Variant

Variant ID Consequence Effect Gene AC AN AF NS NHOM maxEAF
1-46016379-G-A c.-583G>A 5_prime_UTR_premature_start_codon_gain AKR1A1 3 1826 0.00164294 913 0 4.14065E-4
1-46016548-AGTGAGTGACCAAGTTCCGGCCAGTTCGACCTCGAGGATCCAGAGGTGGAGACGGTACTACCTCCCAGCTCTGTTTTCCATCCCCTTCAG-A c.-325+3_-323delGAGTGACCAAGTTCCGGCCAGTTCGACCTCGAGGATCCAGAGGTGGAGACGGTACTACCTCCCAGCTCTGTTTTCCATCCCCTTCAGGT splice_acceptor AKR1A1 5 2896 0.00172652 1448 0 NA
1-46016688-A-T c.-274A>T 5_prime_UTR_premature_start_codon_gain AKR1A1 2 3024 6.61376E-4 1512 0 9.55962E-4
1-46016754-C-G c.-80C>G 5_prime_UTR_premature_start_codon_gain AKR1A1 1 2978 3.35796E-4 1489 0 6.36862E-5
1-46027453-T-A c.-6-8T>A splice_region AKR1A1 1 83030 1.20438E-5 41515 0 NA
1-46027459-AG-A c.-6-1delG splice_acceptor AKR1A1 1 83102 1.20334E-5 41551 0 NA
1-46027462-G-A c.-5G>A splice_region AKR1A1 1 83136 1.20285E-5 41568 0 8.23845E-6
1-46027471-C-T p.Ala2Val missense AKR1A1 2 83174 2.4046E-5 41587 0 3.58106E-5
1-46027477-C-T p.Ser4Phe missense AKR1A1 87 83196 0.00104572 41598 0 0.00149682
1-46027482-G-A p.Val6Ile missense AKR1A1 1 83218 1.20166E-5 41609 0 NA
1-46027489-T-TG p.His9fs frameshift AKR1A1 1 83246 1.20126E-5 41623 0 NA
1-46027499-G-C p.Gly11Gly synonymous AKR1A1 4 83232 4.80584E-5 41616 0 3.18431E-4
1-46027523-G-C p.Leu19Leu synonymous AKR1A1 1 83176 1.20227E-5 41588 0 3.97709E-6
1-46027529-C-A p.Thr21Thr synonymous AKR1A1 1 83134 1.20288E-5 41567 0 NA
1-46027534-A-G p.Lys23Arg missense AKR1A1 1 83104 1.20331E-5 41552 0 NA
1-46027537-G-A p.Ser24Asn missense AKR1A1 1 83090 1.20351E-5 41545 0 NA
1-46027549-AG-A p.Glu25fs frameshift AKR1A1 1 82988 1.20499E-5 41494 0 3.97833E-6
1-46027558-A-G c.84+8A>G splice_region AKR1A1 1 82820 1.20744E-5 41410 0 NA
1-46032234-C-T c.85-7C>T splice_region AKR1A1 2 83226 2.4031E-5 41613 0 NA
1-46032240-G-A c.85-1G>A splice_acceptor AKR1A1 1 83262 1.20103E-5 41631 0 1.65191E-5
1-46032260-A-G p.Tyr35Cys missense AKR1A1 2 83272 2.40177E-5 41636 0 1.64886E-5
1-46032262-G-A p.Ala36Thr missense AKR1A1 2 83278 2.40159E-5 41639 0 4.12201E-5
1-46032271-G-A p.Val39Ile missense AKR1A1 2 83278 2.40159E-5 41639 0 3.1835E-5
1-46032280-C-T p.Arg42Cys missense AKR1A1 1 83312 1.20031E-5 41656 0 3.1839E-5
1-46032281-G-A p.Arg42His missense AKR1A1 1 83310 1.20034E-5 41655 0 7.95564E-6
1-46032286-A-G p.Ile44Val missense AKR1A1 1 83336 1.19996E-5 41668 0 NA
1-46032288-T-A p.Ile44Ile synonymous AKR1A1 1 83342 1.19988E-5 41671 0 8.23778E-6
1-46032295-GC-G p.Ala47fs frameshift AKR1A1 11 83348 1.31977E-4 41674 0 3.54224E-4
1-46032306-C-T p.Tyr50Tyr synonymous AKR1A1 2 83360 2.39923E-5 41680 0 2.78396E-5
1-46032307-G-A p.Gly51Ser missense AKR1A1 564 83356 0.00676616 41678 5 0.00706813
1-46032311-A-G p.Asn52Ser missense AKR1A1 3242 83300 0.0389196 41650 78 0.0460103
1-46032339-G-GGAGGACGTGGGACCAGGCAAGGT p.Ala59fs frameshift AKR1A1 3 83342 3.59963E-5 41671 0 NA
1-46032344-A-G p.Asp63Gly missense AKR1A1 1 83338 1.19993E-5 41669 0 NA
1-46032345-C-T p.Asp63Asp synonymous AKR1A1 1 83332 1.20002E-5 41666 0 7.95716E-6
1-46032346-G-T p.Val64Leu missense AKR1A1 1 83338 1.19993E-5 41669 0 2.47382E-5
1-46032346-G-A p.Val64Met missense AKR1A1 1 83338 1.19993E-5 41669 0 1.64921E-5
1-46032356-G-T p.Gly67Val missense AKR1A1 4 83296 4.80215E-5 41648 0 3.30175E-5
1-46032365-G-A c.204+5G>A splice_region AKR1A1 133 83246 0.00159767 41623 2 0.00149634
1-46032536-A-G c.205-5A>G splice_region AKR1A1 1 82474 1.2125E-5 41237 0 3.9954E-6
1-46032540-G-T c.205-1G>T splice_acceptor AKR1A1 1 82566 1.21115E-5 41283 0 3.99284E-6
1-46032542-C-T p.Ala69Val missense+splice_region AKR1A1 4 82566 4.84461E-5 41283 0 2.23001E-4
1-46032543-G-A p.Ala69Ala splice_region+synonymous AKR1A1 1794 82536 0.021736 41268 24 0.0206865
1-46032548-C-G p.Pro71Arg missense AKR1A1 3 82648 3.62985E-5 41324 0 1.66517E-5
1-46032550-C-T p.Arg72Trp missense AKR1A1 3 82680 3.62845E-5 41340 0 3.18837E-5
1-46032561-G-C p.Leu75Leu synonymous AKR1A1 1 82858 1.20688E-5 41429 0 NA
1-46032564-T-C p.Phe76Phe synonymous AKR1A1 4 82888 4.82579E-5 41444 0 NA
1-46032592-C-T p.His86Tyr missense AKR1A1 3 82970 3.61576E-5 41485 0 1.65019E-5
1-46032608-T-G p.Val91Gly missense AKR1A1 5 83006 6.02366E-5 41503 0 1.27486E-4
1-46032628-ACT-A p.Leu99fs frameshift AKR1A1 1 82984 1.20505E-5 41492 0 NA
1-46032637-G-T p.Asp101Tyr missense AKR1A1 1 82936 1.20575E-5 41468 0 NA
1-46032645-G-T p.Gln103His missense AKR1A1 2 82900 2.41255E-5 41450 0 NA
1-46032656-T-G p.Leu107Arg missense AKR1A1 1 82746 1.20852E-5 41373 0 NA
1-46032684-T-C p.Tyr116Tyr synonymous AKR1A1 1 82050 1.21877E-5 41025 0 3.99326E-6
1-46033629-C-T c.357-4C>T splice_region AKR1A1 6 81078 7.40028E-5 40539 0 1.99466E-4
1-46033655-C-T p.Arg120Trp missense+splice_region AKR1A1 1 81928 1.22058E-5 40964 0 6.38855E-5
1-46033656-G-A p.Arg120Gln missense+splice_region AKR1A1 1 81980 1.21981E-5 40990 0 1.20644E-5
1-46033656-G-C p.Arg120Pro missense+splice_region AKR1A1 1 81980 1.21981E-5 40990 0 1.84945E-5
1-46033661-G-A p.Asp122Asn missense AKR1A1 2 82064 2.43712E-5 41032 0 NA
1-46033666-C-T p.Asn123Asn synonymous AKR1A1 3 82184 3.65035E-5 41092 0 1.20055E-5
1-46033672-C-T p.Phe125Phe synonymous AKR1A1 1 82378 1.21392E-5 41189 0 NA
1-46033681-T-C p.Asn128Asn synonymous AKR1A1 3 82546 3.63434E-5 41273 0 2.52164E-5
1-46033688-G-T p.Gly131Trp missense AKR1A1 2 82638 2.42019E-5 41319 0 8.35129E-6
1-46033690-G-T p.Gly131Gly synonymous AKR1A1 1 82672 1.2096E-5 41336 0 3.19468E-5
1-46033690-G-C p.Gly131Gly synonymous AKR1A1 1 82672 1.2096E-5 41336 0 NA
1-46033692-C-T p.Thr132Ile missense AKR1A1 1 82696 1.20925E-5 41348 0 NA
1-46033702-C-T p.Tyr135Tyr synonymous AKR1A1 2 82774 2.41622E-5 41387 0 7.4643E-5
1-46033703-G-A p.Asp136Asn missense AKR1A1 19 82800 2.29469E-4 41400 0 5.42958E-4
1-46033711-C-T p.Thr138Thr synonymous AKR1A1 217 82914 0.00261717 41457 0 0.00397213
1-46033715-T-C p.Tyr140His missense AKR1A1 1 82958 1.20543E-5 41479 0 2.48151E-5
1-46033716-A-G p.Tyr140Cys missense AKR1A1 23 82968 2.77215E-4 41484 1 2.87448E-4
1-46033721-G-A p.Glu142Lys missense AKR1A1 7 83014 8.43231E-5 41507 0 2.5861E-4
1-46033740-A-T p.Glu148Val missense AKR1A1 3 83052 3.61219E-5 41526 0 6.37918E-5
1-46033748-G-A p.Val151Met missense AKR1A1 35 83092 4.2122E-4 41546 0 0.003125
1-46033753-T-A p.Ala152Ala synonymous AKR1A1 1 83104 1.20331E-5 41552 0 NA
1-46033757-G-A p.Gly154Arg missense AKR1A1 1 83120 1.20308E-5 41560 0 3.97864E-6
1-46033759-G-C p.Gly154Gly synonymous AKR1A1 2 83096 2.40685E-5 41548 0 6.37471E-5
1-46033766-CAG-AAA p.Gln157Lys missense AKR1A1 1 83080 1.20366E-5 41540 0 NA
1-46033770-C-T p.Ala158Val missense AKR1A1 1 83066 1.20386E-5 41533 0 8.32515E-6
1-46033771-G-A p.Ala158Ala synonymous AKR1A1 10 83074 1.20375E-4 41537 0 3.18817E-4
1-46033771-G-C p.Ala158Ala synonymous AKR1A1 1 83074 1.20375E-5 41537 0 NA
1-46033776-G-A p.Gly160Asp missense AKR1A1 1 83098 1.2034E-5 41549 0 1.66834E-5
1-46033778-C-T p.Leu161Leu synonymous AKR1A1 1 83094 1.20346E-5 41547 0 8.34864E-6
1-46033785-A-G p.Asn163Ser missense AKR1A1 4 83074 4.81498E-5 41537 0 NA
1-46033786-C-A p.Asn163Lys missense AKR1A1 1 83084 1.2036E-5 41542 0 3.98096E-6
1-46033788-T-TC p.Asn165fs frameshift AKR1A1 1 83070 1.2038E-5 41535 0 NA
1-46033791-A-C p.Asn165Thr missense AKR1A1 1 83064 1.20389E-5 41532 0 NA
1-46033796-C-T p.Arg167Trp missense AKR1A1 1 83040 1.20424E-5 41520 0 7.96641E-6
1-46033810-C-T p.Asp171Asp synonymous AKR1A1 1 82966 1.20531E-5 41483 0 NA
1-46033811-A-G p.Ile172Val missense AKR1A1 1 82968 1.20528E-5 41484 0 NA
1-46033813-A-C p.Ile172Ile synonymous AKR1A1 1 82966 1.20531E-5 41483 0 NA
1-46033814-C-T p.Leu173Phe missense AKR1A1 3 82946 3.61681E-5 41473 0 2.79225E-5
1-46033817-A-G p.Ser174Gly missense AKR1A1 1 82928 1.20587E-5 41464 0 2.68063E-5
1-46033828-C-T p.Ser177Ser synonymous AKR1A1 3 82808 3.62284E-5 41404 0 6.25E-4
1-46033829-G-A p.Val178Met missense AKR1A1 1 82770 1.20817E-5 41385 0 1.20484E-5
1-46033832-C-G p.Arg179Gly missense AKR1A1 1 82706 1.2091E-5 41353 0 NA
1-46033832-C-T p.Arg179Cys missense AKR1A1 1 82706 1.2091E-5 41353 0 1.20811E-5
1-46033833-G-A p.Arg179His missense AKR1A1 4 82710 4.83617E-5 41355 0 0.00201613
1-46033833-G-T p.Arg179Leu missense AKR1A1 1 82710 1.20904E-5 41355 0 4.03239E-6
1-46033838-G-C p.Ala181Pro missense AKR1A1 6 82626 7.26164E-5 41313 0 3.82336E-4
1-46033841-G-C p.Val182Leu missense AKR1A1 1 82582 1.21092E-5 41291 0 2.14468E-5
1-46034152-C-T c.553-5C>T splice_region AKR1A1 1 82536 1.21159E-5 41268 0 NA
1-46034163-T-C p.Cys187Arg missense AKR1A1 1 82732 1.20872E-5 41366 0 NA
1-46034174-C-T p.Tyr190Tyr synonymous AKR1A1 1 82834 1.20723E-5 41417 0 4.12371E-5
1-46034194-T-C p.Ile197Thr missense AKR1A1 1 82964 1.20534E-5 41482 0 8.24239E-6
1-46034204-C-T p.Cys200Cys synonymous AKR1A1 1 82994 1.20491E-5 41497 0 3.97763E-6
1-46034211-C-T p.Arg203Cys missense AKR1A1 1 82990 1.20496E-5 41495 0 9.55475E-5
1-46034212-G-A p.Arg203His missense AKR1A1 2 82970 2.41051E-5 41485 0 6.37186E-5
1-46034226-A-T p.Thr208Ser missense AKR1A1 1 82992 1.20494E-5 41496 0 NA
1-46034233-A-G p.Tyr210Cys missense AKR1A1 1 83004 1.20476E-5 41502 0 3.97706E-6
1-46034245-G-T p.Gly214Val missense AKR1A1 1 82940 1.20569E-5 41470 0 8.23845E-6
1-46034256-C-T p.Arg218Cys missense AKR1A1 3 82876 3.61987E-5 41438 0 2.78408E-5
1-46034257-G-A p.Arg218His missense AKR1A1 8 82870 9.65367E-5 41435 0 4.94299E-5
1-46034257-G-T p.Arg218Leu missense AKR1A1 4 82870 4.82684E-5 41435 0 3.18532E-5
1-46034262-T-C p.Trp220Arg missense AKR1A1 3 82884 3.61952E-5 41442 0 3.97731E-6
1-46034263-G-T p.Trp220Leu missense AKR1A1 8 82888 9.65158E-5 41444 0 1.27372E-4
1-46034270-T-C p.Asp222Asp synonymous AKR1A1 1 82866 1.20677E-5 41433 0 6.37024E-5
1-46034273-T-C p.Pro223Pro synonymous AKR1A1 1 82864 1.2068E-5 41432 0 NA
1-46034298-C-G p.Pro232Ala missense AKR1A1 1 82700 1.20919E-5 41350 0 3.9788E-6
1-46034301-G-A p.Val233Ile missense AKR1A1 11 82684 1.33037E-4 41342 0 0.00125
1-46034306-C-T p.Val234Val synonymous AKR1A1 1 82662 1.20975E-5 41331 0 NA
1-46034307-C-T p.Leu235Leu synonymous AKR1A1 1 82666 1.20969E-5 41333 0 1.19375E-5
1-46034324-G-A p.Lys240Lys synonymous AKR1A1 1 82556 1.2113E-5 41278 0 NA
1-46034325-T-C p.Tyr241His missense AKR1A1 1 82520 1.21183E-5 41260 0 NA
1-46034329-G-A p.Gly242Asp missense AKR1A1 17 82480 2.06111E-4 41240 0 5.41505E-4
1-46034332-G-A p.Arg243Gln missense AKR1A1 2 82426 2.42642E-5 41213 0 1.65003E-5
1-46034344-A-C p.Gln247Pro missense AKR1A1 1 82328 1.21465E-5 41164 0 NA
1-46034352-C-T p.Leu250Phe missense AKR1A1 1 82198 1.21657E-5 41099 0 NA
1-46034363-G-A c.752+7G>A splice_region AKR1A1 2 82040 2.43784E-5 41020 0 NA
1-46034594-C-T c.753-5C>T splice_region AKR1A1 19 83366 2.27911E-4 41683 1 6.25E-4
1-46034599-G-A p.Arg251Arg splice_region+synonymous AKR1A1 1 83380 1.19933E-5 41690 0 6.25E-4
1-46034612-C-T p.Arg256Trp missense AKR1A1 3 83384 3.59781E-5 41692 0 5.03525E-4
1-46034620-G-A p.Val258Val synonymous AKR1A1 1 83392 1.19916E-5 41696 0 NA
1-46034637-G-A p.Ser264Asn missense AKR1A1 1 83402 1.19901E-5 41701 0 8.23642E-6
1-46034640-T-C p.Ile265Thr missense AKR1A1 1 83402 1.19901E-5 41701 0 2.47093E-5
1-46034651-C-T p.Arg269* stop_gained AKR1A1 2 83406 2.39791E-5 41703 0 2.78354E-5
1-46034652-G-A p.Arg269Gln missense AKR1A1 1 83404 1.19898E-5 41702 0 7.95305E-5
1-46034657-C-T p.Leu271Phe missense AKR1A1 1 83408 1.19893E-5 41704 0 1.59056E-5
1-46034666-A-G p.Ile274Val missense AKR1A1 1 83396 1.1991E-5 41698 0 3.97655E-6
1-46034669-AAGGTACTTGGTAATGGGTTCTATCTTCTTTAGCTCTTTGGGACATTTTCTTGGCCCTGACTCTACCTGGCTAAAAAGGCAGTGTTGTGGAACCCCAGCTTCTGCTCACAAAGCTGGCTTTCTTGAACCCCACTCTCCATCCTC-A p.Lys275fs frameshift AKR1A1 2 83394 2.39825E-5 41697 0 NA
1-46034676-T-G c.825+5T>G splice_region AKR1A1 1 83382 1.1993E-5 41691 0 NA
1-46034683-T-C n.311+5T>C splice_region AKR1A1 1 83384 1.19927E-5 41692 0 NA
1-46034685-G-C n.311+7G>C splice_region AKR1A1 4 83380 4.79731E-5 41690 0 3.18132E-5
1-46034811-T-G c.826-4T>G splice_region AKR1A1 1 83354 1.1997E-5 41677 0 3.18492E-5
1-46034812-C-G c.826-3C>G splice_region AKR1A1 3 83354 3.59911E-5 41677 0 NA
1-46034815-G-T p.Val276Leu missense+splice_region AKR1A1 1 83376 1.19939E-5 41688 0 NA
1-46034816-T-C p.Val276Ala missense+splice_region AKR1A1 12 83382 1.43916E-4 41691 0 0.00625
1-46034837-C-A p.Pro283Gln missense AKR1A1 17 83370 2.0391E-4 41685 0 1.91156E-4
1-46034847-G-A p.Met286Ile missense AKR1A1 1 83378 1.19936E-5 41689 0 3.9764E-6
1-46034850-G-A p.Lys287Lys synonymous AKR1A1 2 83372 2.39889E-5 41686 0 2.38586E-5
1-46034859-T-A p.Asn290Lys missense AKR1A1 1 83376 1.19939E-5 41688 0 3.97643E-6
1-46034866-A-T p.Asn293Tyr missense AKR1A1 2 83368 2.399E-5 41684 0 NA
1-46034876-G-A p.Trp296* stop_gained AKR1A1 1 83366 1.19953E-5 41683 0 8.2375E-6
1-46034879-G-T p.Arg297Ile missense AKR1A1 145 83362 0.0017394 41681 0 0.00535271
1-46034879-G-A p.Arg297Lys missense AKR1A1 8 83362 9.5967E-5 41681 0 7.55563E-5
1-46034879-G-GAT p.Val300fs frameshift AKR1A1 1 83362 1.19959E-5 41681 0 NA
1-46034883-T-C p.Tyr298Tyr synonymous AKR1A1 4 83358 4.79858E-5 41679 0 4.94275E-5
1-46034889-G-A p.Val300Val synonymous AKR1A1 1 83340 1.1999E-5 41670 0 NA
1-46034890-C-T p.Pro301Ser missense AKR1A1 1 83338 1.19993E-5 41669 0 NA
1-46034900-C-T p.Thr304Met missense+splice_region AKR1A1 7 83310 8.40235E-5 41655 0 6.25E-4
1-46035556-T-G c.913-7T>G splice_region AKR1A1 1 82186 1.21675E-5 41093 0 NA
1-46035563-G-A p.Val305Met missense+splice_region AKR1A1 1 82366 1.21409E-5 41183 0 8.26569E-6
1-46035568-T-C p.Asp306Asp synonymous AKR1A1 1 82424 1.21324E-5 41212 0 1.65183E-5
1-46035571-G-A p.Gly307Gly synonymous AKR1A1 107 82474 0.00129738 41237 2 0.0151057
1-46035572-AAG-A p.Arg309fs frameshift AKR1A1 1 82500 1.21212E-5 41250 0 NA
1-46035573-A-G p.Lys308Arg missense AKR1A1 1 82504 1.21206E-5 41252 0 7.95969E-6
1-46035584-A-G p.Arg312Gly missense AKR1A1 3 82620 3.63108E-5 41310 0 5.03525E-4
1-46035592-A-G p.Ala314Ala synonymous AKR1A1 1 82694 1.20928E-5 41347 0 3.18573E-5
1-46035599-C-T p.Pro317Ser missense AKR1A1 78 82766 9.42416E-4 41383 1 0.0020141
1-46035599-C-G p.Pro317Ala missense AKR1A1 1 82772 1.20814E-5 41386 0 NA
1-46035600-C-T p.Pro317Leu missense AKR1A1 1 82786 1.20793E-5 41393 0 7.41718E-5
1-46035602-C-T p.Leu318Leu synonymous AKR1A1 5 82796 6.03894E-5 41398 0 1.64821E-5
1-46035606-A-G p.Tyr319Cys missense AKR1A1 8 82798 9.66207E-5 41399 1 9.56816E-5
1-46035608-C-G p.Pro320Ala missense AKR1A1 8 82824 9.65904E-5 41412 0 1.59286E-4
1-46035621-C-T p.Pro324Leu missense AKR1A1 87 82858 0.00104999 41429 0 0.00226201
1-46035622-G-A p.Pro324Pro synonymous AKR1A1 2 82848 2.41406E-5 41424 0 2.4717E-5
1-46035627-G-C p.Ter326Serext*? stop_lost AKR1A1 2 82874 2.4133E-5 41437 0 1.27405E-4