-G-C p.Arg60Gly missense AKT1S1 1 66638 1.50065E-5 33319 0 3.19407E-5
19-50376376-G-A p.Arg59Arg synonymous AKT1S1 1 65848 1.51865E-5 32924 0 9.58038E-5
19-50376376-G-T p.Arg59Arg synonymous AKT1S1 1 65848 1.51865E-5 32924 0 NA
19-50376377-C-T p.Arg59His missense AKT1S1 1 65286 1.53172E-5 32643 0 5.69671E-5
19-50376378-G-A p.Arg59Cys missense AKT1S1 1 64636 1.54713E-5 32318 0 NA
19-50376380-G-A p.Ala58Val missense AKT1S1 2 63444 3.15239E-5 31722 0 5.7924E-5
19-50376388-C-T p.Ala55Ala synonymous AKT1S1 119 61806 0.00192538 30903 0 0.00319509
19-50376407-T-C p.His49Arg missense AKT1S1 7 56116 1.24742E-4 28058 0 NA
19-50376413-G-C p.Ala47Gly missense AKT1S1 1 54774 1.82568E-5 27387 0 NA
19-50376434-C-T p.Arg40His missense AKT1S1 1 48480 2.06271E-5 24240 0 1.66141E-4
19-50376438-G-T p.Pro39Thr missense AKT1S1 1 48292 2.07074E-5 24146 0 6.0983E-5
19-50376442-T-C p.Pro37Pro synonymous AKT1S1 2 47612 4.20062E-5 23806 0 NA
19-50376445-C-T p.Pro36Pro synonymous AKT1S1 1 46722 2.14032E-5 23361 0 1.02569E-4
19-50376445-C-A p.Pro36Pro synonymous AKT1S1 1 46724 2.14023E-5 23362 0 0.00263713
19-50376448-C-T p.Pro35Pro synonymous AKT1S1 1 45974 2.17514E-5 22987 0 3.2112E-5
19-50376450-G-A p.Pro35Ser missense AKT1S1 1 45734 2.18656E-5 22867 0 7.91077E-6
19-50376454-C-T p.Ala33Ala splice_region+synonymous AKT1S1 32 44728 7.15436E-4 22364 0 0.00191926
19-50376457-G-A p.Thr32Thr synonymous AKT1S1 7 44248 1.58199E-4 22124 0 0.00417973
19-50376458-G-A p.Thr32Ile missense AKT1S1 4 44104 9.06947E-5 22052 0 2.30897E-5
19-50376469-C-T p.Leu28Leu synonymous AKT1S1 1 43370 2.30574E-5 21685 0 NA
19-50376475-C-T p.Thr26Thr synonymous AKT1S1 1 42866 2.33285E-5 21433 0 1.6975E-4
19-50376476-G-A p.Thr26Met missense AKT1S1 1 42846 2.33394E-5 21423 0 3.68775E-5
19-50376482-G-C p.Thr24Ser missense AKT1S1 2 42534 4.70212E-5 21267 0 NA
19-50376485-C-T p.Arg23Gln missense AKT1S1 21 42216 4.97442E-4 21108 0 0.00547706
19-50376486-G-A p.Arg23Trp missense AKT1S1 1 42232 2.36787E-5 21116 0 3.19734E-5
19-50376491-C-T p.Arg21Gln missense AKT1S1 2 41868 4.77692E-5 20934 0 2.89297E-5
19-50376498-G-A p.Arg19Cys missense AKT1S1 4 41500 9.63855E-5 20750 0 2.21926E-4
19-50376505-G-A p.Ala16Ala synonymous AKT1S1 8 41148 1.9442E-4 20574 0 0.00265957
19-50376508-C-G p.Gly15Gly synonymous AKT1S1 5 41190 1.21389E-4 20595 0 7.3947E-6
19-50376517-G-A p.Ala12Ala synonymous AKT1S1 10 40938 2.44272E-4 20469 0 0.0010352
19-50376517-G-C p.Ala12Ala synonymous AKT1S1 1 40938 2.44272E-5 20469 0 1.49056E-5
19-50376528-G-A p.Leu9Leu synonymous AKT1S1 1 40942 2.44248E-5 20471 0 NA
19-50376535-G-A p.Pro6Pro synonymous AKT1S1 1 40742 2.45447E-5 20371 0 8.93687E-6
19-50376539-C-T p.Arg5His missense AKT1S1 1 40534 2.46706E-5 20267 0 1.00685E-4
19-50376547-C-T p.Ala2Ala synonymous AKT1S1 3 40470 7.4129E-5 20235 0 1.91804E-4
19-50376560-C-G c.-7-1G>C splice_acceptor AKT1S1 2 40146 4.98182E-5 20073 0 NA
19-50376562-G-GCC c.-7-4_-7-3insGG splice_region AKT1S1 1 40072 2.49551E-5 20036 0 NA
19-50376563-C-T c.-7-4G>A splice_region AKT1S1 3 40016 7.497E-5 20008 0 6.39386E-5
19-50376564-G-GTAGCCAGCATGGCC c.-7-6_-7-5insGGCCATGCTGGCTA splice_region AKT1S1 1 40034 2.49788E-5 20017 0 NA
19-50376565-G-GCCGGCCCGGC c.-7-7_-7-6insGCCGGGCCGG splice_region AKT1S1 1 39980 2.50125E-5 19990 0 NA
19-50376566-G-C c.-7-7C>G splice_region AKT1S1 1 39952 2.503E-5 19976 0 1.44953E-5
19-50376575-G-A c.-23C>T 5_prime_UTR_premature_start_codon_gain AKT1S1 1 39858 2.50891E-5 19929 0 NA
19-50376580-G-C c.-28C>G 5_prime_UTR_premature_start_codon_gain AKT1S1 2 39768 5.02917E-5 19884 0 NA
19-50376599-G-A c.-47C>T 5_prime_UTR_premature_start_codon_gain AKT1S1 24 39084 6.14062E-4 19542 0 7.07142E-4
19-50376651-C-T c.-99G>A 5_prime_UTR_premature_start_codon_gain AKT1S1 2 37270 5.36625E-5 18635 0 3.19264E-5
19-50376655-C-T c.-103G>A 5_prime_UTR_premature_start_codon_gain AKT1S1 1 37176 2.68991E-5 18588 0 3.19305E-5
19-50376663-C-A c.-111G>T 5_prime_UTR_premature_start_codon_gain AKT1S1 1 36920 2.70856E-5 18460 0 9.57304E-5
19-50376681-G-A c.-129C>T 5_prime_UTR_premature_start_codon_gain AKT1S1 1 36042 2.77454E-5 18021 0 1.27804E-4
19-50376720-T-A c.-8+7A>T splice_region AKT1S1 1 30558 3.27247E-5 15279 0 NA
19-50376727-C-G c.-8G>C splice_region AKT1S1 1 29946 3.33934E-5 14973 0 NA
19-50376742-G-A c.-190C>T 5_prime_UTR_premature_start_codon_gain AKT1S1 2 28816 6.94059E-5 14408 0 1.27779E-4
19-50376760-G-A c.-208C>T 5_prime_UTR_premature_start_codon_gain AKT1S1 1 27028 3.69987E-5 13514 0 NA
19-50376797-C-T c.-245G>A 5_prime_UTR_premature_start_codon_gain AKT1S1 1 21648 4.61936E-5 10824 0 NA
19-50376862-G-C c.-310C>G 5_prime_UTR_premature_start_codon_gain AKT1S1 1 12820 7.80031E-5 6410 0 3.19632E-5
19-50379129-A-G c.-8+2T>C splice_donor AKT1S1 1 24248 4.12405E-5 12124 0 NA
19-50379231-T-C c.-108A>G 5_prime_UTR_premature_start_codon_gain AKT1S1 2 24276 8.23859E-5 12138 0 3.19081E-5
19-50379338-C-A c.-215G>T 5_prime_UTR_premature_start_codon_gain AKT1S1 1 24310 4.11353E-5 12155 0 NA
19-50379482-C-G c.-359G>C 5_prime_UTR_premature_start_codon_gain AKT1S1 3 25660 1.16913E-4 12830 0 6.38855E-5
19-50379488-T-C c.-365A>G 5_prime_UTR_premature_start_codon_gain AKT1S1 1 25904 3.86041E-5 12952 0 NA
19-50379502-G-C c.-379C>G 5_prime_UTR_premature_start_codon_gain AKT1S1 1 27048 3.69713E-5 13524 0 NA
19-50379852-C-A c.-8+8G>T splice_region AKT1S1 4 78300 5.10856E-5 39150 0 0.00254369
19-50379873-G-C p.Leu14Val missense AKT1S1 3 78928 3.80093E-5 39464 0 3.18451E-5
19-50379881-G-C p.Pro11Arg missense AKT1S1 2 79036 2.53049E-5 39518 0 NA
19-50379884-C-A p.Gly10Val missense AKT1S1 2 79052 2.52998E-5 39526 0 3.18532E-5
19-50379886-G-A c.-34C>T 5_prime_UTR_premature_start_codon_gain AKT1S1 1 79062 1.26483E-5 39531 0 3.18512E-5
19-50379886-G-T p.Ala9Ala synonymous AKT1S1 1 79062 1.26483E-5 39531 0 2.23957E-5
19-50379886-G-C p.Ala9Ala synonymous AKT1S1 4 79062 5.05932E-5 39531 0 NA
19-50379887-G-C p.Ala9Gly missense AKT1S1 1 79062 1.26483E-5 39531 0 NA
19-50379892-G-C p.Asp7Glu missense AKT1S1 1 79110 1.26406E-5 39555 0 NA
19-50379906-A-G p.Phe3Leu missense AKT1S1 1 79162 1.26323E-5 39581 0 1.27551E-4
19-50379908-G-A p.Ser2Phe missense AKT1S1 31 79160 3.91612E-4 39580 0 0.00136669
19-50379908-G-C p.Ser2Cys missense AKT1S1 16 79162 2.02117E-4 39581 0 6.30782E-4
19-50379912-T-C p.Met1? start_lost AKT1S1 1 79112 1.26403E-5 39556 0 NA
19-50379917-G-A n.326C>T splice_region AKT1S1 1 79044 1.26512E-5 39522 0 NA
19-50379926-G-A c.-74C>T 5_prime_UTR_premature_start_codon_gain AKT1S1 3 78990 3.79795E-5 39495 0 1.94643E-5
19-50379940-G-A c.-88C>T 5_prime_UTR_premature_start_codon_gain AKT1S1 1 78898 1.26746E-5 39449 0 NA
19-50379976-T-C c.-124A>G 5_prime_UTR_premature_start_codon_gain AKT1S1 3 78006 3.84586E-5 39003 0 1.59297E-4
19-50380009-C-T c.-157G>A 5_prime_UTR_premature_start_codon_gain AKT1S1 1 77008 1.29857E-5 38504 0 NA
19-50380011-G-A c.-159C>T 5_prime_UTR_premature_start_codon_gain AKT1S1 3 76918 3.90026E-5 38459 0 3.1837E-5
19-50380029-G-A c.-177C>T 5_prime_UTR_premature_start_codon_gain AKT1S1 11 74610 1.47433E-4 37305 0 2.86551E-4
19-50380036-A-G c.-184T>C 5_prime_UTR_premature_start_codon_gain AKT1S1 40 74024 5.40365E-4 37012 0 0.0012105
19-50380054-C-A n.189G>T splice_region AKT1S1 1 69946 1.42967E-5 34973 0 NA
19-50380054-C-T n.189G>A splice_region AKT1S1 1 69946 1.42967E-5 34973 0 3.18532E-5
19-50380138-G-A c.-286C>T 5_prime_UTR_premature_start_codon_gain AKT1S1 1 43122 2.319E-5 21561 0 NA
19-50380154-G-A c.-302C>T 5_prime_UTR_premature_start_codon_gain AKT1S1 3 39000 7.69231E-5 19500 0 3.82117E-4
19-50380178-A-C c.-326T>G 5_prime_UTR_premature_start_codon_gain AKT1S1 1 32332 3.09291E-5 16166 0 NA
19-50380236-G-A c.-384C>T 5_prime_UTR_premature_start_codon_gain AKT1S1 2 12834 1.55836E-4 6417 0 NA
19-50380560-T-C c.-74A>G 5_prime_UTR_premature_start_codon_gain AKT1S1 2 5594 3.57526E-4 2797 0 NA
19-50380583-G-A c.-97C>T 5_prime_UTR_premature_start_codon_gain AKT1S1 1 8244 1.213E-4 4122 0 3.18329E-5
19-50380587-T-C c.-101A>G 5_prime_UTR_premature_start_codon_gain AKT1S1 8 9194 8.70133E-4 4597 0 0.00124148
19-50380641-A-T c.-729T>A 5_prime_UTR_premature_start_codon_gain AKT1S1 1 25346 3.9454E-5 12673 0 NA
19-50380671-G-A c.-759C>T 5_prime_UTR_premature_start_codon_gain AKT1S1 1 35488 2.81785E-5 17744 0 NA
19-50380721-G-A c.-809C>T 5_prime_UTR_premature_start_codon_gain AKT1S1 1 50022 1.99912E-5 25011 0 3.18431E-5
19-50380726-G-C c.-814C>G 5_prime_UTR_premature_start_codon_gain AKT1S1 1 51216 1.95251E-5 25608 0 NA
19-50380759-T-C c.-847A>G 5_prime_UTR_premature_start_codon_gain AKT1S1 1 58462 1.71051E-5 29231 0 NA
19-50380771-C-A c.-859G>T 5_prime_UTR_premature_start_codon_gain AKT1S1 2 63334 3.15786E-5 31667 0 NA
19-50380798-G-A c.-886C>T 5_prime_UTR_premature_start_codon_gain AKT1S1 1 67762 1.47575E-5 33881 0 NA
19-50380802-C-A c.-890G>T 5_prime_UTR_premature_start_codon_gain AKT1S1 2 68742 2.90943E-5 34371 0 NA
19-50380804-C-A c.-892G>T 5_prime_UTR_premature_start_codon_gain AKT1S1 1 70106 1.42641E-5 35053 0 NA
19-50380809-G-A c.-897C>T 5_prime_UTR_premature_start_codon_gain AKT1S1 4 71060 5.62905E-5 35530 0 NA
19-50380941-A-C c.-1029T>G 5_prime_UTR_premature_start_codon_gain AKT1S1 63 81432 7.73652E-4 40716 0 7.32344E-4
19-50380954-G-A c.-1042C>T 5_prime_UTR_premature_start_codon_gain AKT1S1 1 81446 1.22781E-5 40723 0 1.44638E-5
19-50380974-G-A c.-1062C>T 5_prime_UTR_premature_start_codon_gain AKT1S1 2 81320 2.45942E-5 40660 0 NA
19-50381117-G-A c.-1205C>T 5_prime_UTR_premature_start_codon_gain AKT1S1 1 78706 1.27055E-5 39353 0 NA
19-50381140-C-T c.-1228G>A 5_prime_UTR_premature_start_codon_gain AKT1S1 4 76760 5.21105E-5 38380 0 NA
19-50381146-C-A c.-1234G>T 5_prime_UTR_premature_start_codon_gain AKT1S1 1 76212 1.31213E-5 38106 0 NA
19-50381160-G-A c.-1248C>T 5_prime_UTR_premature_start_codon_gain AKT1S1 1 74368 1.34466E-5 37184 0 NA
19-50381242-G-C c.-1330C>G 5_prime_UTR_premature_start_codon_gain AKT1S1 9 69754 1.29025E-4 34877 1 6.42096E-5
19-50381248-G-A c.-1336C>T 5_prime_UTR_premature_start_codon_gain AKT1S1 2 70122 2.85217E-5 35061 0 NA
19-50381284-A-G c.-1372T>C 5_prime_UTR_premature_start_codon_gain AKT1S1 2 74284 2.69237E-5 37142 0 6.38896E-5
19-50381425-A-G c.-8+2T>C splice_donor AKT1S1 22 81326 2.70516E-4 40663 0 0.00203874
19-50381426-C-T c.-8+1G>A splice_donor AKT1S1 1 81350 1.22926E-5 40675 0 NA
19-50381434-C-G c.-15G>C 5_prime_UTR_premature_start_codon_gain AKT1S1 2 81386 2.45743E-5 40693 0 NA
19-50381485-G-A c.-66C>T 5_prime_UTR_premature_start_codon_gain AKT1S1 7 81570 8.58159E-5 40785 0 5.42293E-5
19-50381549-G-A c.-130C>T 5_prime_UTR_premature_start_codon_gain AKT1S1 2 80988 2.4695E-5 40494 0 2.42107E-4
19-50381610-G-C c.-191C>G 5_prime_UTR_premature_start_codon_gain AKT1S1 2 81278 2.46069E-5 40639 0 NA
19-50381642-G-A c.-223C>T 5_prime_UTR_premature_start_codon_gain AKT1S1 1 81918 1.22073E-5 40959 0 NA
19-50381674-A-C c.-255T>G 5_prime_UTR_premature_start_codon_gain AKT1S1 1 82398 1.21362E-5 41199 0 NA
19-50381692-A-G c.-273T>C 5_prime_UTR_premature_start_codon_gain AKT1S1 1 82650 1.20992E-5 41325 0 3.18512E-5