Variant

Variant ID Consequence Effect Gene AC AN AF NS NHOM maxEAF
1-109358799-T-G p.Lys835Asn missense AKNAD1 2 83090 2.40703E-5 41545 0 6.59805E-5
1-109358807-G-T p.Arg833Arg synonymous AKNAD1 1 83044 1.20418E-5 41522 0 3.18959E-5
1-109358822-G-A p.Gln828* stop_gained AKNAD1 2 83224 2.40315E-5 41612 0 NA
1-109358829-A-G p.Ala825Ala synonymous AKNAD1 12 83238 1.44165E-4 41619 0 6.36983E-5
1-109358835-G-C p.Asp823Glu missense AKNAD1 1 83266 1.20097E-5 41633 0 NA
1-109358841-T-C p.Ala821Ala synonymous AKNAD1 1 83278 1.2008E-5 41639 0 NA
1-109358844-A-G p.Ile820Ile synonymous AKNAD1 1 83272 1.20088E-5 41636 0 NA
1-109358847-C-T p.Thr819Thr synonymous AKNAD1 1 83268 1.20094E-5 41634 0 1.99162E-5
1-109358848-G-A p.Thr819Met missense AKNAD1 3 83266 3.60291E-5 41633 0 0.00125
1-109358861-G-A p.Gln815* stop_gained AKNAD1 1 83268 1.20094E-5 41634 0 3.18634E-5
1-109358866-G-A p.Thr813Ile missense AKNAD1 1 83274 1.20085E-5 41637 0 NA
1-109358867-T-C p.Thr813Ala missense AKNAD1 1 83272 1.20088E-5 41636 0 8.23696E-6
1-109358876-TCAA-T p.Leu809del conservative_inframe_deletion AKNAD1 1 83266 1.20097E-5 41633 0 3.1835E-5
1-109358881-A-ATCATT p.Ile808fs frameshift AKNAD1 1 83266 1.20097E-5 41633 0 3.18431E-5
1-109358883-G-GTATTTTA p.Ile808fs frameshift AKNAD1 2 83254 2.40229E-5 41627 0 3.9841E-6
1-109358883-G-GATCTGTA p.Ile808fs frameshift AKNAD1 1 83264 1.201E-5 41632 0 3.18532E-5
1-109358883-G-T p.Thr807Thr synonymous AKNAD1 1 83264 1.201E-5 41632 0 3.9841E-6
1-109358884-G-C p.Thr807Ser missense AKNAD1 2 83252 2.40234E-5 41626 0 3.98483E-6
1-109358884-G-A p.Thr807Ile missense AKNAD1 2 83260 2.40211E-5 41630 0 NA
1-109358885-T-G p.Thr807Pro missense AKNAD1 1 83262 1.20103E-5 41631 0 NA
1-109358887-G-A p.Ala806Val missense AKNAD1 1 83260 1.20106E-5 41630 0 NA
1-109358897-G-C p.Leu803Val missense AKNAD1 51 83256 6.12568E-4 41628 0 0.00152886
1-109358901-A-G p.His801His synonymous AKNAD1 239 83246 0.00287101 41623 1 0.00627309
1-109358914-G-A p.Ser797Leu missense AKNAD1 3 83190 3.6062E-5 41595 0 8.11333E-6
1-109358916-G-A p.Asn796Asn synonymous AKNAD1 3 83194 3.60603E-5 41597 0 1.64867E-5
1-109358927-A-G c.2380-3T>C splice_region AKNAD1 1 83146 1.2027E-5 41573 0 NA
1-109358928-C-T c.2380-4G>A splice_region AKNAD1 311 83148 0.00374032 41574 3 0.00598917
1-109359490-A-G n.338+6T>C splice_region AKNAD1 15226 44778 0.340033 22389 294 0.491016
1-109359496-C-T n.338G>A splice_region AKNAD1 1 64188 1.55792E-5 32094 0 NA
1-109359666-T-G c.2379+4A>C splice_region AKNAD1 1 83282 1.20074E-5 41641 0 8.25982E-6
1-109359673-A-C p.Ser792Ser synonymous AKNAD1 1 83320 1.20019E-5 41660 0 3.18492E-5
1-109359674-G-A p.Ser792Phe missense AKNAD1 3 83326 3.60032E-5 41663 0 0.0020141
1-109359675-AT-A p.Lys791fs frameshift AKNAD1 1 83328 1.20008E-5 41664 0 3.18573E-5
1-109359678-T-C p.Lys791Glu missense AKNAD1 1 83340 1.1999E-5 41670 0 NA
1-109359679-T-C p.Ile790Met missense AKNAD1 2 83346 2.39964E-5 41673 0 2.47361E-5
1-109359685-T-C p.Glu788Glu synonymous AKNAD1 9 83356 1.07971E-4 41678 0 1.59236E-4
1-109359691-G-A p.Ser786Ser synonymous AKNAD1 1 83368 1.1995E-5 41684 0 NA
1-109359692-C-T p.Ser786Asn missense AKNAD1 2 83370 2.39894E-5 41685 0 3.29663E-5
1-109359699-A-C p.Phe784Val missense AKNAD1 1 83378 1.19936E-5 41689 0 NA
1-109359702-C-T p.Asp783Asn missense AKNAD1 9 83378 1.07942E-4 41689 0 8.28236E-4
1-109359706-T-C p.Leu781Leu synonymous AKNAD1 3 83374 3.59824E-5 41687 0 8.23859E-6
1-109359709-G-C p.Ser780Ser synonymous AKNAD1 1 83382 1.1993E-5 41691 0 NA
1-109359719-C-A p.Gly777Val missense AKNAD1 22 83392 2.63814E-4 41696 0 0.00122089
1-109359752-G-A p.Pro766Leu missense AKNAD1 1 83400 1.19904E-5 41700 0 5.03525E-4
1-109359765-C-T p.Asp762Asn missense AKNAD1 3 83394 3.59738E-5 41697 0 9.55779E-5
1-109359773-T-C p.Tyr759Cys missense AKNAD1 7 83390 8.39429E-5 41695 0 6.37146E-5
1-109359775-G-A p.Thr758Thr synonymous AKNAD1 1 83388 1.19921E-5 41694 0 0.00125
1-109359783-A-G p.Phe756Leu missense AKNAD1 3 83378 3.59807E-5 41689 0 4.12875E-5
1-109359791-AG-A p.Leu753fs frameshift AKNAD1 1 83370 1.19947E-5 41685 0 NA
1-109359793-T-A p.Lys752Asn missense AKNAD1 1 83354 1.1997E-5 41677 0 3.98194E-6
1-109363176-GT-G p.Thr747fs frameshift AKNAD1 1 83044 1.20418E-5 41522 0 NA
1-109363178-G-T p.Pro746Pro synonymous AKNAD1 1 83048 1.20412E-5 41524 0 6.25E-4
1-109363180-G-A p.Pro746Ser missense AKNAD1 6 83044 7.22509E-5 41522 0 6.37267E-5
1-109363207-A-C p.Ser737Ala missense AKNAD1 4 83082 4.81452E-5 41541 0 3.29669E-5
1-109363213-C-T p.Val735Met missense AKNAD1 4 83064 4.81556E-5 41532 0 0.00100705
1-109363230-C-T p.Arg729Gln missense AKNAD1 2 82944 2.41127E-5 41472 0 9.07441E-5
1-109363231-G-T p.Arg729Arg synonymous AKNAD1 1 82912 1.2061E-5 41456 0 3.18634E-5
1-109363231-G-A p.Arg729Trp missense AKNAD1 2 82912 2.4122E-5 41456 0 3.30028E-5
1-109363232-T-C p.Lys728Lys synonymous AKNAD1 23537 82180 0.286408 41090 3669 0.374622
1-109363236-G-A p.Pro727Leu missense AKNAD1 1 82890 1.20642E-5 41445 0 0.00100705
1-109363242-A-T p.Leu725* stop_gained AKNAD1 1 82838 1.20718E-5 41419 0 0.00100705
1-109363244-A-C p.Phe724Leu missense AKNAD1 3 82816 3.62249E-5 41408 0 NA
1-109363245-A-G p.Phe724Ser missense AKNAD1 2 82806 2.41528E-5 41403 0 4.02004E-6
1-109363248-G-A p.Ser723Phe missense+splice_region AKNAD1 1 82730 1.20875E-5 41365 0 NA
1-109365461-T-C c.*487A>G splice_region AKNAD1 1 12202 8.19538E-5 6101 0 4.13881E-4
1-109365778-C-T p.Gln722Gln synonymous AKNAD1 2 63828 3.13342E-5 31914 0 3.1841E-5
1-109365781-C-T p.Ser721Ser synonymous AKNAD1 3201 64236 0.0498319 32118 82 0.0457116
1-109365785-T-A p.Lys720Ile missense AKNAD1 8 65320 1.22474E-4 32660 0 1.49895E-4
1-109365801-C-A p.Gly715Trp missense AKNAD1 1 67532 1.48078E-5 33766 0 NA
1-109365821-C-G p.Gly708Ala missense AKNAD1 2 70398 2.84099E-5 35199 0 6.21643E-6
1-109365821-C-T p.Gly708Glu missense AKNAD1 2 70398 2.84099E-5 35199 0 NA
1-109365826-T-G p.Thr706Thr synonymous AKNAD1 1 70834 1.41175E-5 35417 0 NA
1-109365831-G-A p.Pro705Ser missense AKNAD1 148 71810 0.00206099 35905 0 0.00527496
1-109365846-T-C p.Thr700Ala missense AKNAD1 1 73740 1.35612E-5 36870 0 NA
1-109365861-C-T p.Val695Met missense AKNAD1 1 75890 1.3177E-5 37945 0 NA
1-109365873-A-G p.Cys730Arg missense AKNAD1 2 77312 2.58692E-5 38656 0 1.21131E-4
1-109365880-T-G p.Pro727Pro synonymous AKNAD1 3 78350 3.82897E-5 39175 0 1.46215E-5
1-109365887-G-T p.Ala725Asp missense AKNAD1 1 79014 1.2656E-5 39507 0 1.86522E-5
1-109365893-G-A p.Ser723Phe missense+splice_region AKNAD1 1 79866 1.2521E-5 39933 0 8.87036E-6
1-109365898-C-T c.2168-5G>A splice_region AKNAD1 2 80316 2.49016E-5 40158 0 5.61545E-5
1-109365949-T-C p.Ter444Ter stop_retained AKNAD1 29 82774 3.50352E-4 41387 1 5.73943E-4
1-109365960-T-C p.Ile440Met missense AKNAD1 1 82978 1.20514E-5 41489 0 NA
1-109365961-A-G p.Ile440Thr missense AKNAD1 1 83002 1.20479E-5 41501 0 6.37186E-5
1-109365962-T-C p.Ile440Val missense AKNAD1 1 83036 1.2043E-5 41518 0 NA
1-109365964-G-A p.Ser439Phe missense AKNAD1 51 83044 6.14132E-4 41522 0 0.00127421
1-109365976-C-T p.Cys435Tyr missense AKNAD1 1 83170 1.20236E-5 41585 0 8.25655E-6
1-109365979-G-A p.Ser434Phe missense AKNAD1 1653 83146 0.0198807 41573 21 0.01875
1-109365984-G-T p.Tyr432* stop_gained AKNAD1 81 83232 9.73183E-4 41616 0 0.005625
1-109365988-T-C p.Lys431Arg missense AKNAD1 1 83260 1.20106E-5 41630 0 NA
1-109365991-C-T c.2077+1G>A splice_donor AKNAD1 81 83260 9.72856E-4 41630 0 0.005625
1-109366003-T-C p.Asn426Ser missense AKNAD1 8 83288 9.60523E-5 41644 0 9.57304E-5
1-109366006-T-C p.Lys425Arg missense AKNAD1 2 83290 2.40125E-5 41645 0 NA
1-109366018-A-G p.Leu421Ser missense AKNAD1 1 83292 1.2006E-5 41646 0 NA
1-109366023-A-G p.His419His synonymous AKNAD1 3 83304 3.60127E-5 41652 0 3.29484E-5
1-109366024-T-C p.His419Arg missense AKNAD1 1 83306 1.20039E-5 41653 0 NA
1-109366027-G-A p.Pro418Leu missense AKNAD1 1 83314 1.20028E-5 41657 0 NA
1-109366028-G-C p.Pro418Ala missense AKNAD1 1 83318 1.20022E-5 41659 0 NA
1-109366040-C-T p.Ala414Thr missense AKNAD1 3 83338 3.5998E-5 41669 0 NA
1-109366076-GA-TT p.ThrPro401ThrThr missense AKNAD1 2 83330 2.4001E-5 41665 0 NA
1-109366076-G-A p.Pro402Ser missense AKNAD1 3 83330 3.60014E-5 41665 0 NA
1-109366083-G-A p.Tyr399Tyr synonymous AKNAD1 1 83324 1.20013E-5 41662 0 1.19307E-5
1-109366089-A-G p.Tyr397Tyr synonymous AKNAD1 96 83330 0.00115205 41665 0 0.00171942
1-109366101-TG-T c.1181-3delC splice_region AKNAD1 1 83316 1.20025E-5 41658 0 NA
1-109366181-G-GTGTT c.1180+6_1180+7insAACA splice_region AKNAD1 3 83306 3.60118E-5 41653 0 1.59067E-5
1-109366187-C-A c.1180+1G>T splice_donor AKNAD1 2 83318 2.40044E-5 41659 0 3.18735E-5
1-109366211-G-C p.Ala386Gly missense AKNAD1 1 83308 1.20036E-5 41654 0 NA
1-109366214-C-T p.Arg385Lys missense AKNAD1 1 83312 1.20031E-5 41656 0 8.23642E-6
1-109366218-G-A p.Arg384* stop_gained AKNAD1 1 83300 1.20048E-5 41650 0 6.37064E-5
1-109366230-TC-AT p.LysIle379LysPhe missense AKNAD1 1 83296 1.20054E-5 41648 0 NA
1-109366231-C-CT p.Ile380fs frameshift AKNAD1 1 83294 1.20057E-5 41647 0 2.47101E-5
1-109366262-T-G p.Gln369Pro missense AKNAD1 2 83240 2.40269E-5 41620 0 3.18431E-5
1-109366276-A-G p.Ser364Ser synonymous AKNAD1 2 83224 2.40315E-5 41612 0 6.25E-4
1-109366286-C-T p.Cys361Tyr missense AKNAD1 20647 82368 0.250668 41184 2760 0.264375
1-109366286-C-G p.Cys361Ser missense AKNAD1 15 83202 1.80284E-4 41601 0 1.59693E-4
1-109366298-C-T p.Gly357Glu missense AKNAD1 3 83112 3.60959E-5 41556 0 NA
1-109366302-T-C p.Thr356Ala missense AKNAD1 1 83086 1.20357E-5 41543 0 NA
1-109366313-G-A c.1058-3C>T splice_region AKNAD1 1 82976 1.20517E-5 41488 0 8.24647E-6
1-109369830-G-A p.Pro352Ser missense AKNAD1 1 82702 1.20916E-5 41351 0 6.39918E-5
1-109369846-T-C p.Pro346Pro synonymous AKNAD1 3 82852 3.62091E-5 41426 0 NA
1-109369849-T-C p.Ala345Ala synonymous AKNAD1 3 82892 3.61917E-5 41446 0 8.256E-6
1-109369869-T-C p.Ile339Val missense AKNAD1 3 82952 3.61655E-5 41476 0 7.96991E-6
1-109369889-A-T p.Ile332Asn missense AKNAD1 1 82970 1.20525E-5 41485 0 2.4757E-5
1-109369896-C-T p.Gly330Arg missense AKNAD1 1 82896 1.20633E-5 41448 0 3.98432E-6
1-109369897-G-A p.His329His synonymous AKNAD1 4 82926 4.82358E-5 41463 0 1.19516E-5
1-109369901-C-A p.Gly328Val missense AKNAD1 1 82936 1.20575E-5 41468 0 3.98524E-6
1-109369901-C-T p.Gly328Asp missense AKNAD1 2 82936 2.4115E-5 41468 0 3.19857E-5
1-109369914-CG-C p.Asn323fs frameshift AKNAD1 1 82822 1.20741E-5 41411 0 NA
1-109369915-G-T p.Asn323Lys missense AKNAD1 46322 81194 0.57051 40597 13823 0.58761
1-109369920-G-T p.Gln322Lys missense AKNAD1 1 82760 1.20831E-5 41380 0 NA
1-109369923-T-A p.Lys321* stop_gained AKNAD1 1 82700 1.20919E-5 41350 0 NA
1-109369924-C-T p.Trp320* stop_gained AKNAD1 3 82736 3.62599E-5 41368 0 NA
1-109369932-A-G c.960-8T>C splice_region AKNAD1 1 82670 1.20963E-5 41335 0 5.99266E-5
1-109373192-C-G p.Arg316Ser missense AKNAD1 1 82812 1.20755E-5 41406 0 NA
1-109373196-C-T p.Arg315His missense AKNAD1 200 82812 0.00241511 41406 3 0.00646744
1-109373196-C-A p.Arg315Leu missense AKNAD1 2 82812 2.41511E-5 41406 0 1.19434E-5
1-109373200-A-G p.Cys314Arg missense AKNAD1 2 82898 2.4126E-5 41449 0 NA
1-109373207-A-G p.Cys311Cys synonymous AKNAD1 2 82900 2.41255E-5 41450 0 8.24049E-6
1-109373207-A-T p.Cys311* stop_gained AKNAD1 1 82900 1.20627E-5 41450 0 7.9595E-6
1-109373213-C-T p.Pro309Pro synonymous AKNAD1 1 82902 1.20624E-5 41451 0 3.97921E-5
1-109373214-G-A p.Pro309Leu missense AKNAD1 12 82928 1.44704E-4 41464 0 0.00100705
1-109373224-C-T p.Ala306Thr missense AKNAD1 1 82962 1.20537E-5 41481 0 2.78532E-5
1-109373226-G-A p.Thr305Met missense AKNAD1 2 82956 2.41092E-5 41478 0 3.9789E-5
1-109373253-G-A p.Gln562* stop_gained AKNAD1 22 82890 2.65412E-4 41445 1 0.00553877
1-109373260-C-T p.Gly294Ser missense AKNAD1 1 82810 1.20758E-5 41405 0 2.47313E-5
1-109373261-G-A p.Thr559Met missense AKNAD1 11 82812 1.32831E-4 41406 0 5.03525E-4
1-109373276-C-A c.868-4G>T splice_region AKNAD1 27 82646 3.26695E-4 41323 0 6.25E-4
1-109373277-G-A c.868-5C>T splice_region AKNAD1 1 82660 1.20978E-5 41330 0 1.65006E-5
1-109373280-A-G c.868-8T>C splice_region AKNAD1 3 82638 3.63029E-5 41319 0 3.98105E-6
1-109377064-A-T c.867+5T>A splice_region AKNAD1 1 82488 1.2123E-5 41244 0 NA
1-109377070-C-A p.Gly289Val missense+splice_region AKNAD1 9873 82182 0.120136 41091 668 0.140084
1-109377075-G-A p.Asn287Asn synonymous AKNAD1 1 82598 1.21068E-5 41299 0 NA
1-109377089-T-A p.Arg283Trp missense AKNAD1 2 82716 2.41791E-5 41358 0 NA
1-109377091-A-G p.Met282Thr missense AKNAD1 1 82696 1.20925E-5 41348 0 3.18959E-5
1-109377102-G-A p.Asp278Asp synonymous AKNAD1 1 82730 1.20875E-5 41365 0 4.05226E-6
1-109377118-G-A p.Ala273Val missense AKNAD1 1 82624 1.2103E-5 41312 0 3.20041E-5
1-109377126-A-G p.Asp270Asp synonymous AKNAD1 2 82542 2.42301E-5 41271 0 NA
1-109377129-T-G p.Gly269Gly synonymous AKNAD1 1 82514 1.21192E-5 41257 0 9.90354E-6
1-109377132-A-G p.Tyr268Tyr synonymous AKNAD1 1 82534 1.21162E-5 41267 0 4.16778E-6
1-109377133-T-C p.Tyr268Cys missense AKNAD1 7 82482 8.4867E-5 41241 0 4.9985E-5
1-109377140-C-A p.Gly266Cys missense AKNAD1 37 82388 4.49095E-4 41194 0 0.00164195
1-109377140-C-T p.Gly266Ser missense AKNAD1 2 82390 2.42748E-5 41195 0 1.0789E-4
1-109377141-G-A p.Asn265Asn synonymous AKNAD1 8 82364 9.71298E-5 41182 0 1.11392E-4
1-109377148-T-C p.Tyr263Cys missense+splice_region AKNAD1 11 82146 1.33908E-4 41073 0 4.52202E-4
1-109377154-A-AT c.786-5_786-4insA splice_region AKNAD1 17 81972 2.07388E-4 40986 0 0.0035014
1-109377157-TA-T c.786-8delT splice_region AKNAD1 49836 74754 0.666667 37377 14355 0.764312
1-109377157-TAA-T c.786-9_786-8delTT splice_region AKNAD1 5659 81788 0.0691911 40894 1 0.130298
1-109377157-T-TAA c.786-8_786-7insTT splice_region AKNAD1 12 81796 1.46706E-4 40898 0 7.73162E-4
1-109377158-AA-GG c.786-9_786-8delTTinsCC splice_region AKNAD1 1 62596 1.59755E-5 31298 0 NA
1-109377550-C-T c.785+1G>A splice_donor AKNAD1 11 81216 1.35441E-4 40608 0 6.24576E-5
1-109377551-G-A p.Thr262Ile missense+splice_region AKNAD1 1 81290 1.23016E-5 40645 0 1.14301E-5
1-109377556-C-T p.Pro260Pro synonymous AKNAD1 7 81358 8.60395E-5 40679 0 2.87045E-4
1-109377557-G-A p.Pro260Leu missense AKNAD1 2 81418 2.45646E-5 40709 0 1.77283E-5
1-109377579-C-T p.Glu253Lys missense AKNAD1 1 81938 1.22043E-5 40969 0 1.74049E-5
1-109377580-G-A p.Asn252Asn synonymous AKNAD1 18 81990 2.19539E-4 40995 0 1.30129E-4
1-109377581-T-C p.Asn252Ser missense AKNAD1 1 81996 1.21957E-5 40998 0 NA
1-109377582-T-A p.Asn252Tyr missense AKNAD1 1 81996 1.21957E-5 40998 0 2.59722E-5
1-109377591-C-T p.Glu249Lys missense AKNAD1 3 82082 3.65488E-5 41041 0 1.06012E-5
1-109377592-C-G p.Gln248His missense AKNAD1 2 82088 2.43641E-5 41044 0 NA
1-109377594-G-A p.Gln248* stop_gained AKNAD1 2 82082 2.43659E-5 41041 0 8.55988E-6
1-109377594-G-C p.Gln248Glu missense AKNAD1 2 82082 2.43659E-5 41041 0 5.23445E-6
1-109377595-C-T c.1537-7G>A splice_region AKNAD1 3 82076 3.65515E-5 41038 0 2.10126E-5
1-109377596-G-A p.Pro247Leu missense AKNAD1 16 82100 1.94884E-4 41050 0 0.00251572
1-109377606-G-A p.Gln244* stop_gained AKNAD1 3 82256 3.64715E-5 41128 0 1.69065E-5
1-109377606-G-T p.Gln244Lys missense AKNAD1 2 82256 2.43143E-5 41128 0 6.76258E-5
1-109377607-G-T p.Pro243Pro synonymous AKNAD1 2 82284 2.43061E-5 41142 0 1.00358E-5
1-109377617-G-C p.Thr240Arg missense AKNAD1 2 82318 2.4296E-5 41159 0 NA
1-109377622-C-T p.Glu238Glu synonymous AKNAD1 1 82316 1.21483E-5 41158 0 NA
1-109377635-G-C p.Ser234* stop_gained AKNAD1 2 82382 2.42771E-5 41191 0 NA
1-109377641-C-T p.Arg232Gln missense AKNAD1 9 82284 1.09377E-4 41142 0 2.54956E-4
1-109377642-G-A p.Arg232* stop_gained AKNAD1 2 82242 2.43185E-5 41121 0 NA
1-109377646-C-T p.Gly230Gly synonymous AKNAD1 1 82224 1.21619E-5 41112 0 NA
1-109377647-C-T p.Gly230Glu missense AKNAD1 17 82214 2.06777E-4 41107 0 3.8258E-4
1-109377650-G-A p.Ser229Phe missense AKNAD1 3 82276 3.64626E-5 41138 0 NA
1-109377654-G-C p.Pro228Ala missense AKNAD1 1 82210 1.2164E-5 41105 0 8.38518E-6
1-109377658-G-A p.Gly226Gly synonymous AKNAD1 4 82138 4.86985E-5 41069 0 1.7603E-4
1-109377661-G-A p.Pro225Pro synonymous AKNAD1 30 82076 3.65515E-4 41038 0 6.25E-4
1-109377681-G-T c.658-3C>A splice_region AKNAD1 75 81734 9.17611E-4 40867 0 0.0031902
1-109377684-GGAGCCACACAGAAAGACTTGAATTA-G c.658-31_658-7delTAATTCAAGTCTTTCTGTGTGGCTC splice_region AKNAD1 2 81646 2.4496E-5 40823 0 NA
1-109380174-C-T p.Glu219Lys missense+splice_region AKNAD1 1 83260 1.20106E-5 41630 0 3.18512E-5
1-109380177-T-G p.Asn218His missense AKNAD1 1 83266 1.20097E-5 41633 0 8.24049E-6
1-109380191-A-C p.Phe213Cys missense AKNAD1 15 83286 1.80102E-4 41643 0 9.54631E-5
1-109380204-A-G p.Leu209Leu synonymous AKNAD1 1 83304 1.20042E-5 41652 0 NA
1-109380245-G-A p.Ala195Val missense AKNAD1 1 83314 1.20028E-5 41657 0 3.97674E-6
1-109380246-C-G p.Ala195Pro missense AKNAD1 2 83322 2.40033E-5 41661 0 NA
1-109380265-A-G p.Asp188Asp synonymous AKNAD1 2 83314 2.40056E-5 41657 0 6.3678E-5
1-109380276-C-G p.Glu185Gln missense AKNAD1 1 83292 1.2006E-5 41646 0 NA
1-109380281-A-G p.Val183Ala missense AKNAD1 2 83284 2.40142E-5 41642 0 NA
1-109380303-A-G p.Leu176Leu synonymous AKNAD1 1 83116 1.20314E-5 41558 0 8.23873E-6
1-109380332-A-G c.501-4T>C splice_region AKNAD1 1 82976 1.20517E-5 41488 0 NA
1-109385750-T-C c.500+6A>G splice_region AKNAD1 822 82950 0.00990958 41475 11 0.013734
1-109385755-C-G c.500+1G>C splice_donor AKNAD1 1 83006 1.20473E-5 41503 0 NA
1-109385763-G-T p.Pro165Thr missense AKNAD1 3 83022 3.6135E-5 41511 0 NA
1-109385778-C-T p.Val160Ile missense AKNAD1 25 83048 3.01031E-4 41524 0 1.71093E-4
1-109385779-G-A p.Ile159Ile synonymous AKNAD1 1 83062 1.20392E-5 41531 0 3.18431E-5
1-109385780-A-C p.Ile159Ser missense AKNAD1 1 83072 1.20378E-5 41536 0 NA
1-109385781-T-C p.Ile159Val missense AKNAD1 27 83078 3.24996E-4 41539 1 5.03525E-4
1-109385784-T-C p.Thr158Ala missense AKNAD1 5 83074 6.01873E-5 41537 0 2.22859E-4
1-109385787-A-AT p.Ser157fs frameshift AKNAD1 1 83082 1.20363E-5 41541 0 NA
1-109385790-C-T p.Glu156Lys missense AKNAD1 2 83080 2.40732E-5 41540 0 6.59174E-5
1-109385810-T-G p.Gln149Pro missense AKNAD1 5 83050 6.02047E-5 41525 0 3.1837E-5
1-109385812-C-T p.Leu148Leu synonymous AKNAD1 1 83042 1.20421E-5 41521 0 NA
1-109385822-T-G p.His145Pro missense AKNAD1 1 83020 1.20453E-5 41510 0 NA
1-109385829-C-T p.Asp143Asn missense AKNAD1 3 82966 3.61594E-5 41483 0 7.41424E-5
1-109385831-T-G p.Lys142Thr missense AKNAD1 1 82958 1.20543E-5 41479 0 NA
1-109385837-G-C p.Ala140Gly missense AKNAD1 2 82936 2.4115E-5 41468 0 3.97785E-6
1-109385841-G-A p.Leu139Leu synonymous AKNAD1 1 82944 1.20563E-5 41472 0 NA
1-109385845-G-C p.Asn137Lys missense AKNAD1 2 82938 2.41144E-5 41469 0 NA
1-109385853-C-G p.Glu135Gln missense AKNAD1 1 82892 1.20639E-5 41446 0 NA
1-109385866-G-T p.His130Gln missense AKNAD1 8 82820 9.6595E-5 41410 0 1.59185E-4
1-109385867-T-G p.His130Pro missense AKNAD1 1 82804 1.20767E-5 41402 0 NA
1-109385872-C-T p.Gln128Gln synonymous AKNAD1 3 82770 3.6245E-5 41385 0 NA
1-109385886-G-A p.Leu124Leu synonymous AKNAD1 1 82670 1.20963E-5 41335 0 8.25777E-6
1-109385890-C-T c.367-1G>A splice_acceptor AKNAD1 2 82636 2.42025E-5 41318 0 NA
1-109385891-T-C c.367-2A>G splice_acceptor AKNAD1 1 82602 1.21062E-5 41301 0 1.99418E-5
1-109385896-C-T c.367-7G>A splice_region AKNAD1 3 82512 3.63583E-5 41256 0 1.59753E-5
1-109385897-G-A c.367-8C>T splice_region AKNAD1 43 82520 5.21086E-4 41260 0 0.00130523
1-109391368-C-A c.366+6G>T splice_region AKNAD1 1 82768 1.2082E-5 41384 0 3.18492E-5
1-109391373-C-A c.366+1G>T splice_donor AKNAD1 1 82844 1.20709E-5 41422 0 4.12712E-6
1-109391376-GC-G p.Lys121fs frameshift AKNAD1 3 82894 3.61908E-5 41447 0 8.30096E-6
1-109391402-G-A p.Ser113Phe missense AKNAD1 3 83042 3.61263E-5 41521 0 1.07698E-4
1-109391408-T-C p.Gln111Arg missense AKNAD1 1 83084 1.2036E-5 41542 0 NA
1-109391427-ATTC-A p.Glu104del conservative_inframe_deletion AKNAD1 1 83124 1.20302E-5 41562 0 8.27993E-6
1-109391436-C-A p.Val102Leu missense+splice_region AKNAD1 5 83130 6.01468E-5 41565 0 5.79547E-5
1-109391443-T-G c.304-7A>C splice_region AKNAD1 1 83116 1.20314E-5 41558 0 8.27993E-6
1-109391444-G-A c.304-8C>T splice_region AKNAD1 2 83116 2.40628E-5 41558 0 8.28061E-6
1-109391528-T-C c.303+6A>G splice_region AKNAD1 4 83122 4.8122E-5 41561 0 8.3453E-6
1-109391548-G-C p.Gln97Glu missense AKNAD1 1 83138 1.20282E-5 41569 0 NA
1-109391557-G-A p.Gln94* stop_gained AKNAD1 1 83126 1.20299E-5 41563 0 3.18573E-5
1-109391577-A-G p.Met87Thr missense AKNAD1 1 83132 1.20291E-5 41566 0 1.65967E-5
1-109391585-C-T p.Gly84Gly synonymous AKNAD1 3 83132 3.60872E-5 41566 0 3.1841E-5
1-109391597-C-A p.Lys80Asn missense AKNAD1 2 83120 2.40616E-5 41560 0 1.59236E-4
1-109391601-TG-T p.Gln79fs frameshift AKNAD1 2 83118 2.40622E-5 41559 0 NA
1-109391618-A-G p.Ser73Ser synonymous AKNAD1 1 83068 1.20383E-5 41534 0 8.29311E-6
1-109391622-G-A p.Ser72Leu missense AKNAD1 3 83054 3.61211E-5 41527 0 NA
1-109391650-A-G p.Ser63Pro missense AKNAD1 1 82880 1.20656E-5 41440 0 3.3579E-5
1-109391653-A-T p.Leu62Met missense AKNAD1 1 82860 1.20685E-5 41430 0 4.15562E-6
1-109391656-TAGAG-T p.Lys61fs frameshift AKNAD1 8 82830 9.65834E-5 41415 0 0.00352467
1-109391658-G-A p.Ser60Phe missense AKNAD1 52 82802 6.28004E-4 41401 1 3.72408E-4
1-109391662-G-C p.Leu59Val missense AKNAD1 6532 82390 0.0792815 41195 237 0.0987253
1-109391662-G-T p.Leu59Ile missense AKNAD1 1 82738 1.20863E-5 41369 0 8.49387E-6
1-109391664-C-T p.Ser58Asn missense AKNAD1 1 82710 1.20904E-5 41355 0 2.56353E-5
1-109391672-A-C p.Ser55Ser synonymous AKNAD1 2 82616 2.42084E-5 41308 0 NA
1-109391684-T-G c.155-2A>C splice_acceptor AKNAD1 2 82304 2.43002E-5 41152 0 NA
1-109392150-CATT-C c.154+6_154+8delAAT splice_region AKNAD1 19 82418 2.30532E-4 41209 0 4.78255E-4
1-109392158-C-T c.154+1G>A splice_donor AKNAD1 2 82660 2.41955E-5 41330 0 1.03597E-4
1-109392169-T-C p.Glu48Glu synonymous AKNAD1 1 82858 1.20688E-5 41429 0 NA
1-109392186-C-T p.Val43Ile missense AKNAD1 3 82950 3.61664E-5 41475 0 0.00100705
1-109392188-A-G p.Ile42Thr missense AKNAD1 2 82938 2.41144E-5 41469 0 NA
1-109392198-T-A p.Met39Leu missense+splice_region AKNAD1 1 82880 1.20656E-5 41440 0 NA
1-109394291-T-C c.993+3A>G splice_region AKNAD1 1 82996 1.20488E-5 41498 0 NA
1-109394326-C-G p.Gly321Arg missense AKNAD1 12 83214 1.44206E-4 41607 0 0.00151057
1-109394331-T-G p.Gln319Pro missense AKNAD1 1 83222 1.20161E-5 41611 0 NA
1-109394351-AAC-A p.Val312fs frameshift AKNAD1 5 83236 6.00702E-5 41618 0 4.17987E-6
1-109394361-G-A p.Ser309Leu missense AKNAD1 1 83264 1.201E-5 41632 0 6.25E-4
1-109394361-G-T p.Ser309* stop_gained AKNAD1 1 83264 1.201E-5 41632 0 1.6506E-5
1-109394363-C-T p.Glu308Glu synonymous AKNAD1 3 83268 3.60282E-5 41634 0 4.03454E-6
1-109394369-C-T p.Thr306Thr synonymous AKNAD1 11 83268 1.32104E-4 41634 0 4.94739E-5
1-109394369-C-A p.Thr306Thr synonymous AKNAD1 3 83268 3.60282E-5 41634 0 1.2008E-5
1-109394370-G-A p.Thr306Met missense AKNAD1 9 83274 1.08077E-4 41637 0 0.00100705
1-109394378-T-C p.Leu303Leu synonymous AKNAD1 2 83284 2.40142E-5 41642 0 3.1837E-5
1-109394383-T-C p.Ser302Gly missense AKNAD1 4 83288 4.80261E-5 41644 0 3.29571E-5
1-109394384-A-C p.Asp301Glu missense AKNAD1 1 83286 1.20068E-5 41643 0 NA
1-109394384-A-G p.Asp301Asp synonymous AKNAD1 1 83286 1.20068E-5 41643 0 NA
1-109394386-C-T p.Asp301Asn missense AKNAD1 2 83286 2.40136E-5 41643 0 1.27397E-4
1-109394398-T-C p.Thr297Ala missense AKNAD1 1 83286 1.20068E-5 41643 0 NA
1-109394405-A-C p.Asp294Glu missense AKNAD1 1 83286 1.20068E-5 41643 0 NA
1-109394411-C-T p.Ser292Ser synonymous AKNAD1 1 83286 1.20068E-5 41643 0 1.64756E-5
1-109394412-G-A p.Ser292Leu missense AKNAD1 3 83280 3.60231E-5 41640 0 5.03525E-4
1-109394414-C-T p.Lys291Lys synonymous AKNAD1 2 83284 2.40142E-5 41642 0 NA
1-109394422-A-T p.Ser289Thr missense AKNAD1 1 83294 1.20057E-5 41647 0 8.23778E-6
1-109394429-G-A p.Ala286Ala synonymous AKNAD1 1 83290 1.20062E-5 41645 0 3.97833E-6
1-109394430-G-T p.Ala286Asp missense AKNAD1 2 83288 2.40131E-5 41644 0 NA
1-109394436-T-G p.Lys284Thr missense AKNAD1 1 83296 1.20054E-5 41648 0 NA
1-109394440-C-G p.Ala283Pro missense AKNAD1 3 83286 3.60205E-5 41643 0 6.25E-4
1-109394442-A-C p.Ile282Arg missense AKNAD1 1 83286 1.20068E-5 41643 0 NA
1-109394445-G-A p.Ala281Val missense AKNAD1 1 83282 1.20074E-5 41641 0 8.35615E-5
1-109394449-G-A p.Leu280Phe missense AKNAD1 2 83290 2.40125E-5 41645 0 8.239E-6
1-109394465-C-G p.Lys274Asn missense AKNAD1 1 83304 1.20042E-5 41652 0 8.2394E-6
1-109394478-A-G p.Ile270Thr missense AKNAD1 2 83306 2.40079E-5 41653 0 NA
1-109394482-T-C p.Lys269Glu missense AKNAD1 1 83300 1.20048E-5 41650 0 5.03525E-4
1-109394484-A-G p.Val268Ala missense AKNAD1 2 83296 2.40108E-5 41648 0 NA
1-109394496-A-C p.Ile264Ser missense AKNAD1 1 83322 1.20016E-5 41661 0 6.25E-4
1-109394513-G-A p.Leu258Leu synonymous AKNAD1 1 83330 1.20005E-5 41665 0 6.25E-4
1-109394516-C-T p.Gln257Gln synonymous AKNAD1 1 83332 1.20002E-5 41666 0 8.23696E-6
1-109394518-G-A p.Gln257* stop_gained AKNAD1 1 83334 1.19999E-5 41667 0 NA
1-109394524-G-A p.His255Tyr missense AKNAD1 796 83334 0.00955192 41667 22 0.0198382
1-109394532-C-T p.Gly252Asp missense AKNAD1 1 83340 1.1999E-5 41670 0 2.86533E-4
1-109394535-T-C p.Gln251Arg missense AKNAD1 2 83350 2.39952E-5 41675 0 NA
1-109394540-G-A p.Tyr249Tyr synonymous AKNAD1 10 83344 1.19985E-4 41672 0 6.25E-4
1-109394548-A-AC p.Phe247fs frameshift AKNAD1 3 83354 3.59911E-5 41677 0 0.00100705
1-109394549-C-T p.Thr246Thr synonymous AKNAD1 20 83348 2.39958E-4 41674 0 4.77646E-4
1-109394550-G-A p.Thr246Met missense AKNAD1 6 83356 7.19804E-5 41678 0 1.27397E-4
1-109394552-G-A p.Asn245Asn synonymous AKNAD1 3 83354 3.59911E-5 41677 0 NA
1-109394560-A-G p.Ser243Pro missense AKNAD1 1 83348 1.19979E-5 41674 0 NA
1-109394564-T-C p.Ala241Ala synonymous AKNAD1 4961 83296 0.0595587 41648 201 0.075
1-109394564-TG-CA p.Ala241Val missense AKNAD1 2 83346 2.39964E-5 41673 0 NA
1-109394566-C-CT p.Ala241fs frameshift AKNAD1 1 83348 1.19979E-5 41674 0 NA
1-109394566-C-CTT p.Ala241fs frameshift AKNAD1 1 83348 1.19979E-5 41674 0 NA
1-109394579-C-T p.Gln236Gln synonymous AKNAD1 2 83350 2.39952E-5 41675 0 8.23655E-6
1-109394586-T-C p.Gln234Arg missense AKNAD1 1 83340 1.1999E-5 41670 0 NA
1-109394593-A-C p.Ser232Ala missense AKNAD1 1375 83324 0.0165018 41662 15 0.040625
1-109394601-T-C p.Gln229Arg missense AKNAD1 1 83326 1.20011E-5 41663 0 NA
1-109394607-CTT-C p.Ser227fs frameshift AKNAD1 1 83330 1.20005E-5 41665 0 NA
1-109394609-T-A p.Lys226Asn missense AKNAD1 1370 83300 0.0164466 41650 15 0.040625
1-109394619-T-C p.Asp223Gly missense AKNAD1 2 83302 2.4009E-5 41651 0 NA
1-109394622-C-T p.Gly222Asp missense AKNAD1 1 83298 1.20051E-5 41649 0 NA
1-109394640-G-C p.Thr216Ser missense AKNAD1 1 83240 1.20135E-5 41620 0 1.64878E-5
1-109394644-G-A p.Leu215Leu synonymous AKNAD1 1 83218 1.20166E-5 41609 0 NA
1-109394647-C-G p.Val214Leu missense AKNAD1 2 83198 2.4039E-5 41599 0 NA
1-109394652-A-G p.Val212Ala missense AKNAD1 2 83160 2.405E-5 41580 0 NA
1-109394655-T-C p.Asn211Ser missense AKNAD1 2 83158 2.40506E-5 41579 0 3.98156E-6
1-109394666-G-A p.Ser207Ser synonymous AKNAD1 1 83032 1.20435E-5 41516 0 NA
1-109394668-T-A p.Ser207Cys missense AKNAD1 1 83008 1.2047E-5 41504 0 4.154E-5
1-109394682-G-A p.Ala202Val missense AKNAD1 1 82856 1.20691E-5 41428 0 NA
1-109394683-C-T p.Ala202Thr missense AKNAD1 1 82840 1.20715E-5 41420 0 NA
1-109394684-C-A p.Val201Val synonymous AKNAD1 2 82854 2.41388E-5 41427 0 8.32002E-6
1-109394718-GTC-TTG p.ThrThr189ThrLys missense AKNAD1 26 82362 3.1568E-4 41181 0 NA
1-109394718-G-T p.Thr190Lys missense AKNAD1 3 82362 3.64246E-5 41181 0 4.3514E-4
1-109394719-T-A p.Thr190Ser missense AKNAD1 1 82298 1.2151E-5 41149 0 NA
1-109394720-C-G p.Thr189Thr synonymous AKNAD1 3 82294 3.64547E-5 41147 0 4.35251E-4
1-109394720-C-A p.Thr189Thr synonymous AKNAD1 1 82294 1.21516E-5 41147 0 2.39588E-5
1-109394721-G-C p.Thr189Arg missense AKNAD1 1 82292 1.21518E-5 41146 0 NA
1-109394721-G-A p.Thr189Met missense AKNAD1 5 82292 6.07592E-5 41146 0 9.18494E-5
1-109394729-A-G p.Ser186Ser synonymous AKNAD1 1 82254 1.21575E-5 41127 0 NA
1-109394735-A-C p.Pro184Pro synonymous AKNAD1 1 82242 1.21592E-5 41121 0 NA
1-109394736-G-C p.Pro184Arg missense AKNAD1 1 82218 1.21628E-5 41109 0 NA
1-109394749-T-C p.Asn180Asp missense AKNAD1 1 82168 1.21702E-5 41084 0 NA
1-109394757-T-C p.Asp177Gly missense AKNAD1 3 82170 3.65097E-5 41085 0 1.67001E-5
1-109394765-C-T p.Pro174Pro synonymous AKNAD1 10 82104 1.21797E-4 41052 0 0.00151057
1-109394765-C-G p.Pro174Pro synonymous AKNAD1 1 82104 1.21797E-5 41052 0 NA
1-109394766-G-A p.Pro174Leu missense AKNAD1 2 82086 2.43647E-5 41043 0 2.80357E-5
1-109394775-T-C p.Gln171Arg missense AKNAD1 1 82044 1.21886E-5 41022 0 NA
1-109394793-G-A p.Thr165Ile missense AKNAD1 35 82012 4.26767E-4 41006 1 0.00251762
1-109394793-G-T p.Thr165Asn missense AKNAD1 2 82016 2.43855E-5 41008 0 3.18593E-5
1-109394796-T-G p.Gln164Pro missense AKNAD1 1 82052 1.21874E-5 41026 0 NA
1-109394811-G-T p.Ser159Tyr missense AKNAD1 4 82126 4.87056E-5 41063 0 1.67062E-5
1-109394819-A-C p.Asn156Lys missense AKNAD1 2 82244 2.43179E-5 41122 0 8.35617E-6
1-109394820-T-C p.Asn156Ser missense AKNAD1 2 82256 2.43143E-5 41128 0 NA
1-109394827-A-G p.Cys154Arg missense AKNAD1 1 82364 1.21412E-5 41182 0 4.00792E-6
1-109394869-C-T p.Asp140Asn missense AKNAD1 1 82986 1.20502E-5 41493 0 8.28528E-6
1-109394870-G-A p.Ala139Ala synonymous AKNAD1 9 83006 1.08426E-4 41503 0 6.25E-4
1-109394871-G-A p.Ala139Val missense AKNAD1 4 83022 4.818E-5 41511 0 5.03525E-4
1-109394872-C-G p.Ala139Pro missense AKNAD1 2 83016 2.40917E-5 41508 0 2.86642E-4
1-109394885-TG-T p.Pro134fs frameshift AKNAD1 1 83114 1.20317E-5 41557 0 NA
1-109394889-A-G p.Leu133Pro missense AKNAD1 1 83136 1.20285E-5 41568 0 3.99096E-6
1-109394891-G-A p.Thr132Thr synonymous AKNAD1 19 83142 2.28525E-4 41571 0 9.55718E-5
1-109394892-G-T p.Thr132Asn missense AKNAD1 2 83158 2.40506E-5 41579 0 3.18471E-5
1-109394897-A-G p.Cys130Cys synonymous AKNAD1 1 83186 1.20213E-5 41593 0 NA
1-109394899-A-T p.Cys130Ser missense AKNAD1 1 83200 1.20192E-5 41600 0 NA
1-109394923-A-G p.Phe122Leu missense AKNAD1 4 83252 4.80469E-5 41626 0 5.03525E-4
1-109394930-T-C p.Lys119Lys synonymous AKNAD1 1 83264 1.201E-5 41632 0 NA
1-109394938-G-T p.Leu117Ile missense AKNAD1 3 83278 3.60239E-5 41639 0 8.26419E-6
1-109394952-A-G p.Ile112Thr missense AKNAD1 1 83276 1.20083E-5 41638 0 NA
1-109394958-G-A p.Ser110Phe missense AKNAD1 2 83280 2.40154E-5 41640 0 6.36983E-5
1-109394961-A-G p.Ile109Thr missense AKNAD1 1 83282 1.20074E-5 41641 0 NA
1-109394962-T-C p.Ile109Val missense AKNAD1 1 83282 1.20074E-5 41641 0 8.24933E-6
1-109394964-C-T p.Ser108Asn missense AKNAD1 26 83282 3.12192E-4 41641 0 0.00101898
1-109394972-A-C p.Ser105Ser synonymous AKNAD1 1 83284 1.20071E-5 41642 0 3.97905E-6
1-109394976-G-A p.Ala104Val missense AKNAD1 1697 83252 0.0203839 41626 35 0.0154666
1-109394976-GC-AT p.Ala104Ile missense AKNAD1 1 83282 1.20074E-5 41641 0 NA
1-109394977-C-T p.Ala104Thr missense AKNAD1 16 83282 1.92118E-4 41641 1 0.00151057
1-109394978-G-A p.Asp103Asp synonymous AKNAD1 11060 83158 0.133 41579 745 0.156352
1-109394980-C-A p.Asp103Tyr missense AKNAD1 4 83282 4.80296E-5 41641 0 6.36821E-5
1-109394985-T-C p.Glu101Gly missense AKNAD1 4 83282 4.80296E-5 41641 0 2.54745E-4
1-109395001-G-A p.His96Tyr missense AKNAD1 5 83278 6.00399E-5 41639 0 2.47174E-5
1-109395017-T-C p.Gln90Gln synonymous AKNAD1 5 83280 6.00384E-5 41640 0 NA
1-109395025-C-G p.Glu88Gln missense AKNAD1 1 83286 1.20068E-5 41643 0 3.18613E-5
1-109395031-C-T p.Glu86Lys missense AKNAD1 13 83284 1.56092E-4 41642 0 0.001875
1-109395032-G-A p.Asp85Asp synonymous AKNAD1 14 83286 1.68095E-4 41643 0 0.00100705
1-109395062-T-G p.Lys75Asn missense AKNAD1 4 83306 4.80158E-5 41653 0 7.964E-6
1-109395068-C-T p.Leu73Leu synonymous AKNAD1 1 83306 1.20039E-5 41653 0 3.18492E-5
1-109395069-A-T p.Leu73Gln missense AKNAD1 4 83308 4.80146E-5 41654 0 3.98197E-6
1-109395070-G-A p.Leu73Leu synonymous AKNAD1 2 83304 2.40085E-5 41652 0 NA
1-109395072-G-A p.Pro72Leu missense AKNAD1 3 83308 3.60109E-5 41654 0 NA
1-109395073-G-C p.Pro72Ala missense AKNAD1 2 83310 2.40067E-5 41655 0 3.98143E-6
1-109395075-A-G p.Ile71Thr missense AKNAD1 1 83310 1.20034E-5 41655 0 NA
1-109395105-C-T p.Ser61Asn missense AKNAD1 68550 82738 0.828519 41369 28480 0.841893
1-109395116-C-T p.Lys57Lys synonymous AKNAD1 2 83308 2.40073E-5 41654 0 6.36821E-5
1-109395121-C-A p.Glu56* stop_gained AKNAD1 1 83304 1.20042E-5 41652 0 8.24511E-6
1-109395127-G-A p.Pro54Ser missense AKNAD1 3 83304 3.60127E-5 41652 0 NA
1-109395130-C-A p.Asp53Tyr missense AKNAD1 1 83306 1.20039E-5 41653 0 8.24647E-6
1-109395146-AATTTG-A p.Gln46fs frameshift AKNAD1 1 83312 1.20031E-5 41656 0 NA
1-109395153-T-A p.Asn45Ile missense AKNAD1 18 83294 2.16102E-4 41647 0 3.50207E-4
1-109395155-T-C p.Leu44Leu synonymous AKNAD1 1 83292 1.2006E-5 41646 0 1.27372E-4
1-109395160-C-G p.Val43Leu missense AKNAD1 1 83276 1.20083E-5 41638 0 NA
1-109395161-T-G p.Glu42Asp missense AKNAD1 1 83274 1.20085E-5 41637 0 NA
1-109395163-C-T p.Glu42Lys missense AKNAD1 5 83272 6.00442E-5 41636 0 8.25764E-6
1-109395165-A-G p.Leu41Pro missense AKNAD1 1 83270 1.20091E-5 41635 0 3.30338E-5
1-109395167-G-A p.Gly40Gly synonymous AKNAD1 1 83272 1.20088E-5 41636 0 8.26009E-6
1-109395167-G-T p.Gly40Gly synonymous AKNAD1 3 83272 3.60265E-5 41636 0 5.03525E-4
1-109395168-C-T p.Gly40Asp missense AKNAD1 27 83270 3.24246E-4 41635 0 1.67118E-4
1-109395171-T-C p.Asp39Gly missense AKNAD1 2 83264 2.402E-5 41632 0 2.47864E-5
1-109395173-C-G p.Lys38Asn missense AKNAD1 1 83270 1.20091E-5 41635 0 NA
1-109395179-T-A p.Ser36Ser synonymous AKNAD1 1 83264 1.201E-5 41632 0 NA
1-109395184-T-C p.Thr35Ala missense AKNAD1 4 83236 4.80561E-5 41618 0 8.2802E-6
1-109395184-T-G p.Thr35Pro missense AKNAD1 2 83236 2.40281E-5 41618 0 8.2802E-6
1-109395202-C-T p.Gly29Ser missense AKNAD1 1 83178 1.20224E-5 41589 0 NA
1-109395225-C-G p.Gly21Ala missense AKNAD1 1 83138 1.20282E-5 41569 0 NA
1-109395230-A-G p.Tyr19Tyr synonymous AKNAD1 154 83154 0.00185199 41577 1 0.0032813
1-109395235-G-A p.Pro18Ser missense AKNAD1 2 83154 2.40518E-5 41577 0 4.11533E-6
1-109395235-G-T p.Pro18Thr missense AKNAD1 1 83154 1.20259E-5 41577 0 2.58056E-5
1-109395240-T-C p.Asp16Gly missense AKNAD1 1 83176 1.20227E-5 41588 0 NA
1-109395244-C-T p.Glu15Lys missense AKNAD1 3 83180 3.60664E-5 41590 0 NA
1-109395246-T-G p.Gln14Pro missense AKNAD1 2 83190 2.40414E-5 41595 0 8.70398E-6
1-109395251-A-G p.Tyr12Tyr synonymous AKNAD1 1 83190 1.20207E-5 41595 0 4.21884E-6
1-109395255-G-C p.Thr11Ser missense AKNAD1 1 83186 1.20213E-5 41593 0 NA
1-109395258-G-T p.Thr10Lys missense AKNAD1 101 83198 0.00121397 41599 0 0.0025
1-109395258-G-A p.Thr10Met missense AKNAD1 9 83200 1.08173E-4 41600 0 6.10874E-5
1-109395271-A-T p.Phe6Ile missense AKNAD1 1 83184 1.20215E-5 41592 0 NA
1-109395272-A-C p.Asp5Glu missense AKNAD1 1 83180 1.20221E-5 41590 0 8.89537E-6
1-109395278-C-T p.Glu3Glu synonymous AKNAD1 2 83168 2.40477E-5 41584 0 NA
1-109395280-C-T p.Glu3Lys missense AKNAD1 35 83152 4.20916E-4 41576 0 2.46125E-4
1-109395296-G-T c.-10C>A 5_prime_UTR_premature_start_codon_gain AKNAD1 2 83106 2.40657E-5 41553 0 NA
1-109395300-G-A c.-14C>T 5_prime_UTR_premature_start_codon_gain AKNAD1 3 83052 3.61219E-5 41526 0 1.5472E-4
1-109395310-G-A c.-24C>T 5_prime_UTR_premature_start_codon_gain AKNAD1 1 82910 1.20613E-5 41455 0 3.18593E-5
1-109395350-T-C c.-64A>G 5_prime_UTR_premature_start_codon_gain AKNAD1 24 81822 2.9332E-4 40911 0 6.36821E-4
1-109395392-G-A c.-103-3C>T splice_region AKNAD1 2 75758 2.63999E-5 37879 0 NA
1-109395394-G-A c.-103-5C>T splice_region AKNAD1 1 75670 1.32153E-5 37835 0 3.1841E-5
1-109399543-A-G c.-104+8T>C splice_region AKNAD1 229 2918 0.0784784 1459 6 0.095525
1-109399644-T-C c.-197A>G 5_prime_UTR_premature_start_codon_gain AKNAD1 327 4322 0.0756594 2161 14 0.095443
1-109400732-G-A c.-288C>T 5_prime_UTR_premature_start_codon_gain AKNAD1 1 42758 2.33874E-5 21379 0 NA
1-109400817-G-A c.-373C>T 5_prime_UTR_premature_start_codon_gain AKNAD1 4 42822 9.34099E-5 21411 0 3.18613E-5
1-109505983-G-A p.Asp38Asp splice_region+synonymous AKNAD1 1 11540 8.66551E-5 5770 0 9.38086E-5
1-109505988-G-A p.Pro37Ser missense AKNAD1 1 11868 8.42602E-5 5934 0 7.69124E-6
1-109506000-T-A p.Arg33Trp missense AKNAD1 2 12312 1.62443E-4 6156 0 0.00279278
1-109506010-G-T p.Ser29Ser synonymous AKNAD1 1 12618 7.92519E-5 6309 0 NA
1-109506029-C-G p.Arg23Pro missense AKNAD1 180 12934 0.0139168 6467 0 0.0132862
1-109506046-G-A p.Cys17Cys synonymous AKNAD1 2 13004 1.53799E-4 6502 0 3.18654E-4
1-109506046-G-C p.Cys17Trp missense AKNAD1 1 13006 7.68876E-5 6503 0 2.29417E-5
1-109506067-G-A p.Thr10Thr synonymous AKNAD1 2 12980 1.54083E-4 6490 0 6.37227E-5
1-109506083-C-CTGGG p.Arg5fs frameshift AKNAD1 2 12930 1.54679E-4 6465 0 3.18532E-5
1-109506088-C-T p.Arg3Arg synonymous AKNAD1 2 12868 1.55424E-4 6434 0 1.83632E-4
1-109506091-C-A p.Thr2Thr synonymous AKNAD1 1 12848 7.78331E-5 6424 0 7.64429E-4
1-109506096-T-C p.Met1? start_lost AKNAD1 1 12788 7.81983E-5 6394 0 6.37186E-5