Variant

Variant ID Consequence Effect Gene AC AN AF NS NHOM maxEAF
14-105235921-GATC-G p.Ter163delins??? stop_lost AKT1 3 13014 2.30521E-4 6507 0 2.37767E-5
14-105235937-G-C p.Leu159Val missense AKT1 1 13024 7.67813E-5 6512 0 NA
14-105235944-G-A p.Thr156Thr synonymous AKT1 1 13036 7.67106E-5 6518 0 2.4853E-5
14-105236310-G-T c.*368C>A splice_region AKT1 3 10720 2.79851E-4 5360 0 1.91241E-4
14-105236684-C-T p.Thr479Thr synonymous AKT1 1 81156 1.23219E-5 40578 0 1.03496E-5
14-105236685-G-A p.Thr479Met missense AKT1 2 81140 2.46488E-5 40570 0 3.08141E-5
14-105236688-C-A p.Gly478Val missense AKT1 1 81204 1.23147E-5 40602 0 NA
14-105236689-C-T p.Gly478Ser missense AKT1 1 81204 1.23147E-5 40602 0 4.07286E-6
14-105236690-G-A p.Ser477Ser synonymous AKT1 1 81170 1.23198E-5 40585 0 9.55353E-5
14-105236696-C-T p.Ser475Ser synonymous AKT1 1 81190 1.23168E-5 40595 0 2.89346E-5
14-105236705-G-A p.Phe472Phe synonymous AKT1 4 81252 4.92296E-5 40626 0 6.57907E-5
14-105236711-G-C p.Pro470Pro synonymous AKT1 1 81210 1.23138E-5 40605 0 NA
14-105236727-C-T p.Arg465His missense AKT1 19 80960 2.34684E-4 40480 0 6.25E-4
14-105236728-G-A p.Arg465Cys missense AKT1 1 80906 1.236E-5 40453 0 1.87593E-5
14-105236731-C-T p.Glu464Lys missense AKT1 2 80938 2.47103E-5 40469 0 3.66644E-5
14-105236732-G-A p.Ser463Ser synonymous AKT1 64 80928 7.90826E-4 40464 1 0.00206993
14-105236741-A-G p.Cys460Cys synonymous AKT1 23 80798 2.84661E-4 40399 0 3.50408E-4
14-105236748-A-T p.Met458Lys missense AKT1 2 80812 2.47488E-5 40406 0 1.64897E-5
14-105237079-C-T c.1363+3G>A splice_region AKT1 1 80206 1.24679E-5 40103 0 NA
14-105237109-T-C p.Met446Val missense AKT1 1 79888 1.25175E-5 39944 0 NA
14-105237116-C-T p.Thr443Thr synonymous AKT1 3 79492 3.77396E-5 39746 0 1.075E-4
14-105237152-C-T p.Ser431Ser synonymous AKT1 1 77582 1.28896E-5 38791 0 3.1873E-5
14-105237155-C-T p.Thr430Thr synonymous AKT1 2 77340 2.58598E-5 38670 0 6.37064E-5
14-105237156-G-A p.Thr430Met missense AKT1 2 77298 2.58739E-5 38649 0 8.41156E-6
14-105238697-C-T c.1260+5G>A splice_region AKT1 2 82728 2.41756E-5 41364 0 8.7581E-5
14-105238698-G-A c.1260+4C>T splice_region AKT1 3 82746 3.62555E-5 41373 0 3.18593E-5
14-105238701-C-G c.1260+1G>C splice_donor AKT1 1 82790 1.20788E-5 41395 0 3.98023E-6
14-105238705-C-T p.Lys419Lys synonymous AKT1 1 82856 1.20691E-5 41428 0 NA
14-105238711-G-A p.Tyr417Tyr synonymous AKT1 1109 82800 0.0133937 41400 12 0.0131333
14-105238713-A-C p.Tyr417Asp missense AKT1 1 82870 1.20671E-5 41435 0 3.97953E-6
14-105238729-G-A p.Ile411Ile synonymous AKT1 14 82866 1.68947E-4 41433 0 1.0348E-4
14-105238734-C-T p.Gly410Ser missense AKT1 2 82814 2.41505E-5 41407 0 9.55718E-5
14-105238735-G-A p.Ala409Ala synonymous AKT1 9 82822 1.08667E-4 41411 0 0.00100806
14-105238745-C-T p.Arg406His missense AKT1 1 82752 1.20843E-5 41376 0 3.18552E-5
14-105238746-G-A p.Arg406Cys missense AKT1 1 82752 1.20843E-5 41376 0 8.29091E-6
14-105238756-G-A p.Ile402Ile synonymous AKT1 3 82600 3.63196E-5 41300 0 3.31928E-5
14-105238763-T-G p.Lys400Thr missense AKT1 1 82432 1.21312E-5 41216 0 NA
14-105238768-G-A p.Asp398Asp synonymous AKT1 7 82160 8.51996E-5 41080 0 5.04032E-4
14-105238771-C-T p.Glu397Glu synonymous AKT1 1 82080 1.21832E-5 41040 0 3.18512E-5
14-105238772-T-G p.Glu397Ala missense AKT1 1 81914 1.22079E-5 40957 0 4.995E-5
14-105238773-C-T p.Glu397Lys missense AKT1 3 81860 3.66479E-5 40930 0 4.17941E-5
14-105238774-G-A p.Ser396Ser synonymous AKT1 4 81960 4.88043E-5 40980 0 NA
14-105238779-C-T p.Gly395Ser missense AKT1 1 82246 1.21586E-5 41123 0 NA
14-105238783-G-A p.Gly393Gly synonymous AKT1 374 82172 0.00455143 41086 4 0.00853775
14-105238795-G-C c.1173-6C>G splice_region AKT1 1 82074 1.21841E-5 41037 0 3.98921E-6
14-105238797-C-T c.1173-8G>A splice_region AKT1 1 81990 1.21966E-5 40995 0 1.59619E-5
14-105239210-C-T c.1172+5G>A splice_region AKT1 1 81484 1.22723E-5 40742 0 1.23253E-5
14-105239246-A-C p.Ser381Ala missense AKT1 1 82662 1.20975E-5 41331 0 NA
14-105239264-C-T p.Glu375Lys missense AKT1 1 82932 1.20581E-5 41466 0 6.39223E-5
14-105239265-G-A p.Pro374Pro synonymous AKT1 2 82936 2.4115E-5 41468 0 1.2505E-4
14-105239268-A-T p.Gly373Gly synonymous AKT1 1 82990 1.20496E-5 41495 0 NA
14-105239270-C-A p.Gly373Cys missense AKT1 1 83008 1.2047E-5 41504 0 NA
14-105239275-G-T p.Thr371Lys missense AKT1 2 83064 2.40778E-5 41532 0 3.18918E-5
14-105239275-G-A p.Thr371Met missense AKT1 1 83064 1.20389E-5 41532 0 1.65843E-5
14-105239275-GT-TG p.Thr371Gln missense AKT1 1 83064 1.20389E-5 41532 0 NA
14-105239279-G-A p.Arg370Cys missense AKT1 3 83104 3.60993E-5 41552 0 3.31241E-5
14-105239280-C-T p.Pro369Pro synonymous AKT1 10 83110 1.20322E-4 41555 0 1.5952E-4
14-105239287-C-T p.Arg367His missense AKT1 1 83156 1.20256E-5 41578 0 1.19372E-5
14-105239328-G-A p.Asp40Asp splice_region+synonymous AKT1 2 83258 2.40217E-5 41629 0 1.64832E-5
14-105239334-G-A c.118-4C>T splice_region AKT1 1 83258 1.20109E-5 41629 0 1.64813E-5
14-105239340-G-A p.Phe349Phe synonymous AKT1 1 83244 1.20129E-5 41622 0 NA
14-105239355-G-A p.Cys344Cys synonymous AKT1 59 83222 7.08947E-4 41611 0 0.00137091
14-105239367-G-A p.Tyr340Tyr synonymous AKT1 253 83202 0.00304079 41601 0 0.0025131
14-105239367-G-C p.Tyr340* stop_gained AKT1 1 83204 1.20187E-5 41602 0 NA
14-105239371-A-G p.Met339Thr missense AKT1 1 83192 1.20204E-5 41596 0 NA
14-105239379-G-A p.Gly336Gly synonymous AKT1 2 83152 2.40523E-5 41576 0 3.97776E-6
14-105239408-C-T p.Gly327Ser missense AKT1 2 83094 2.40691E-5 41547 0 3.97962E-6
14-105239409-G-A p.Tyr326Tyr synonymous AKT1 2 83088 2.40709E-5 41544 0 3.18674E-5
14-105239415-A-G p.Asn324Asn synonymous AKT1 2 83058 2.40796E-5 41529 0 NA
14-105239416-T-C p.Asn324Ser missense AKT1 1 83050 1.20409E-5 41525 0 8.24402E-6
14-105239435-C-T c.958-6G>A splice_region AKT1 3 82850 3.621E-5 41425 0 1.31987E-4
14-105239436-G-A c.958-7C>T splice_region AKT1 111 82836 0.00134 41418 3 0.009375
14-105239581-C-T c.957+7G>A splice_region AKT1 5 82708 6.04536E-5 41354 0 3.18857E-5
14-105239582-G-A c.957+6C>T splice_region AKT1 1 82712 1.20901E-5 41356 0 1.19578E-5
14-105239591-G-A p.Pro318Pro synonymous AKT1 6 82810 7.2455E-5 41405 0 3.30622E-5
14-105239594-G-T p.Ala317Ala synonymous AKT1 1 82874 1.20665E-5 41437 0 1.59408E-4
14-105239615-G-A p.Cys310Cys synonymous AKT1 4 82908 4.82462E-5 41454 0 9.56511E-5
14-105239639-G-A c.-10C>T 5_prime_UTR_premature_start_codon_gain AKT1 2 83008 2.40941E-5 41504 0 9.56328E-5
14-105239682-A-C p.Ile288Ser missense AKT1 1 82972 1.20523E-5 41486 0 NA
14-105239690-G-A p.Asp285Asp synonymous AKT1 5 82914 6.03034E-5 41457 0 1.27559E-4
14-105239699-C-G p.Leu282Leu synonymous AKT1 1 82922 1.20595E-5 41461 0 NA
14-105239716-GCTAGGGGAAAGGTGGCCTCAGGTCAGTGCCGCCAGGCCCCCAGGGCCCTGCCCCCCTGCCTGCCCGCCAGCGCAC-G c.828+1_829-1delGTGCGCTGGCGGGCAGGCAGGGGGGCAGGGCCCTGGGGGCCTGGCGGCACTGACCTGAGGCCACCTTTCCCCTAG splice_acceptor AKT1 15 82810 1.81138E-4 41405 7 NA
14-105239720-G-A c.829-4C>T splice_region AKT1 2 82792 2.41569E-5 41396 0 5.80027E-5
14-105239720-G-C c.829-4C>G splice_region AKT1 1 82792 1.20785E-5 41396 0 NA
14-105239788-G-A c.828+4C>T splice_region AKT1 3 82480 3.63725E-5 41240 0 7.61615E-5
14-105239813-G-A c.-34C>T 5_prime_UTR_premature_start_codon_gain AKT1 2 82448 2.42577E-5 41224 0 9.56206E-5
14-105239822-C-T p.Ser266Ser synonymous AKT1 23 82494 2.78808E-4 41247 0 5.18798E-5
14-105239823-G-A p.Ser266Leu missense AKT1 1 82496 1.21218E-5 41248 0 3.18756E-5
14-105239830-G-A p.Leu264Leu synonymous AKT1 1 82528 1.21171E-5 41264 0 1.74526E-5
14-105239831-G-A p.Tyr263Tyr synonymous AKT1 1 82506 1.21203E-5 41253 0 8.72539E-6
14-105239837-C-T p.Leu261Leu synonymous AKT1 3 82482 3.63716E-5 41241 0 6.37714E-5
14-105239850-A-G p.Ile257Thr missense AKT1 2 82464 2.4253E-5 41232 0 NA
14-105239857-C-T p.Ala255Thr missense AKT1 4 82404 4.85413E-5 41202 0 9.11793E-6
14-105239858-G-A p.Gly254Gly synonymous AKT1 1 82368 1.21406E-5 41184 0 3.18756E-5
14-105239864-G-A p.Phe252Phe synonymous AKT1 1 82358 1.21421E-5 41179 0 NA
14-105239868-C-T p.Arg251His missense AKT1 3 82262 3.64688E-5 41131 0 1.88445E-5
14-105239869-G-A p.Arg251Cys missense AKT1 2 82238 2.43197E-5 41119 0 6.3743E-5
14-105239882-G-A p.Ser246Ser synonymous AKT1 5 81796 6.11277E-5 40898 0 6.37308E-5
14-105239884-A-C p.Ser246Ala missense AKT1 1 81788 1.22267E-5 40894 0 9.8744E-6
14-105239885-G-A p.Phe245Phe synonymous AKT1 1 81784 1.22273E-5 40892 0 NA
14-105239894-C-T p.Glu242Glu synonymous AKT1 19014 80490 0.236228 40245 2497 0.314133
14-105239915-C-A p.Leu235Leu splice_region+synonymous AKT1 2 80898 2.47225E-5 40449 0 6.37349E-5
14-105239917-G-C p.Leu235Val missense+splice_region AKT1 3 80788 3.71342E-5 40394 0 6.37349E-5
14-105239921-C-T c.703-4G>A splice_region AKT1 3 80462 3.72847E-5 40231 0 3.95007E-5
14-105240255-C-T p.Gly232Gly synonymous AKT1 2 80742 2.47703E-5 40371 0 1.26461E-5
14-105240258-G-A p.Asn231Asn synonymous AKT1 2 80802 2.47519E-5 40401 0 4.81383E-5
14-105240286-C-T p.Arg222His missense AKT1 3 81272 3.69131E-5 40636 0 1.03018E-5
14-105240287-G-A p.Arg222Cys missense AKT1 4 81258 4.92259E-5 40629 0 2.05782E-5
14-105240291-G-A p.His220His synonymous AKT1 11 81128 1.35588E-4 40564 0 9.57243E-5
14-105240301-A-G p.Phe217Ser missense AKT1 1 81226 1.23113E-5 40613 0 NA
14-105240303-A-G p.Ser216Ser synonymous AKT1 1 81272 1.23044E-5 40636 0 NA
14-105241275-T-C p.Thr211Thr splice_region+synonymous AKT1 3 82076 3.65515E-5 41038 0 NA
14-105241294-G-C p.Ser205Cys missense AKT1 1 82578 1.21098E-5 41289 0 4.00067E-6
14-105241304-G-A p.Leu202Leu synonymous AKT1 1421 82670 0.0171888 41335 63 0.0365192
14-105241308-G-A p.Arg200Arg synonymous AKT1 1 82700 1.20919E-5 41350 0 2.5038E-5
14-105241310-G-A p.Arg200Cys missense AKT1 1 82734 1.20869E-5 41367 0 3.99623E-6
14-105241326-G-C p.His194Gln missense AKT1 1 82758 1.20834E-5 41379 0 NA
14-105241339-TCCTGTAAAGCAGGGCTGGGTGAGCTGCCACCCCGCACCCTCATCTCCACCCTGCCCCACCGCCCCGGCCCCA-T p.Asp190fs frameshift AKT1 15 82712 1.81352E-4 41356 7 NA
14-105241405-G-A c.567+8C>T splice_region AKT1 1 82512 1.21194E-5 41256 0 3.19076E-5
14-105241422-G-A p.Ile186Ile synonymous AKT1 844 82822 0.0101905 41411 25 0.0199439
14-105241455-G-A p.Tyr175Tyr synonymous AKT1 2 83054 2.40807E-5 41527 0 8.26173E-6
14-105241459-C-T p.Arg174His missense AKT1 1 83060 1.20395E-5 41530 0 7.95665E-6
14-105241460-G-A p.Arg174Cys missense AKT1 3 83060 3.61185E-5 41530 0 3.18613E-5
14-105241485-G-A p.Ile165Ile synonymous AKT1 2 83060 2.4079E-5 41530 0 3.18695E-5
14-105241488-C-T p.Val164Val synonymous AKT1 1 83062 1.20392E-5 41531 0 NA
14-105241527-C-T p.Glu151Glu synonymous AKT1 3 82964 3.61603E-5 41482 0 2.4825E-5
14-105241533-C-T p.Glu149Glu synonymous AKT1 1 82904 1.20621E-5 41452 0 NA
14-105241535-C-T p.Glu149Lys missense AKT1 2 82868 2.41348E-5 41434 0 NA
14-105241536-G-A p.Asn148Asn synonymous AKT1 3 82856 3.62074E-5 41428 0 2.48513E-5
14-105241540-A-G p.Met147Thr missense AKT1 2 82826 2.4147E-5 41413 0 1.99275E-5
14-105241542-G-A p.Thr146Thr splice_region+synonymous AKT1 5 82786 6.03967E-5 41393 0 4.78404E-5
14-105241545-CT-C c.436-2delA splice_acceptor AKT1 1 82746 1.20852E-5 41373 0 NA
14-105241547-A-G c.436-3T>C splice_region AKT1 5 82684 6.04712E-5 41342 0 1.07769E-4
14-105241552-C-T c.436-8G>A splice_region AKT1 1 82540 1.21153E-5 41270 0 NA
14-105241992-G-A p.Arg144Arg synonymous AKT1 20 82330 2.42925E-4 41165 0 5.7387E-4
14-105241993-C-T p.Arg144His missense AKT1 1 82366 1.21409E-5 41183 0 3.98788E-6
14-105242018-C-T p.Val136Met missense AKT1 19 82844 2.29347E-4 41422 0 1.11423E-4
14-105242037-T-C p.Ser129Ser synonymous AKT1 5 83004 6.02381E-5 41502 0 2.47504E-5
14-105242041-T-A p.Asn128Ile missense AKT1 1 82992 1.20494E-5 41496 0 NA
14-105242055-G-A p.Gly123Gly synonymous AKT1 1 83002 1.20479E-5 41501 0 NA
14-105242059-G-A p.Ser122Leu missense AKT1 6 83014 7.2277E-5 41507 1 3.18959E-5
14-105242063-G-A p.Arg121Trp missense AKT1 1 83024 1.20447E-5 41512 0 3.18837E-5
14-105242072-TCTC-T p.Glu117del conservative_inframe_deletion AKT1 1 82926 1.20589E-5 41463 0 3.19203E-5
14-105242072-T-TCTCCTC p.Glu116_Glu117dup conservative_inframe_insertion AKT1 1 82960 1.2054E-5 41480 0 NA
14-105242072-T-TCTC p.Glu117dup conservative_inframe_insertion AKT1 1 82960 1.2054E-5 41480 0 3.98156E-6
14-105242073-C-T p.Glu117Glu synonymous AKT1 1 82976 1.20517E-5 41488 0 6.37959E-5
14-105242081-C-T p.Glu115Lys missense AKT1 1 83004 1.20476E-5 41502 0 3.18776E-5
14-105242087-GCTT-G p.Lys112del conservative_inframe_deletion AKT1 1 82940 1.20569E-5 41470 0 NA
14-105242099-C-G p.Gly109Arg missense AKT1 2 82894 2.41272E-5 41447 0 3.9807E-6
14-105242100-G-A p.Asp108Asp synonymous AKT1 7 82876 8.44635E-5 41438 0 3.18939E-5
14-105242105-CCA-C p.Val106fs frameshift AKT1 1 82892 1.20639E-5 41446 0 NA
14-105242110-G-A p.Thr105Ile missense AKT1 1 82856 1.20691E-5 41428 0 NA
14-105242121-G-A p.Thr101Thr synonymous AKT1 2 82716 2.41791E-5 41358 0 3.32768E-5
14-105242139-G-A c.288-3C>T splice_region AKT1 8 82408 9.7078E-5 41204 0 1.27494E-4
14-105242140-CAGG-C c.288-7_288-5delCCT splice_region AKT1 1 82394 1.21368E-5 41197 0 6.37471E-5
14-105242991-C-T c.287+5G>A splice_region AKT1 2 82442 2.42595E-5 41221 0 0.00125
14-105242992-G-A c.287+4C>T splice_region AKT1 1 82478 1.21244E-5 41239 0 8.38448E-6
14-105242996-C-T p.Arg96Gln missense+splice_region AKT1 1 82612 1.21048E-5 41306 0 NA
14-105243005-G-T p.Pro93His missense AKT1 3 82760 3.62494E-5 41380 0 3.18593E-5
14-105243016-A-G p.His89His synonymous AKT1 5 82870 6.03355E-5 41435 0 2.79245E-5
14-105243031-G-A p.Ile84Ile synonymous AKT1 1 82952 1.20552E-5 41476 0 7.97563E-6
14-105243046-C-T p.Gln79Gln synonymous AKT1 15 82978 1.80771E-4 41489 0 0.00906344
14-105243083-C-T p.Arg67Gln missense AKT1 4 82800 4.83092E-5 41400 0 NA
14-105243084-G-A p.Arg67Trp missense AKT1 3 82742 3.62573E-5 41371 0 1.59804E-5
14-105243088-C-T p.Thr65Thr synonymous AKT1 3 82732 3.62617E-5 41366 0 1.08527E-4
14-105243097-C-T p.Leu62Leu synonymous AKT1 1 82474 1.2125E-5 41237 0 8.38757E-6
14-105243111-C-T c.176-4G>A splice_region AKT1 6 81904 7.32565E-5 40952 0 9.57488E-5
14-105243112-G-T c.176-5C>A splice_region AKT1 4 81904 4.88377E-5 40952 0 2.55524E-5
14-105243112-G-A c.176-5C>T splice_region AKT1 1 81904 1.22094E-5 40952 0 1.61058E-5
14-105243888-CACCTGGGGAACACAT-C c.-12+3_-12+17delATGTGTTCCCCAGGT splice_region AKT1 1 25190 3.96983E-5 12595 0 6.38162E-5
14-105243931-C-T c.-37G>A 5_prime_UTR_premature_start_codon_gain AKT1 168 24872 0.00675458 12436 2 0.0180143
14-105243937-C-G c.-43G>C 5_prime_UTR_premature_start_codon_gain AKT1 1 24856 4.02317E-5 12428 0 1.91217E-4
14-105246421-T-C c.175+4A>G splice_region AKT1 1 83040 1.20424E-5 41520 0 NA
14-105246426-C-T p.Ala58Ala splice_region+synonymous AKT1 10 83044 1.20418E-4 41522 0 6.3884E-5
14-105246427-G-A p.Ala58Val missense+splice_region AKT1 2 83036 2.40859E-5 41518 0 NA
14-105246457-C-T p.Arg48His missense AKT1 5 83092 6.01743E-5 41546 0 2.39261E-5
14-105246458-G-A p.Arg48Cys missense AKT1 4 83092 4.81394E-5 41546 0 5.81917E-5
14-105246459-T-C p.Gln47Gln synonymous AKT1 1 83100 1.20337E-5 41550 0 5.58267E-5
14-105246462-G-T p.Asp46Glu missense AKT1 50 83082 6.01815E-4 41541 0 3.26951E-4
14-105246468-A-G p.Asp44Asp synonymous AKT1 1 83080 1.20366E-5 41540 0 7.97607E-6
14-105246474-C-T p.Pro42Pro synonymous AKT1 16 83044 1.92669E-4 41522 0 1.59226E-4
14-105246474-C-A p.Pro42Pro synonymous AKT1 1 83044 1.20418E-5 41522 0 NA
14-105246478-C-T p.Arg41Gln missense AKT1 1 83024 1.20447E-5 41512 0 3.18431E-5
14-105246480-C-T p.Glu40Glu synonymous AKT1 3 83008 3.61411E-5 41504 0 8.32834E-5
14-105246486-G-A p.Tyr38Tyr synonymous AKT1 1 83040 1.20424E-5 41520 0 8.33778E-6
14-105246493-A-G p.Ile36Thr missense AKT1 1 83038 1.20427E-5 41519 0 8.32792E-6
14-105246532-C-G p.Arg23Pro missense AKT1 1 82674 1.20957E-5 41337 0 NA
14-105246558-A-G c.47-5T>C splice_region AKT1 1 82296 1.21513E-5 41148 0 3.18451E-5
14-105246561-C-T c.47-8G>A splice_region AKT1 4 82164 4.86831E-5 41082 0 5.91756E-5
14-105246561-C-A c.47-8G>T splice_region AKT1 1 82164 1.21708E-5 41082 0 8.02182E-6
14-105258964-A-G p.Ile6Thr missense AKT1 1 83012 1.20465E-5 41506 0 4.01419E-6
14-105258965-T-C p.Ile6Val missense AKT1 1 83004 1.20476E-5 41502 0 NA
14-105258971-C-T p.Val4Met missense AKT1 2 82978 2.41028E-5 41489 0 4.78377E-4
14-105258972-G-A p.Asp3Asp synonymous AKT1 1 82962 1.20537E-5 41481 0 5.01916E-5
14-105258974-C-T p.Asp3Asn missense AKT1 9 82950 1.08499E-4 41475 0 1.59449E-4
14-105258975-G-A p.Ser2Ser synonymous AKT1 4 82946 4.82241E-5 41473 0 6.37918E-5
14-105258988-G-A c.-8C>T 5_prime_UTR_premature_start_codon_gain AKT1 4 82884 4.82602E-5 41442 0 6.25E-4
14-105258988-G-C c.-8C>G 5_prime_UTR_premature_start_codon_gain AKT1 3 82884 3.61952E-5 41442 0 2.02405E-5
14-105258996-C-A c.-16G>T 5_prime_UTR_premature_start_codon_gain AKT1 1 82802 1.2077E-5 41401 0 NA
14-105258999-G-A c.-19C>T 5_prime_UTR_premature_start_codon_gain AKT1 3 82716 3.62687E-5 41358 0 3.19163E-4
14-105259020-G-A c.-40C>T 5_prime_UTR_premature_start_codon_gain AKT1 1 82348 1.21436E-5 41174 0 NA
14-105259060-C-CGGGCCGCCGCG c.-79-2_-79-1insCGCGGCGGCCC splice_acceptor AKT1 1 81100 1.23305E-5 40550 0 NA
14-105259140-C-T c.-160G>A 5_prime_UTR_premature_start_codon_gain AKT1 1 58858 1.699E-5 29429 0 NA
14-105259145-C-T c.-165G>A 5_prime_UTR_premature_start_codon_gain AKT1 3 55712 5.38484E-5 27856 0 NA
14-105259248-C-T c.-268G>A 5_prime_UTR_premature_start_codon_gain AKT1 1 22482 4.448E-5 11241 0 NA
14-105259347-C-A c.-367G>T 5_prime_UTR_premature_start_codon_gain AKT1 1 7938 1.25976E-4 3969 0 6.37389E-5
14-105259415-G-A c.-435C>T 5_prime_UTR_premature_start_codon_gain AKT1 3 4514 6.64599E-4 2257 0 3.21543E-4
14-105260193-C-A c.-809G>T 5_prime_UTR_premature_start_codon_gain AKT1 2 516 0.00387597 258 0 0.00159286
14-105260492-G-C c.-1108C>G 5_prime_UTR_premature_start_codon_gain AKT1 8 248 0.0322581 124 0 0.0125486