Variant

Variant ID Consequence Effect Gene AC AN AF NS NHOM maxEAF
9-117099344-C-A p.Cys897Phe missense AKNA 1 73952 1.35223E-5 36976 0 NA
9-117099353-C-T p.Arg894Gln missense AKNA 4 76184 5.25045E-5 38092 0 0.00205339
9-117099354-G-A p.Arg894Trp missense AKNA 1 76182 1.31265E-5 38091 0 5.18882E-6
9-117099365-G-C p.Ala890Gly missense AKNA 2 78156 2.55898E-5 39078 0 4.50694E-6
9-117099371-C-T p.Arg888His missense AKNA 4 78450 5.09879E-5 39225 0 1.02526E-4
9-117099371-C-A p.Arg888Leu missense AKNA 1 78452 1.27466E-5 39226 0 NA
9-117099372-G-A p.Arg888Cys missense AKNA 8 78656 1.01709E-4 39328 0 1.59949E-4
9-117099375-G-T p.Leu887Met missense AKNA 5 79068 6.32367E-5 39534 0 3.19673E-5
9-117099376-G-C p.Asp886Glu missense AKNA 1 79096 1.26429E-5 39548 0 NA
9-117099379-G-A p.Ala885Ala synonymous AKNA 38 79226 4.79641E-4 39613 1 0.00203459
9-117099388-C-T p.Ser882Ser synonymous AKNA 49 79998 6.12515E-4 39999 0 6.38488E-4
9-117099389-G-A p.Ser882Leu missense AKNA 9 80150 1.12289E-4 40075 0 1.91522E-4
9-117099401-T-C p.Gln878Arg missense AKNA 1 80842 1.23698E-5 40421 0 1.02367E-4
9-117099416-C-T p.Arg873His missense AKNA 1 80986 1.23478E-5 40493 0 8.92204E-6
9-117099417-G-A p.Arg873Cys missense AKNA 3 81164 3.69622E-5 40582 0 4.0783E-5
9-117099420-C-T p.Val872Ile missense AKNA 20 81188 2.46342E-4 40594 0 6.25E-4
9-117099421-G-A p.Ser871Ser synonymous AKNA 32 81246 3.93866E-4 40623 0 9.5645E-4
9-117099426-C-T p.Glu870Lys missense AKNA 1 81330 1.22956E-5 40665 0 5.04541E-4
9-117099427-G-A p.Ala869Ala synonymous AKNA 5 81330 6.14779E-5 40665 0 2.8688E-4
9-117099429-C-T p.Ala869Thr missense AKNA 8 81350 9.83405E-5 40675 0 6.37349E-5
9-117099437-A-G p.Val866Ala missense AKNA 1 81452 1.22772E-5 40726 0 8.62084E-6
9-117099438-C-T p.Val866Met missense AKNA 1 81424 1.22814E-5 40712 0 3.44626E-5
9-117099439-G-A p.Ala865Ala synonymous AKNA 5 81400 6.14251E-5 40700 0 1.27413E-4
9-117099443-C-T p.Arg864Gln missense AKNA 1 81512 1.22681E-5 40756 0 6.00467E-5
9-117099444-G-A p.Arg864Trp missense AKNA 1 81456 1.22766E-5 40728 0 6.37024E-5
9-117099451-G-T p.Ala861Ala synonymous AKNA 2 81546 2.4526E-5 40773 0 0.00125
9-117099458-T-C p.Asn859Ser missense AKNA 3 81584 3.67719E-5 40792 0 3.18674E-5
9-117099475-G-A p.Gly853Gly synonymous AKNA 12 81634 1.46998E-4 40817 0 0.0025
9-117099483-C-T p.Asp851Asn missense AKNA 4 81652 4.89884E-5 40826 0 6.82477E-5
9-117099484-G-A p.Leu850Leu synonymous AKNA 2 81666 2.449E-5 40833 0 3.18674E-5
9-117099497-T-A p.His846Leu missense AKNA 1 81692 1.22411E-5 40846 0 1.71594E-5
9-117099500-C-T p.Arg845Gln missense AKNA 3 81732 3.67053E-5 40866 0 2.47975E-5
9-117099501-G-A p.Arg845Trp missense AKNA 1 81782 1.22276E-5 40891 0 1.24212E-5
9-117099504-G-A p.His844Tyr missense AKNA 1 81782 1.22276E-5 40891 0 1.72259E-5
9-117099506-C-G p.Arg843Thr missense AKNA 3 81760 3.66928E-5 40880 0 6.3743E-5
9-117099509-C-T p.Arg842Gln missense AKNA 7 81726 8.56521E-5 40863 0 5.04541E-4
9-117099510-G-A p.Arg842Trp missense AKNA 3 81806 3.66721E-5 40903 0 6.25E-4
9-117099535-C-T p.Pro833Pro synonymous AKNA 3 81402 3.68541E-5 40701 0 5.04032E-4
9-117099536-G-A p.Pro833Leu missense AKNA 30 81446 3.68342E-4 40723 0 4.46087E-4
9-117099557-G-C p.Ala826Gly missense AKNA 3 81528 3.67972E-5 40764 0 8.96202E-6
9-117099559-T-C p.Ser825Ser synonymous AKNA 1 81454 1.22769E-5 40727 0 NA
9-117099574-A-G p.Pro820Pro synonymous AKNA 177 81042 0.00218405 40521 1 0.00417623
9-117099586-C-CA c.2448-1_2448insT splice_acceptor AKNA 1 80646 1.23999E-5 40323 0 NA
9-117103817-C-T p.Ala815Thr missense AKNA 2 78842 2.53672E-5 39421 0 8.26569E-6
9-117103818-G-A p.Ala814Ala synonymous AKNA 1 78954 1.26656E-5 39477 0 3.30442E-5
9-117103825-G-A p.Pro812Leu missense AKNA 4 78958 5.06598E-5 39479 0 2.47566E-5
9-117103828-T-C p.Tyr811Cys missense AKNA 2 78888 2.53524E-5 39444 0 8.03904E-6
9-117103838-T-C p.Ile808Val missense AKNA 1759 79124 0.0222309 39562 114 0.0516757
9-117103838-T-A p.Ile808Phe missense AKNA 1 79290 1.26119E-5 39645 0 NA
9-117103845-C-T p.Ser805Ser synonymous AKNA 6 79382 7.55839E-5 39691 0 1.27486E-4
9-117103846-G-A p.Ser805Leu missense AKNA 4 79396 5.03804E-5 39698 0 1.20519E-5
9-117103848-G-T p.Ser804Ser synonymous AKNA 1 79516 1.25761E-5 39758 0 6.37105E-5
9-117103849-G-A p.Ser804Phe missense AKNA 1 79576 1.25666E-5 39788 0 4.01642E-6
9-117103853-T-C p.Ile803Val missense AKNA 2 79604 2.51244E-5 39802 0 NA
9-117103859-C-A p.Ala801Ser missense AKNA 20 79724 2.50865E-4 39862 0 3.50408E-4
9-117103867-G-A p.Pro798Leu missense AKNA 8 79922 1.00098E-4 39961 0 2.0071E-5
9-117103870-G-A p.Pro797Leu missense AKNA 2 79950 2.50156E-5 39975 0 1.64929E-5
9-117103872-G-T p.Ala796Ala synonymous AKNA 2 79966 2.50106E-5 39983 0 1.20561E-5
9-117103887-C-T p.Ala791Ala synonymous AKNA 5 79768 6.26818E-5 39884 0 0.00100908
9-117103891-G-A p.Thr790Ile missense AKNA 1 80212 1.2467E-5 40106 0 6.37592E-5
9-117103900-T-C p.Tyr787Cys missense AKNA 2327 80164 0.029028 40082 184 0.0668389
9-117103901-A-G p.Tyr787His missense AKNA 1 80248 1.24614E-5 40124 0 8.04298E-6
9-117103910-C-T p.Gly784Arg missense AKNA 2 79958 2.50131E-5 39979 0 3.19163E-5
9-117103910-C-CG p.Gly784fs frameshift AKNA 2 79954 2.50144E-5 39977 0 3.19163E-5
9-117103911-G-A p.Pro783Pro synonymous AKNA 2 80000 2.5E-5 40000 0 1.65262E-5
9-117103913-G-A p.Pro783Ser missense AKNA 3 80006 3.74972E-5 40003 0 NA
9-117103915-G-A p.Pro782Leu missense AKNA 1 79938 1.25097E-5 39969 0 1.65136E-5
9-117103919-G-T p.Pro781Thr missense AKNA 1 79966 1.25053E-5 39983 0 3.30431E-5
9-117103921-C-T p.Arg780His missense AKNA 6 79778 7.52087E-5 39889 0 0.00100806
9-117103926-C-T p.Ser778Ser synonymous AKNA 4 80064 4.996E-5 40032 0 7.34074E-4
9-117103929-C-T p.Ser777Ser synonymous AKNA 2 80234 2.49271E-5 40117 0 3.19081E-5
9-117103930-G-A p.Ser777Leu missense AKNA 4 80292 4.98182E-5 40146 0 8.98781E-5
9-117103932-C-T p.Gly776Gly synonymous AKNA 1 80498 1.24227E-5 40249 0 1.6581E-5
9-117103935-C-T p.Ala775Ala synonymous AKNA 1 80590 1.24085E-5 40295 0 1.66005E-5
9-117103936-G-A p.Ala775Val missense AKNA 5 80576 6.20532E-5 40288 0 6.95644E-5
9-117103945-C-T p.Ser772Asn missense AKNA 9 80924 1.11215E-4 40462 0 6.99767E-5
9-117103963-G-C p.Pro766Arg missense AKNA 1 81332 1.22953E-5 40666 0 3.1902E-5
9-117103973-A-G p.Ser763Pro missense AKNA 39866 78740 0.506299 39370 10585 0.604181
9-117103987-G-C p.Thr758Arg missense AKNA 8 81720 9.78953E-5 40860 0 4.4247E-5
9-117103987-G-A p.Thr758Met missense AKNA 2 81720 2.44738E-5 40860 0 8.8494E-5
9-117103994-C-T p.Ala756Thr missense AKNA 1 81702 1.22396E-5 40851 0 NA
9-117104008-A-G c.2255-3T>C splice_region AKNA 4 81638 4.89968E-5 40819 0 4.04012E-5
9-117104010-C-G c.2255-5G>C splice_region AKNA 4 81620 4.90076E-5 40810 0 5.06729E-6
9-117104281-G-C c.2254+8C>G splice_region AKNA 2 83180 2.40442E-5 41590 0 NA
9-117104305-T-C p.Pro746Pro synonymous AKNA 1 83220 1.20163E-5 41610 0 NA
9-117104311-A-G p.Asp744Asp synonymous AKNA 1 83214 1.20172E-5 41607 0 4.12766E-5
9-117104312-T-C p.Asp744Gly missense AKNA 1 83212 1.20175E-5 41606 0 8.25655E-6
9-117104321-G-A p.Pro741Leu missense AKNA 1 83236 1.2014E-5 41618 0 8.26624E-6
9-117104322-G-C p.Pro741Ala missense AKNA 5 83224 6.00788E-5 41612 0 NA
9-117104327-G-T p.Ser739Tyr missense AKNA 1 83206 1.20184E-5 41603 0 NA
9-117104327-G-A p.Ser739Phe missense AKNA 2 83206 2.40367E-5 41603 0 3.18593E-5
9-117104330-C-T p.Gly738Glu missense AKNA 1 83186 1.20213E-5 41593 0 NA
9-117104333-A-G p.Val737Ala missense AKNA 1 83184 1.20215E-5 41592 0 3.98394E-6
9-117104339-C-T p.Gly735Asp missense AKNA 2 83146 2.40541E-5 41573 0 2.49099E-5
9-117104340-C-T p.Gly735Ser missense AKNA 19 83130 2.28558E-4 41565 0 7.97385E-6
9-117104353-C-T p.Gln730Gln synonymous AKNA 1 83036 1.2043E-5 41518 0 5.60117E-5
9-117104361-T-C p.Thr728Ala missense AKNA 2 82894 2.41272E-5 41447 0 3.19244E-5
9-117104363-T-C p.Asp727Gly missense AKNA 2 82870 2.41342E-5 41435 0 8.54E-6
9-117104367-C-T p.Ala726Thr missense AKNA 2 82688 2.41873E-5 41344 0 2.60083E-5
9-117104368-G-A p.Pro725Pro synonymous AKNA 861 82596 0.0104242 41298 20 0.0211816
9-117104374-C-T p.Pro723Pro synonymous AKNA 1 82428 1.21318E-5 41214 0 5.03525E-4
9-117104386-G-C p.Asp719Glu missense AKNA 1 81872 1.22142E-5 40936 0 9.44697E-6
9-117104388-C-G p.Asp719His missense AKNA 1 81760 1.22309E-5 40880 0 9.53925E-6
9-117104390-C-A p.Gly718Val missense AKNA 2 81686 2.4484E-5 40843 0 NA
9-117105987-C-T c.2137+1G>A splice_donor AKNA 1 82992 1.20494E-5 41496 0 7.9552E-6
9-117105989-C-T p.Ala712Ala splice_region+synonymous AKNA 52 83016 6.26385E-4 41508 0 6.36902E-4
9-117105990-G-A p.Ala712Val missense+splice_region AKNA 4 83018 4.81823E-5 41509 0 6.36943E-5
9-117106003-T-C p.Arg708Gly missense AKNA 6 83092 7.22091E-5 41546 0 3.18471E-5
9-117106011-C-T p.Arg705Gln missense AKNA 6 83142 7.21657E-5 41571 0 6.37105E-5
9-117106012-G-A p.Arg705Trp missense AKNA 3 83172 3.60698E-5 41586 0 4.12249E-5
9-117106012-G-T p.Arg705Arg synonymous AKNA 1 83174 1.2023E-5 41587 0 NA
9-117106012-G-C p.Arg705Gly missense AKNA 1 83174 1.2023E-5 41587 0 NA
9-117106014-C-A p.Cys704Phe missense AKNA 1 83194 1.20201E-5 41597 0 8.24498E-6
9-117106020-G-A p.Pro702Leu missense AKNA 2 83230 2.40298E-5 41615 0 4.94698E-5
9-117106026-G-A p.Ser700Phe missense AKNA 2 83242 2.40263E-5 41621 0 NA
9-117106026-G-C p.Ser700Cys missense AKNA 2 83242 2.40263E-5 41621 0 6.37024E-5
9-117106032-G-A p.Thr698Ile missense AKNA 1 83262 1.20103E-5 41631 0 2.38698E-5
9-117106033-T-A p.Thr698Ser missense AKNA 6 83260 7.20634E-5 41630 1 0.00151057
9-117106041-C-T p.Gly695Asp missense AKNA 3 83258 3.60326E-5 41629 0 8.25273E-6
9-117106046-T-G p.Pro693Pro synonymous AKNA 1 83270 1.20091E-5 41635 0 6.36983E-5
9-117106052-C-T p.Ala691Ala synonymous AKNA 1 83258 1.20109E-5 41629 0 0.00100705
9-117106053-G-A p.Ala691Val missense AKNA 1 83260 1.20106E-5 41630 0 1.99029E-5
9-117106060-G-A p.Pro689Ser missense AKNA 1 83276 1.20083E-5 41638 0 8.26911E-6
9-117106078-C-T p.Glu683Lys missense AKNA 1 83244 1.20129E-5 41622 0 1.91144E-4
9-117106079-G-A p.His682His synonymous AKNA 1 83242 1.20132E-5 41621 0 8.33597E-6
9-117106086-G-GTGTATTGGCCCC c.2042-4_2042-3insGGGGCCAATACA splice_region AKNA 1 83198 1.20195E-5 41599 0 NA
9-117106089-G-A c.2042-6C>T splice_region AKNA 1 83188 1.2021E-5 41594 0 1.67468E-5
9-117108157-C-T p.Arg676Gln missense AKNA 2 82488 2.4246E-5 41244 0 2.47431E-5
9-117108158-G-A p.Arg676Trp missense AKNA 9 82536 1.09043E-4 41268 0 6.25E-4
9-117108162-G-A p.Thr674Thr synonymous AKNA 1 82656 1.20983E-5 41328 0 3.18674E-5
9-117108163-G-T p.Thr674Asn missense AKNA 1 82660 1.20978E-5 41330 0 3.18715E-5
9-117108171-G-A p.Asp671Asp synonymous AKNA 1 82790 1.20788E-5 41395 0 5.03525E-4
9-117108172-T-C p.Asp671Gly missense AKNA 1 82794 1.20782E-5 41397 0 NA
9-117108185-C-A p.Ala667Ser missense AKNA 1 82962 1.20537E-5 41481 0 3.9794E-6
9-117108211-C-T p.Arg658Gln missense AKNA 10 83138 1.20282E-4 41569 0 1.59337E-4
9-117108214-G-A p.Ala657Val missense AKNA 1 83160 1.2025E-5 41580 0 1.19349E-5
9-117108220-T-C p.Gln655Arg missense AKNA 15 83182 1.80327E-4 41591 0 2.23214E-4
9-117108233-T-C p.Lys651Glu missense AKNA 16 83200 1.92308E-4 41600 0 4.28611E-4
9-117108244-C-T p.Ser647Asn missense AKNA 2 83200 2.40385E-5 41600 0 NA
9-117108250-T-G p.Glu645Ala missense AKNA 1 83176 1.20227E-5 41588 0 NA
9-117108253-G-A p.Ser644Phe missense AKNA 1 83184 1.20215E-5 41592 0 1.59229E-5
9-117108276-C-T p.Glu636Glu synonymous AKNA 22 82992 2.65086E-4 41496 0 0.0020141
9-117108289-C-T p.Ser632Asn missense+splice_region AKNA 1 82832 1.20726E-5 41416 0 3.18878E-5
9-117108953-G-A p.Ser630Ser synonymous AKNA 1 82992 1.20494E-5 41496 0 4.08107E-6
9-117108956-C-T p.Leu629Leu synonymous AKNA 1 82988 1.20499E-5 41494 0 NA
9-117108960-C-T p.Arg628Gln missense AKNA 1 83050 1.20409E-5 41525 0 6.25E-4
9-117108970-CCCGAGGCACTGAGGAAGA-C p.Ser619_Arg624del conservative_inframe_deletion AKNA 1 83132 1.20291E-5 41566 0 NA
9-117108971-C-T p.Arg624Arg synonymous AKNA 3648 83008 0.0439476 41504 399 0.092818
9-117108972-C-T p.Arg624Gln missense AKNA 2 83150 2.40529E-5 41575 0 NA
9-117108973-G-A p.Arg624Trp missense AKNA 1 83146 1.2027E-5 41573 0 6.37064E-5
9-117108974-A-T p.Pro623Pro synonymous AKNA 1 83154 1.20259E-5 41577 0 6.37105E-5
9-117108975-G-A p.Pro623Leu missense AKNA 6 83176 7.21362E-5 41588 0 8.25273E-6
9-117108993-G-A p.Ala617Val missense AKNA 1 83238 1.20137E-5 41619 0 NA
9-117108996-C-T p.Arg616Gln missense AKNA 2 83240 2.40269E-5 41620 0 3.18552E-5
9-117109001-C-T p.Arg614Arg synonymous AKNA 1 83254 1.20114E-5 41627 0 NA
9-117109043-A-G p.Pro600Pro synonymous AKNA 1 83264 1.201E-5 41632 0 NA
9-117109044-G-A p.Pro600Leu missense AKNA 6 83262 7.20617E-5 41631 0 8.0289E-6
9-117109049-T-A p.Arg598Ser missense AKNA 1 83246 1.20126E-5 41623 0 8.24674E-6
9-117109057-T-C p.Thr596Ala missense AKNA 1 83216 1.20169E-5 41608 0 NA
9-117109059-G-T p.Ser595Tyr missense AKNA 2 83196 2.40396E-5 41598 0 1.2091E-5
9-117110010-T-C p.Tyr591Cys missense AKNA 1 79106 1.26413E-5 39553 0 6.37959E-5
9-117110029-C-T p.Ala585Thr missense AKNA 47 79654 5.90052E-4 39827 0 0.00223714
9-117110034-G-T p.Ser583Tyr missense AKNA 2 79804 2.50614E-5 39902 0 5.52524E-5
9-117110044-G-T p.Pro580Thr missense AKNA 1 80014 1.24978E-5 40007 0 3.18776E-5
9-117110046-C-T p.Arg579Gln missense AKNA 15540 79210 0.196187 39605 1549 0.235332
9-117110047-G-A p.Arg579Trp missense AKNA 5 80178 6.23612E-5 40089 0 2.23001E-4
9-117110050-C-G p.Gly578Arg missense AKNA 1 80256 1.24601E-5 40128 0 NA
9-117110050-C-T p.Gly578Ser missense AKNA 7 80256 8.72209E-5 40128 0 8.19941E-5
9-117110051-G-A p.Arg577Arg synonymous AKNA 3 80342 3.73404E-5 40171 0 3.4404E-5
9-117110052-C-T p.Arg577His missense AKNA 56 80406 6.96465E-4 40203 0 0.00108108
9-117110053-G-A p.Arg577Cys missense AKNA 1 80466 1.24276E-5 40233 0 1.3675E-5
9-117110058-C-T p.Arg575Gln missense AKNA 3 80578 3.7231E-5 40289 0 1.08696E-4
9-117110059-G-A p.Arg575Trp missense AKNA 2 80610 2.48108E-5 40305 0 1.59388E-4
9-117110062-C-A p.Ala574Ser missense AKNA 4 80662 4.95896E-5 40331 0 5.35504E-5
9-117110063-G-A p.Pro573Pro synonymous AKNA 17 80716 2.10615E-4 40358 0 4.63116E-5
9-117110067-C-T p.Arg572His missense AKNA 2 80848 2.47378E-5 40424 0 3.30133E-5
9-117110068-G-A p.Arg572Cys missense AKNA 1 80904 1.23603E-5 40452 0 1.3113E-5
9-117110088-C-T p.Arg565His missense AKNA 95 81190 0.00117009 40595 0 0.0026138
9-117110089-G-A p.Arg565Cys missense AKNA 1 81242 1.23089E-5 40621 0 6.41643E-5
9-117110092-T-C p.Thr564Ala missense AKNA 7 81252 8.61517E-5 40626 0 0.00106157
9-117110093-C-T p.Pro563Pro synonymous AKNA 6 81278 7.38207E-5 40639 0 5.06073E-5
9-117110094-G-A p.Pro563Leu missense AKNA 1 81296 1.23007E-5 40648 0 1.51439E-4
9-117110097-CT-C p.Ser562fs frameshift AKNA 1 81296 1.23007E-5 40648 0 NA
9-117110102-CT-C p.Gln560fs frameshift AKNA 1 81318 1.22974E-5 40659 0 NA
9-117110104-G-A p.Gln560* stop_gained AKNA 1 81332 1.22953E-5 40666 0 NA
9-117110107-G-A p.Leu559Phe missense AKNA 1 81334 1.2295E-5 40667 0 6.46028E-6
9-117110112-T-C p.Gln557Arg missense AKNA 6940 81258 0.085407 40629 1533 0.176412
9-117110117-C-G p.Leu555Leu synonymous AKNA 1 80984 1.23481E-5 40492 0 0.0105909
9-117110118-A-G p.Leu555Pro missense AKNA 1 81056 1.23371E-5 40528 0 6.04661E-4
9-117110129-C-T p.Leu551Leu synonymous AKNA 1 81234 1.23101E-5 40617 0 1.30196E-5
9-117110133-C-T p.Arg550Gln missense AKNA 2 81266 2.46105E-5 40633 0 5.21485E-5
9-117110134-G-A p.Arg550Trp missense AKNA 2 81256 2.46136E-5 40628 0 1.56413E-4
9-117110139-C-T p.Arg548His missense AKNA 4 81290 4.92065E-5 40645 0 9.56084E-5
9-117110140-G-A p.Arg548Cys missense AKNA 7 81284 8.61178E-5 40642 0 2.07275E-4
9-117110143-G-A p.Leu547Phe missense AKNA 1 81314 1.2298E-5 40657 0 6.42963E-6
9-117110146-G-A p.Arg546Trp missense AKNA 3 81310 3.68958E-5 40655 0 2.57215E-5
9-117110150-C-T p.Val544Val synonymous AKNA 1 81324 1.22965E-5 40662 0 NA
9-117110158-C-T p.Glu542Lys missense AKNA 1 81346 1.22932E-5 40673 0 NA
9-117110158-C-G p.Glu542Gln missense AKNA 1 81346 1.22932E-5 40673 0 NA
9-117110160-T-C p.Gln541Arg missense AKNA 139 81342 0.00170883 40671 1 0.00385645
9-117110167-C-T p.Glu539Lys missense AKNA 1 81320 1.22971E-5 40660 0 NA
9-117110173-T-C p.Ile537Val missense AKNA 5 81328 6.14794E-5 40664 0 8.32725E-5
9-117110180-G-A p.Asp534Asp splice_region+synonymous AKNA 1182 81270 0.0145441 40635 48 0.0264134
9-117110180-G-GTCTCGCC c.1602-1_1602insGGCGAGA splice_acceptor AKNA 1 81302 1.22998E-5 40651 0 NA
9-117111198-C-T p.Gly9Arg missense AKNA 1 10534 9.49307E-5 5267 0 1.55642E-5
9-117111207-C-T p.Gly6Ser missense AKNA 72 10530 0.00683761 5265 0 0.0151679
9-117111208-G-A p.Gly5Gly synonymous AKNA 4 10526 3.80011E-4 5263 0 5.53403E-4
9-117113150-C-G p.Arg530Ser missense AKNA 1 82294 1.21516E-5 41147 0 NA
9-117113154-G-A p.Thr529Ile missense AKNA 16 82358 1.94274E-4 41179 0 0.0020284
9-117113156-G-A p.Leu528Leu synonymous AKNA 1 82384 1.21383E-5 41192 0 3.10832E-5
9-117113180-T-C p.Thr520Thr synonymous AKNA 10 82550 1.21139E-4 41275 0 8.92857E-4
9-117113191-A-G p.Cys517Arg missense AKNA 1 82510 1.21197E-5 41255 0 NA
9-117113192-G-T p.Pro516Pro synonymous AKNA 13 82512 1.57553E-4 41256 0 5.73541E-4
9-117113192-G-A p.Pro516Pro synonymous AKNA 2 82514 2.42383E-5 41257 0 1.22117E-5
9-117113205-G-A p.Ala512Val missense AKNA 1 82366 1.21409E-5 41183 0 NA
9-117113206-C-T p.Ala512Thr missense AKNA 4 82266 4.86228E-5 41133 0 4.29886E-5
9-117113207-G-A p.Ala511Ala synonymous AKNA 994 82250 0.0120851 41125 38 0.0280824
9-117113215-C-T p.Ala509Thr missense AKNA 5 82048 6.09399E-5 41024 0 4.04397E-5
9-117113216-G-A p.Pro508Pro synonymous AKNA 13 82172 1.58205E-4 41086 0 6.27353E-4
9-117113218-G-C p.Pro508Ala missense AKNA 6 82170 7.30193E-5 41085 0 6.37227E-5
9-117113218-G-A p.Pro508Ser missense AKNA 1 82170 1.21699E-5 41085 0 4.01075E-6
9-117113220-G-A p.Ala507Val missense AKNA 2 82142 2.43481E-5 41071 0 3.18593E-5
9-117113222-T-TGGGGGGGGGGGG p.Pro506_Ala507insProProProPro disruptive_inframe_insertion AKNA 1 82062 1.21859E-5 41031 0 NA
9-117113223-G-A p.Pro506Leu missense AKNA 8 82096 9.74469E-5 41048 0 6.37146E-5
9-117113236-T-C p.Ile502Val missense AKNA 5 82060 6.0931E-5 41030 0 3.35025E-5
9-117113238-G-C p.Thr501Arg missense AKNA 4 82098 4.87223E-5 41049 0 5.1907E-5
9-117113244-T-C p.Asn499Ser missense AKNA 2 82148 2.43463E-5 41074 0 5.04032E-4
9-117113252-G-C p.Pro496Pro synonymous AKNA 2 82136 2.43499E-5 41068 0 3.36944E-5
9-117113253-G-A p.Pro496Leu missense AKNA 1 82138 1.21746E-5 41069 0 8.42134E-6
9-117113268-C-T p.Arg491Gln missense AKNA 9 81968 1.09799E-4 40984 0 9.19573E-5
9-117113269-G-A p.Arg491Trp missense AKNA 4 81950 4.88102E-5 40975 0 3.18573E-5
9-117113279-C-T p.Glu487Glu synonymous AKNA 1 81850 1.22175E-5 40925 0 NA
9-117113285-C-G p.Glu485Asp missense AKNA 1 81786 1.2227E-5 40893 0 3.51284E-5
9-117113289-G-A p.Ser484Leu missense AKNA 1 81804 1.22243E-5 40902 0 NA
9-117113301-G-A p.Ala480Val missense+splice_region AKNA 8 81716 9.79E-5 40858 0 1.02869E-4
9-117113301-G-C p.Ala480Gly missense+splice_region AKNA 1 81716 1.22375E-5 40858 0 9.56023E-5
9-117118197-G-A c.1438+8C>T splice_region AKNA 1 82880 1.20656E-5 41440 0 NA
9-117118205-C-T p.Ala480Thr missense+splice_region AKNA 3 82978 3.61542E-5 41489 0 1.19637E-5
9-117118211-C-T p.Glu478Lys missense AKNA 2 83012 2.40929E-5 41506 0 8.37016E-6
9-117118216-GCCAGTGTCCGCT-G p.Glu472_Leu475del disruptive_inframe_deletion AKNA 1 83050 1.20409E-5 41525 0 8.34697E-6
9-117118217-C-T p.Ala476Thr missense AKNA 11 83052 1.32447E-4 41526 0 1.59266E-4
9-117118225-C-T p.Arg473Gln missense AKNA 2 83118 2.40622E-5 41559 0 7.49051E-5
9-117118234-C-T p.Ser470Asn missense AKNA 1 83174 1.2023E-5 41587 0 NA
9-117118245-T-C p.Ala466Ala synonymous AKNA 680 83182 0.00817485 41591 19 0.016276
9-117118248-C-T p.Arg465Arg synonymous AKNA 1 83220 1.20163E-5 41610 0 9.55353E-5
9-117118255-C-T p.Arg463Gln missense AKNA 1 83252 1.20117E-5 41626 0 8.2631E-6
9-117118256-G-A p.Arg463Trp missense AKNA 1 83256 1.20111E-5 41628 0 9.56023E-5
9-117118276-G-A p.Ser456Phe missense AKNA 2 83308 2.40073E-5 41654 0 1.19303E-5
9-117118293-T-C p.Gln450Gln synonymous AKNA 2 83332 2.40004E-5 41666 0 NA
9-117118300-C-T p.Arg448Gln missense AKNA 7 83322 8.40114E-5 41661 0 3.18134E-5
9-117118301-G-A p.Arg448Trp missense AKNA 2 83334 2.39998E-5 41667 0 3.18573E-5
9-117118303-G-A p.Pro447Leu missense AKNA 1 83340 1.1999E-5 41670 0 8.23805E-6
9-117118355-G-A p.Pro430Ser missense AKNA 2 83282 2.40148E-5 41641 0 3.18512E-5
9-117118361-A-G p.Ser428Pro missense AKNA 2 83270 2.40183E-5 41635 0 7.95463E-6
9-117118367-C-G p.Gly426Arg missense AKNA 1 83240 1.20135E-5 41620 0 6.37024E-5
9-117118370-C-T p.Asp425Asn missense AKNA 5 83226 6.00774E-5 41613 0 2.38696E-5
9-117118375-G-C p.Pro423Arg missense AKNA 1 83202 1.20189E-5 41601 0 NA
9-117118379-C-T p.Val422Met missense AKNA 676 83120 0.00813282 41560 18 0.0161198
9-117118383-T-G p.Ala420Ala synonymous AKNA 2 83128 2.40593E-5 41564 0 3.18695E-5
9-117118388-C-G p.Ala419Pro missense AKNA 5 83058 6.01989E-5 41529 0 8.25437E-6
9-117118400-C-T p.Ala415Thr missense AKNA 4 82750 4.83384E-5 41375 0 5.58236E-5
9-117118413-T-C p.Thr410Thr synonymous AKNA 2 82296 2.43025E-5 41148 0 1.19847E-5
9-117118419-G-A c.1227-3C>T splice_region AKNA 2 81904 2.44188E-5 40952 0 3.36095E-5
9-117119135-C-T c.1226+8G>A splice_region AKNA 4 82852 4.82789E-5 41426 0 1.10829E-5
9-117119136-G-A c.1226+7C>T splice_region AKNA 30 82824 3.62214E-4 41412 0 4.78133E-4
9-117119139-A-G c.1226+4T>C splice_region AKNA 1 82836 1.2072E-5 41418 0 3.18857E-5
9-117119154-G-A p.Leu405Leu synonymous AKNA 1 83088 1.20354E-5 41544 0 8.38757E-6
9-117119165-C-T p.Glu402Lys missense AKNA 14 83198 1.68273E-4 41599 0 3.82629E-4
9-117119170-G-A p.Thr400Ile missense AKNA 1 83218 1.20166E-5 41609 0 8.29325E-6
9-117119180-G-A p.Leu397Phe missense AKNA 1 83264 1.201E-5 41632 0 2.47971E-5
9-117119195-T-C p.Ser392Gly missense AKNA 1 83292 1.2006E-5 41646 0 4.74681E-6
9-117119198-T-C p.Thr391Ala missense AKNA 1 83278 1.2008E-5 41639 0 NA
9-117119209-A-G p.Val387Ala missense AKNA 3 83288 3.60196E-5 41644 0 4.64378E-6
9-117119210-C-T p.Val387Met missense AKNA 1 83288 1.20065E-5 41644 0 NA
9-117119232-G-T p.Ser379Ser synonymous AKNA 5 83266 6.00485E-5 41633 0 2.47141E-5
9-117119233-G-A p.Ser379Phe missense AKNA 1 83260 1.20106E-5 41630 0 NA
9-117119235-C-T p.Ala378Ala synonymous AKNA 492 83218 0.00591218 41609 6 0.0125606
9-117119242-C-A p.Trp376Leu missense AKNA 12 83238 1.44165E-4 41619 0 1.15348E-4
9-117120202-TC-T p.Glu373fs frameshift AKNA 2 82374 2.42795E-5 41187 0 9.56023E-5
9-117120218-C-T p.Gly368Ser missense AKNA 3 82462 3.63804E-5 41231 0 3.33217E-5
9-117120219-G-A p.Gly367Gly synonymous AKNA 6 82484 7.27414E-5 41242 0 0.00151362
9-117120242-G-T p.Pro360Thr missense AKNA 1 82772 1.20814E-5 41386 0 NA
9-117120247-C-T p.Arg358His missense AKNA 4 82806 4.83057E-5 41403 0 3.3248E-5
9-117120248-G-T p.Arg358Ser missense AKNA 1 82816 1.2075E-5 41408 0 NA
9-117120253-G-C p.Ser356Cys missense AKNA 1 82900 1.20627E-5 41450 0 NA
9-117120260-C-T p.Gly354Ser missense AKNA 1 82906 1.20619E-5 41453 0 1.24626E-5
9-117120261-G-A p.Ser353Ser synonymous AKNA 8 82902 9.64995E-5 41451 0 3.98387E-4
9-117120263-T-G p.Ser353Arg missense AKNA 1 82932 1.20581E-5 41466 0 NA
9-117120267-C-T p.Glu351Glu synonymous AKNA 3 82964 3.61603E-5 41482 0 3.18593E-5
9-117120273-G-T p.Ser349Arg missense AKNA 1 82938 1.20572E-5 41469 0 8.29091E-6
9-117120290-G-C p.Gln344Glu missense AKNA 1 83018 1.20456E-5 41509 0 6.37105E-5
9-117120301-G-A p.Ala340Val missense AKNA 1 83006 1.20473E-5 41503 0 NA
9-117120302-C-T p.Ala340Thr missense AKNA 8 82994 9.63925E-5 41497 0 4.01439E-6
9-117120303-G-A p.Ser339Ser synonymous AKNA 5 83004 6.02381E-5 41502 0 4.40892E-5
9-117120312-G-A p.Gly336Gly synonymous AKNA 1 82988 1.20499E-5 41494 0 8.28295E-6
9-117120326-G-A p.Pro332Ser missense AKNA 1 83052 1.20406E-5 41526 0 NA
9-117120331-A-G p.Val330Ala missense AKNA 1 83030 1.20438E-5 41515 0 NA
9-117120332-C-T p.Val330Met missense AKNA 41 83030 4.93797E-4 41515 0 3.82385E-4
9-117120333-G-A p.Gly329Gly synonymous AKNA 1026 83012 0.0123597 41506 36 0.0242907
9-117120335-C-A p.Gly329Cys missense AKNA 2 83034 2.40865E-5 41517 0 7.99386E-6
9-117120345-A-G p.Pro325Pro synonymous AKNA 3 83052 3.61219E-5 41526 0 7.97862E-6
9-117120365-C-T p.Gly319Ser missense AKNA 37 83020 4.45676E-4 41510 0 3.18629E-5
9-117120370-C-A p.Gly317Val missense AKNA 1 82978 1.20514E-5 41489 0 3.18593E-5
9-117120375-C-T p.Met315Ile missense AKNA 3 82982 3.61524E-5 41491 1 3.18634E-5
9-117120380-G-A p.His314Tyr missense AKNA 1 82920 1.20598E-5 41460 0 8.24878E-6
9-117120383-C-T p.Gly313Arg missense AKNA 8 82912 9.64878E-5 41456 0 0.00125
9-117120384-G-A p.Asp312Asp synonymous AKNA 5 82912 6.03049E-5 41456 0 1.43427E-4
9-117120391-G-A p.Ala310Val missense AKNA 1 82814 1.20753E-5 41407 0 NA
9-117120405-G-C p.Phe305Leu missense AKNA 1 82672 1.2096E-5 41336 0 NA
9-117120410-C-G p.Gly304Arg missense AKNA 30 82620 3.63108E-4 41310 0 0.00151515
9-117120413-G-C p.Pro303Ala missense AKNA 1 82576 1.21101E-5 41288 0 NA
9-117120413-G-A p.Pro303Ser missense AKNA 2 82576 2.42201E-5 41288 0 NA
9-117120436-T-TC p.Glu295fs frameshift AKNA 1 81838 1.22193E-5 40919 0 8.26119E-6
9-117120438-C-T p.Thr294Thr synonymous AKNA 1 81718 1.22372E-5 40859 0 8.262E-6
9-117120450-G-A c.873-3C>T splice_region AKNA 3 81188 3.69513E-5 40594 0 8.27349E-6
9-117121868-A-T c.872+6T>A splice_region AKNA 1 83222 1.20161E-5 41611 0 3.97867E-6
9-117121870-T-G p.Ter832Tyrext*? stop_lost AKNA 1 83236 1.2014E-5 41618 0 NA
9-117121879-G-T p.Pro289Pro synonymous AKNA 1 83248 1.20123E-5 41624 0 NA
9-117121880-G-A p.Pro289Leu missense AKNA 4 83252 4.80469E-5 41626 0 1.64834E-5
9-117121881-G-A p.Pro289Ser missense AKNA 62 83246 7.44781E-4 41623 1 0.00125
9-117121887-C-A p.Gly287Trp missense AKNA 1 83270 1.20091E-5 41635 0 6.25E-4
9-117121888-A-G p.His286His synonymous AKNA 1 83270 1.20091E-5 41635 0 5.03525E-4
9-117121889-T-C p.His286Arg missense AKNA 1 83284 1.20071E-5 41642 0 7.95583E-6
9-117121894-T-C p.Lys284Lys synonymous AKNA 1 83276 1.20083E-5 41638 0 8.24266E-6
9-117121908-C-T p.Val280Met missense AKNA 2 83254 2.40229E-5 41627 0 1.98942E-5
9-117121909-C-G p.Pro279Pro synonymous AKNA 1 83254 1.20114E-5 41627 0 NA
9-117121910-G-A p.Pro279Leu missense AKNA 1 83248 1.20123E-5 41624 0 3.58429E-5
9-117121912-G-A p.Cys278Cys synonymous AKNA 2 83252 2.40234E-5 41626 0 6.43666E-5
9-117121947-TCCCTGGAGTTGCAGCCAC-T p.Val261_Gly266del conservative_inframe_deletion AKNA 2 83234 2.40286E-5 41617 0 NA
9-117121950-C-T p.Gly266Arg missense AKNA 2 83222 2.40321E-5 41611 0 3.99202E-6
9-117121952-G-A p.Pro265Leu missense AKNA 1 83222 1.20161E-5 41611 0 NA
9-117121962-C-T p.Ala262Thr missense AKNA 1 83194 1.20201E-5 41597 0 4.00449E-6
9-117121966-C-T p.Gly260Gly synonymous AKNA 4 83194 4.80804E-5 41597 0 5.03525E-4
9-117121986-C-T p.Asp254Asn missense AKNA 1 83048 1.20412E-5 41524 0 NA
9-117121990-T-TC p.Gly253fs frameshift AKNA 1 83002 1.20479E-5 41501 0 NA
9-117121994-C-G p.Gly251Ala missense AKNA 1 83030 1.20438E-5 41515 0 8.43982E-6
9-117121999-TTCC-T p.Glu249del disruptive_inframe_deletion AKNA 16 82560 1.93798E-4 41280 0 3.34093E-4
9-117122005-C-CTCCTCCTCCTCTCCTTCT p.Glu247_Glu248insGluGlyGluGluGluGlu disruptive_inframe_insertion AKNA 3 82894 3.61908E-5 41447 0 3.68086E-5
9-117122018-CCTT-C p.Glu242del disruptive_inframe_deletion AKNA 2 82644 2.42002E-5 41322 0 4.14298E-6
9-117122019-C-T p.Gly243Arg missense AKNA 1 82656 1.20983E-5 41328 0 NA
9-117122021-T-G p.Glu242Ala missense AKNA 1 82564 1.21118E-5 41282 0 NA
9-117122023-TTCC-T p.Glu241del disruptive_inframe_deletion AKNA 2 82570 2.42219E-5 41285 0 3.18613E-5
9-117122029-C-A p.Glu239Asp missense AKNA 1 82400 1.21359E-5 41200 0 4.1747E-6
9-117122031-C-T p.Glu239Lys missense AKNA 3 82360 3.64254E-5 41180 0 3.18492E-5
9-117122031-C-G p.Glu239Gln missense AKNA 1 82360 1.21418E-5 41180 0 NA
9-117122053-G-A p.Leu231Leu synonymous AKNA 6 81906 7.32547E-5 40953 0 1.25914E-5
9-117122054-A-G p.Leu231Pro missense AKNA 1 81860 1.2216E-5 40930 0 NA
9-117122060-T-C p.Lys229Arg missense AKNA 5 81826 6.11053E-5 40913 0 1.67055E-5
9-117122067-T-C p.Ser227Gly missense AKNA 1 81776 1.22285E-5 40888 0 NA
9-117122072-TACCTGCAGAAGAACACACAGAGGGGCATGACCTCTGCCCAGTGGGGGACAGCCAAGATCCAGCTGCTGGCCAGACACCCTGGTCAGGTCCAGGTGGCACTC-T p.Tyr225fs frameshift AKNA 6 81712 7.34286E-5 40856 0 NA
9-117122074-C-T p.Arg224Arg splice_region+synonymous AKNA 2 81726 2.4472E-5 40863 0 8.27061E-6
9-117122173-C-T c.671+3G>A splice_region AKNA 1 82920 1.20598E-5 41460 0 8.24429E-6
9-117122181-C-A p.Met222Ile missense AKNA 2 82990 2.40993E-5 41495 0 1.19318E-5
9-117122202-C-T p.Glu215Glu synonymous AKNA 40234 82288 0.488941 41144 10465 0.573125
9-117122210-G-C p.Gln213Glu missense AKNA 3 83094 3.61037E-5 41547 1 NA
9-117122219-T-C p.Lys210Glu missense AKNA 14 83086 1.685E-4 41543 0 9.94249E-5
9-117122219-T-G p.Lys210Gln missense AKNA 1 83086 1.20357E-5 41543 0 NA
9-117122221-T-A p.His209Leu missense AKNA 6 83082 7.22178E-5 41541 0 NA
9-117122221-T-C p.His209Arg missense AKNA 1 83082 1.20363E-5 41541 0 NA
9-117122223-C-T p.Arg208Arg synonymous AKNA 1 83060 1.20395E-5 41530 0 3.97687E-6
9-117122228-G-A p.Leu207Phe missense AKNA 1 83044 1.20418E-5 41522 0 NA
9-117122229-T-G p.Arg206Arg synonymous AKNA 2 83032 2.40871E-5 41516 0 NA
9-117122230-C-T p.Arg206Gln missense AKNA 7 83024 8.4313E-5 41512 0 1.23613E-4
9-117122231-G-A p.Arg206* stop_gained AKNA 11 83014 1.32508E-4 41507 0 5.03525E-4
9-117122242-T-C p.Asp202Gly missense AKNA 1 82918 1.20601E-5 41459 0 NA
9-117122254-TCCTCCACCTCACTGTTGCCAGAGCTCA-T p.Val189_Glu197del disruptive_inframe_deletion AKNA 2 82822 2.41482E-5 41411 0 NA
9-117122261-C-T p.Val196Met missense AKNA 2 82800 2.41546E-5 41400 0 1.19326E-5
9-117122262-C-T p.Glu195Glu synonymous AKNA 2 82808 2.41523E-5 41404 0 NA
9-117122294-C-T p.Val185Ile missense AKNA 1 82368 1.21406E-5 41184 0 7.55834E-5
9-117122295-G-A p.His184His synonymous AKNA 4 82398 4.85449E-5 41199 0 3.58029E-5
9-117122301-T-C p.Pro182Pro synonymous AKNA 5 82324 6.07356E-5 41162 0 3.30126E-5
9-117122310-G-A p.Gly179Gly synonymous AKNA 2 82078 2.43671E-5 41039 0 3.1837E-5
9-117122311-C-A p.Gly179Val missense AKNA 86 82028 0.00104842 41014 0 0.001875
9-117122314-G-C p.Thr178Ser missense AKNA 1 82040 1.21892E-5 41020 0 4.95581E-5
9-117122321-C-T p.Ala176Thr missense AKNA 6 81660 7.34754E-5 40830 0 5.03525E-4
9-117122322-G-A p.Ala175Ala synonymous AKNA 6 81652 7.34826E-5 40826 0 6.25E-4
9-117122324-C-T p.Ala175Thr missense AKNA 140 81456 0.00171872 40728 2 0.0028979
9-117123995-A-T p.Ser165Thr missense AKNA 1 82618 1.21039E-5 41309 0 1.19401E-5
9-117123998-T-G p.Thr164Pro missense AKNA 2 82630 2.42043E-5 41315 0 3.97985E-6
9-117123999-C-T p.Lys163Lys synonymous AKNA 2 82686 2.41879E-5 41343 0 NA
9-117124013-T-C p.Met159Val missense AKNA 3 82788 3.62371E-5 41394 0 8.23845E-6
9-117124019-C-A p.Ala157Ser missense AKNA 28 82778 3.38254E-4 41389 0 3.50475E-4
9-117124036-G-C p.Pro151Arg missense AKNA 8 82870 9.65367E-5 41435 0 5.03525E-4
9-117124044-C-T p.Thr148Thr synonymous AKNA 2 82786 2.41587E-5 41393 0 2.47162E-5
9-117124045-G-A p.Thr148Met missense AKNA 682 82780 0.0082387 41390 5 0.00678359
9-117124049-G-T p.Pro147Thr missense AKNA 1 82818 1.20747E-5 41409 0 NA
9-117124050-C-G p.Gln146His missense AKNA 1 82796 1.20779E-5 41398 0 NA
9-117124053-A-G p.His145His synonymous AKNA 1 82810 1.20758E-5 41405 0 3.97845E-6
9-117124056-G-A p.Leu144Leu synonymous AKNA 470 82824 0.00567468 41412 6 0.0123638
9-117124072-G-A p.Pro139Leu missense AKNA 2 82858 2.41377E-5 41429 0 2.4717E-5
9-117124075-G-A p.Thr138Ile missense AKNA 1 82882 1.20653E-5 41441 0 NA
9-117124077-G-A p.Ser137Ser synonymous AKNA 1 82866 1.20677E-5 41433 0 3.9807E-6
9-117124081-T-C p.Asp136Gly missense AKNA 2 82904 2.41243E-5 41452 0 7.41583E-5
9-117124092-G-A p.Asp132Asp synonymous AKNA 3 82960 3.6162E-5 41480 0 9.56694E-5
9-117124093-T-C p.Asp132Gly missense AKNA 1 82962 1.20537E-5 41481 0 3.98111E-6
9-117124094-C-T p.Asp132Asn missense AKNA 1 82968 1.20528E-5 41484 0 3.98197E-6
9-117124100-C-T p.Gly130Arg missense AKNA 43 82954 5.1836E-4 41477 1 0.00956697
9-117124101-G-A p.Pro129Pro synonymous AKNA 217 82958 0.00261578 41479 0 0.005
9-117124104-C-T p.Pro128Pro synonymous AKNA 2 82936 2.4115E-5 41468 0 6.38121E-5
9-117124105-G-A p.Pro128Leu missense AKNA 1 82946 1.2056E-5 41473 0 1.64837E-5
9-117124113-C-G p.Glu125Asp missense AKNA 5 82966 6.02657E-5 41483 0 1.71592E-4
9-117124115-C-T p.Glu125Lys missense AKNA 7 82986 8.43516E-5 41493 0 6.3804E-5
9-117124118-G-C p.Gln124Glu missense AKNA 7 82958 8.438E-5 41479 0 2.47357E-5
9-117124122-G-T p.Thr122Thr synonymous AKNA 7 82976 8.43617E-5 41488 0 8.24661E-6
9-117124123-G-A p.Thr122Ile missense AKNA 133 82972 0.00160295 41486 0 0.00139381
9-117124125-C-G p.Gln121His missense AKNA 2 82956 2.41092E-5 41478 0 3.18878E-5
9-117124125-C-T p.Gln121Gln synonymous AKNA 8 82956 9.64367E-5 41478 0 3.54663E-4
9-117124135-T-A p.His118Leu missense AKNA 5 82970 6.02627E-5 41485 0 2.47598E-5
9-117124144-A-G p.Leu115Pro missense AKNA 1 82942 1.20566E-5 41471 0 3.1904E-5
9-117124152-C-G p.Leu112Leu synonymous AKNA 1 82842 1.20712E-5 41421 0 NA
9-117124152-C-T p.Leu112Leu synonymous AKNA 1 82842 1.20712E-5 41421 0 NA
9-117124160-T-C p.Ser110Gly missense AKNA 4 82772 4.83255E-5 41386 0 NA
9-117124168-C-T p.Arg107His missense AKNA 19 82594 2.30041E-4 41297 0 0.00151057
9-117124169-G-A p.Arg107Cys missense AKNA 5 82596 6.05356E-5 41298 0 1.4114E-4
9-117124170-G-A p.Tyr106Tyr synonymous AKNA 1 82550 1.21139E-5 41275 0 3.18512E-5
9-117124173-T-C p.Ile105Met missense AKNA 1 82506 1.21203E-5 41253 0 NA
9-117124179-T-C p.Ala103Ala synonymous AKNA 1 82336 1.21454E-5 41168 0 NA
9-117124181-C-T p.Ala103Thr missense AKNA 2 82224 2.43238E-5 41112 0 8.4134E-6
9-117124194-G-GC c.297-4_297-3insG splice_region AKNA 1 81776 1.22285E-5 40888 0 NA
9-117124194-G-GCGAGGATCAAATCTTCCA c.297-4_297-3insTGGAAGATTTGATCCTCG splice_region AKNA 1 81776 1.22285E-5 40888 0 NA
9-117124195-G-GAGGATCA c.297-5_297-4insTGATCCT splice_region AKNA 1 81716 1.22375E-5 40858 0 NA
9-117124679-C-CA c.296+6_296+7insT splice_region AKNA 91 82484 0.00110324 41242 1 0.00558299
9-117124707-G-A p.Pro92Leu missense AKNA 4 82522 4.84719E-5 41261 0 2.0084E-5
9-117124709-C-T p.Thr91Thr synonymous AKNA 4 82514 4.84766E-5 41257 0 6.25E-4
9-117124716-T-C p.Lys89Arg missense AKNA 1 82568 1.21112E-5 41284 0 0.00100705
9-117124726-C-A p.Ala86Ser missense AKNA 3 82600 3.63196E-5 41300 0 NA
9-117124731-G-A p.Pro84Leu missense AKNA 40204 82368 0.488102 41184 10443 0.5725
9-117124753-G-A p.Arg77Trp missense AKNA 5 82592 6.05386E-5 41296 0 8.92124E-6
9-117124762-T-G p.Lys74Gln missense AKNA 1 82704 1.20913E-5 41352 0 NA
9-117124776-T-C p.Glu69Gly missense AKNA 2 82678 2.41902E-5 41339 0 NA
9-117124784-C-A p.Ala66Ala synonymous AKNA 1 82676 1.20954E-5 41338 0 4.02651E-6
9-117124784-C-T p.Ala66Ala synonymous AKNA 3 82676 3.62862E-5 41338 0 8.95319E-6
9-117124785-G-A p.Ala66Val missense AKNA 1583 82638 0.0191558 41319 19 0.027052
9-117124786-C-T p.Ala66Thr missense AKNA 3 82670 3.62889E-5 41335 0 3.62485E-5
9-117124786-C-A p.Ala66Ser missense AKNA 13 82670 1.57252E-4 41335 0 0.0010045
9-117124786-CG-AA p.HisAla65HisSer missense AKNA 2 82670 2.41926E-5 41335 0 NA
9-117124803-C-T p.Arg60Gln missense AKNA 4 82664 4.83887E-5 41332 0 6.26566E-4
9-117124804-G-A p.Arg60Trp missense AKNA 27 82654 3.26663E-4 41327 0 9.55353E-4
9-117126840-C-T p.Lys56Lys splice_region+synonymous AKNA 1 83306 1.20039E-5 41653 0 NA
9-117126846-T-C p.Gln54Gln synonymous AKNA 1 83312 1.20031E-5 41656 0 NA
9-117126865-C-T p.Arg48His missense AKNA 2 83320 2.40038E-5 41660 0 3.18634E-5
9-117126866-G-A p.Arg48Cys missense AKNA 3 83322 3.60049E-5 41661 0 7.95248E-6
9-117126868-C-T p.Gly47Glu missense AKNA 1 83322 1.20016E-5 41661 0 NA
9-117126891-G-A p.Ser39Ser synonymous AKNA 2 83312 2.40061E-5 41656 0 NA
9-117126894-C-T p.Glu38Glu synonymous AKNA 1 83308 1.20036E-5 41654 0 8.23642E-6
9-117126896-C-T p.Glu38Lys missense AKNA 3 83298 3.60153E-5 41649 0 NA
9-117126896-C-A p.Glu38* stop_gained AKNA 2 83298 2.40102E-5 41649 0 NA
9-117129829-C-T p.Leu34Leu synonymous AKNA 1 82854 1.20694E-5 41427 0 3.18878E-5
9-117129835-C-A p.Gln32His missense AKNA 1 82840 1.20715E-5 41420 0 NA
9-117129860-T-A p.Gln24Leu missense AKNA 9 82888 1.0858E-4 41444 0 0.00125313
9-117129872-G-C p.Ala20Gly missense AKNA 1 82898 1.2063E-5 41449 0 NA
9-117129894-T-C p.Ile13Val missense AKNA 28 82786 3.38221E-4 41393 0 0.00111721
9-117129899-C-T p.Arg11Gln missense AKNA 1 82760 1.20831E-5 41380 0 2.40244E-5
9-117129908-G-A p.Pro8Leu missense AKNA 9 82750 1.08761E-4 41375 0 6.37552E-5
9-117129916-C-A p.Gly5Gly synonymous AKNA 2 82706 2.4182E-5 41353 0 NA
9-117129917-C-T p.Gly5Glu missense AKNA 2 82708 2.41815E-5 41354 0 2.51117E-5
9-117129921-G-C p.Leu4Val missense AKNA 1101 82630 0.0133245 41315 52 0.0301697
9-117129922-G-A p.Thr3Thr synonymous AKNA 5 82674 6.04785E-5 41337 0 3.1904E-4
9-117129927-G-A p.Pro2Ser missense AKNA 1 82672 1.2096E-5 41336 0 NA
9-117129939-G-A p.Leu538Phe missense AKNA 1 82646 1.20998E-5 41323 0 1.69707E-5
9-117129940-C-G p.Ser537Ser synonymous AKNA 198 82586 0.0023975 41293 0 0.0127395
9-117129940-C-T p.Ser537Ser synonymous AKNA 2 82594 2.42148E-5 41297 0 2.5479E-5
9-117129941-G-A p.Ser537Leu missense AKNA 4 82628 4.84097E-5 41314 0 1.27575E-4
9-117129962-C-T p.Arg530Gln missense AKNA 2 82456 2.42554E-5 41228 0 5.04541E-4
9-117129964-A-C p.Ala529Ala synonymous AKNA 1 82430 1.21315E-5 41215 0 NA
9-117129966-C-T p.Ala529Thr missense AKNA 1 82438 1.21303E-5 41219 0 1.74896E-5
9-117130475-C-T c.-48+5G>A splice_region AKNA 1 45032 2.22064E-5 22516 0 NA
9-117130513-G-A c.-81C>T 5_prime_UTR_premature_start_codon_gain AKNA 1 58100 1.72117E-5 29050 0 NA
9-117130526-G-C c.-94C>G splice_region AKNA 1 60408 1.65541E-5 30204 0 NA
9-117130712-G-A c.-95+7C>T splice_region AKNA 1 75276 1.32844E-5 37638 0 9.36751E-6
9-117130720-T-A c.-96A>T 5_prime_UTR_premature_start_codon_gain AKNA 13 75572 1.72021E-4 37786 0 NA
9-117130726-C-T p.Ala522Ala synonymous AKNA 1 75680 1.32135E-5 37840 0 9.33637E-6
9-117130727-G-A p.Ala522Val missense AKNA 10 75690 1.32118E-4 37845 0 2.55102E-4
9-117130741-G-T p.Asp517Glu missense AKNA 1 76156 1.31309E-5 38078 0 NA
9-117130746-C-G p.Glu516Gln missense AKNA 2 76108 2.62784E-5 38054 0 9.39179E-6
9-117130747-G-A c.-123C>T 5_prime_UTR_premature_start_codon_gain AKNA 3 76048 3.94488E-5 38024 0 3.19E-5
9-117130750-C-T p.Pro514Pro synonymous AKNA 3 76080 3.94322E-5 38040 0 9.31411E-5
9-117130751-G-A p.Pro514Leu missense AKNA 3 76142 3.94001E-5 38071 0 1.48398E-4
9-117130753-GC-G p.Gly513fs frameshift AKNA 5 76198 6.56185E-5 38099 0 NA
9-117130756-C-T p.Pro512Pro synonymous AKNA 4 76234 5.247E-5 38117 0 1.57247E-4
9-117130758-G-A p.Pro512Ser missense AKNA 1 76276 1.31103E-5 38138 0 NA
9-117130774-G-A p.Arg506Arg synonymous AKNA 1 77012 1.2985E-5 38506 0 3.86435E-5
9-117130775-C-T p.Arg506His missense AKNA 16 76844 2.08214E-4 38422 0 5.04032E-4
9-117130776-G-A p.Arg506Cys missense AKNA 897 76912 0.0116627 38456 35 0.0266263
9-117130785-G-A p.Pro503Ser missense AKNA 2 77178 2.59141E-5 38589 0 NA
9-117130790-G-C p.Thr501Ser missense AKNA 2 77108 2.59376E-5 38554 0 NA
9-117130793-A-C p.Phe500Cys missense AKNA 1 77112 1.29682E-5 38556 0 NA
9-117130802-A-T p.Val497Asp missense AKNA 1 77156 1.29608E-5 38578 0 NA
9-117130810-C-T p.Gly494Gly synonymous AKNA 2 76950 2.59909E-5 38475 0 NA
9-117130821-C-T p.Val491Met missense AKNA 1 77186 1.29557E-5 38593 0 7.24722E-6
9-117130828-C-T p.Thr488Thr synonymous AKNA 10 77314 1.29343E-4 38657 0 2.23044E-4
9-117130829-G-A p.Thr488Met missense AKNA 5 77350 6.46412E-5 38675 0 1.50223E-4
9-117130835-A-C p.Ile486Ser missense AKNA 2 77318 2.58672E-5 38659 0 7.24239E-6
9-117130838-C-T p.Ser485Asn missense AKNA 108 77222 0.00139857 38611 0 0.00318552
9-117130838-C-A p.Ser485Ile missense AKNA 1 77232 1.2948E-5 38616 0 NA
9-117130842-G-A p.His484Tyr missense AKNA 4 77218 5.18014E-5 38609 0 1.8971E-5
9-117130849-C-A p.Gln481His missense AKNA 1 77048 1.29789E-5 38524 0 1.46778E-5
9-117130864-G-A p.Phe476Phe synonymous AKNA 1 76852 1.3012E-5 38426 0 NA
9-117130866-A-T p.Phe476Ile missense AKNA 1 76814 1.30185E-5 38407 0 NA
9-117130867-C-T p.Leu475Leu synonymous AKNA 2 76718 2.60695E-5 38359 0 3.18492E-5
9-117130871-T-C p.Asn474Ser missense AKNA 1 76614 1.30524E-5 38307 0 NA
9-117136381-C-T p.Gly470Arg missense AKNA 3 81040 3.70188E-5 40520 0 3.18634E-5
9-117136387-G-A p.Arg468Cys missense AKNA 3 81020 3.70279E-5 40510 0 1.80358E-5
9-117136409-G-A c.-288C>T 5_prime_UTR_premature_start_codon_gain AKNA 65 80858 8.03878E-4 40429 0 0.0012471
9-117136418-G-A c.-297C>T 5_prime_UTR_premature_start_codon_gain AKNA 8 80656 9.91867E-5 40328 0 0.00102987
9-117136432-G-A p.Leu453Phe missense AKNA 1 80228 1.24645E-5 40114 0 NA
9-117138743-A-G c.-327+3T>C splice_region AKNA 3 82980 3.61533E-5 41490 0 1.65437E-5
9-117138760-C-T p.Val443Ile missense AKNA 1 83088 1.20354E-5 41544 0 NA
9-117138775-G-T p.Gln438Lys missense AKNA 1 82814 1.20753E-5 41407 0 0.00352467
9-117138783-G-A p.Thr435Met missense AKNA 4 82958 4.82172E-5 41479 0 0.00125
9-117138802-C-G p.Val429Leu missense AKNA 1 83118 1.20311E-5 41559 0 5.77605E-5
9-117138802-C-T p.Val429Ile missense AKNA 3 83118 3.60933E-5 41559 0 1.0727E-4
9-117138806-G-C p.Thr427Thr synonymous AKNA 1 83140 1.20279E-5 41570 0 8.2496E-6
9-117138813-G-C p.Pro425Arg missense AKNA 6 83182 7.2131E-5 41591 0 3.97848E-6
9-117138816-T-G p.His424Pro missense AKNA 1 83160 1.2025E-5 41580 0 3.18291E-5
9-117138827-C-T p.Thr420Thr synonymous AKNA 145 83198 0.00174283 41599 1 0.003218
9-117138833-C-T p.Lys418Lys synonymous AKNA 2 83230 2.40298E-5 41615 0 8.24307E-6
9-117138836-T-C p.Ala417Ala synonymous AKNA 1 83234 1.20143E-5 41617 0 1.64856E-5
9-117138846-G-T p.Ala414Glu missense AKNA 51 83240 6.12686E-4 41620 2 0.00275591
9-117138850-C-T p.Glu413Lys missense AKNA 1 83270 1.20091E-5 41635 0 NA
9-117138863-C-T p.Leu408Leu synonymous AKNA 1 83260 1.20106E-5 41630 0 7.55551E-5
9-117138891-G-T p.Ser399Tyr missense AKNA 1 83272 1.20088E-5 41636 0 NA
9-117138930-C-T p.Arg386Lys missense AKNA 1 83238 1.20137E-5 41619 0 3.98308E-6
9-117138935-G-T p.His384Gln missense AKNA 3 83226 3.60464E-5 41613 0 6.64044E-5
9-117138937-G-A p.His384Tyr missense AKNA 8 83224 9.61261E-5 41612 0 6.36943E-5
9-117138944-G-A p.Ser381Ser synonymous AKNA 4 83170 4.80943E-5 41585 0 9.55414E-5
9-117138949-T-C p.Lys380Glu missense AKNA 1 83180 1.20221E-5 41590 0 4.17174E-5
9-117138950-G-T p.Pro379Pro synonymous AKNA 3 83174 3.6069E-5 41587 0 3.3399E-5
9-117138957-C-T p.Arg377His missense AKNA 5 83130 6.01468E-5 41565 0 6.25782E-4
9-117138972-T-C p.Lys372Arg missense AKNA 4 83178 4.80896E-5 41589 0 2.18121E-4
9-117138987-C-T p.Arg367Gln missense AKNA 1 83140 1.20279E-5 41570 0 3.62605E-5
9-117138988-G-A p.Arg367Trp missense AKNA 1 83130 1.20294E-5 41565 0 NA
9-117138991-G-T p.Pro366Thr missense AKNA 1 83140 1.20279E-5 41570 0 NA
9-117139003-A-T p.Ser362Thr missense AKNA 1 83130 1.20294E-5 41565 0 NA
9-117139007-A-G p.Asp360Asp synonymous AKNA 1 83126 1.20299E-5 41563 0 3.18898E-5
9-117139035-C-T p.Arg351Gln missense AKNA 3 83050 3.61228E-5 41525 0 1.81288E-4
9-117139044-T-G p.Lys348Thr missense AKNA 4 83046 4.81661E-5 41523 0 4.7458E-4
9-117139053-T-C p.Asn345Ser missense AKNA 11 83020 1.32498E-4 41510 0 1.81429E-4
9-117139053-T-G p.Asn345Thr missense AKNA 1 83020 1.20453E-5 41510 0 NA
9-117139062-G-A p.Ser342Phe missense AKNA 33 82966 3.97753E-4 41483 0 6.26566E-4
9-117139066-G-A p.Arg341Cys missense AKNA 1 82978 1.20514E-5 41489 0 8.70368E-6
9-117139072-C-T p.Ala339Thr missense AKNA 1 82950 1.20555E-5 41475 0 3.48657E-5
9-117139086-T-C p.Gln334Arg missense AKNA 2 82786 2.41587E-5 41393 0 NA
9-117139097-C-T p.Pro330Pro synonymous AKNA 4 82588 4.84332E-5 41294 0 8.85849E-6
9-117139098-G-A p.Pro330Leu missense AKNA 17 82576 2.05871E-4 41288 0 0.00151362
9-117139101-C-A p.Arg329Met missense AKNA 3 82582 3.63275E-5 41291 0 6.37024E-5
9-117139104-C-T p.Gly328Asp missense AKNA 1 82494 1.21221E-5 41247 0 3.18573E-5
9-117139110-C-T p.Arg326Gln missense AKNA 97 82388 0.00117736 41194 0 0.00375704
9-117139110-C-A p.Arg326Leu missense AKNA 1 82390 1.21374E-5 41195 0 6.28141E-4
9-117139111-G-A p.Arg326Trp missense AKNA 4 82298 4.86039E-5 41149 0 6.25782E-4
9-117139113-G-A p.Thr325Met missense AKNA 2 82320 2.42954E-5 41160 0 9.55292E-5
9-117139114-T-C p.Thr325Ala missense AKNA 5 82298 6.07548E-5 41149 1 5.03525E-4
9-117139130-A-G p.Asn319Asn synonymous AKNA 1 82060 1.21862E-5 41030 0 NA
9-117139137-G-A p.Pro317Leu missense AKNA 45 82006 5.4874E-4 41003 0 0.0020141
9-117139138-G-T p.Pro317Thr missense AKNA 1 81984 1.21975E-5 40992 0 NA
9-117139142-G-A p.Ile315Ile synonymous AKNA 1 81956 1.22017E-5 40978 0 NA
9-117139152-A-G p.Ile312Thr missense AKNA 27 81908 3.29638E-4 40954 0 0.004375
9-117139158-C-T p.Arg310Gln missense AKNA 1 81878 1.22133E-5 40939 0 0.00100705
9-117139164-G-A p.Pro308Leu missense AKNA 2 81874 2.44278E-5 40937 0 1.08024E-4
9-117139172-C-T p.Lys305Lys synonymous AKNA 2 81862 2.44314E-5 40931 0 3.18593E-5
9-117139172-C-A p.Lys305Asn missense AKNA 1 81862 1.22157E-5 40931 0 NA
9-117139180-A-T p.Ser303Thr missense AKNA 2 82008 2.43879E-5 41004 0 3.18613E-5
9-117139181-C-T p.Thr302Thr synonymous AKNA 10 81998 1.21954E-4 40999 0 0.00375
9-117139182-G-A p.Thr302Met missense AKNA 5 82032 6.09518E-5 41016 0 5.03525E-4
9-117139186-T-C p.Lys301Glu missense AKNA 32 82138 3.89588E-4 41069 1 7.04466E-4
9-117139236-G-A p.Thr284Met missense AKNA 1 82390 1.21374E-5 41195 0 4.12909E-5
9-117139244-C-T p.Arg281Arg synonymous AKNA 662 82498 0.00802444 41249 12 0.0171765
9-117139250-TC-T p.Arg279fs frameshift AKNA 1 82618 1.21039E-5 41309 0 NA
9-117139253-A-C p.Asp278Glu missense AKNA 78 82640 9.43853E-4 41320 1 0.00267752
9-117139257-G-A p.Thr277Ile missense AKNA 1 82670 1.20963E-5 41335 0 NA
9-117139261-C-T p.Ala276Thr missense AKNA 2 82666 2.41937E-5 41333 0 NA
9-117139269-G-A p.Pro273Leu missense AKNA 5 82656 6.04917E-5 41328 0 6.37227E-5
9-117139275-T-C p.Gln271Arg missense AKNA 10 82720 1.2089E-4 41360 1 0.00100705
9-117139277-G-C p.Ala270Ala synonymous AKNA 150 82718 0.00181339 41359 2 0.00305888
9-117139280-T-C p.Pro269Pro synonymous AKNA 3522 82560 0.0426599 41280 117 0.0576102
9-117139298-C-G p.Gln263His missense AKNA 3 82832 3.62179E-5 41416 0 1.65033E-5
9-117139309-T-C p.Met260Val missense AKNA 2 82824 2.41476E-5 41412 0 2.38719E-5
9-117139313-G-T p.Thr258Thr synonymous AKNA 2 82822 2.41482E-5 41411 0 3.9788E-6
9-117139320-C-T p.Arg256Gln missense AKNA 4 82842 4.82847E-5 41421 0 4.37814E-5
9-117139346-A-T p.Asp247Glu missense AKNA 7 82842 8.44982E-5 41421 0 2.38806E-5
9-117139350-G-A p.Pro246Leu missense AKNA 1 82844 1.20709E-5 41422 0 NA
9-117139358-G-A p.Leu243Leu synonymous AKNA 1 82806 1.20764E-5 41403 0 NA
9-117139367-G-A p.Ser240Ser synonymous AKNA 32 82740 3.86754E-4 41370 0 6.25E-4
9-117139381-G-A p.Pro236Ser missense AKNA 2 82784 2.41593E-5 41392 0 2.47713E-5
9-117139386-G-T p.Thr234Asn missense AKNA 1 82862 1.20683E-5 41431 0 6.37471E-5
9-117139394-C-T p.Leu231Leu synonymous AKNA 1 82894 1.20636E-5 41447 0 NA
9-117139413-C-T p.Gly225Asp missense AKNA 1 82968 1.20528E-5 41484 0 3.18878E-5
9-117139417-C-T p.Asp224Asn missense AKNA 42 83056 5.05683E-4 41528 1 0.00956697
9-117139417-C-CGGA p.Thr223_Asp224insSer conservative_inframe_insertion AKNA 1 83056 1.20401E-5 41528 0 3.97959E-6
9-117139418-G-A p.Thr223Thr synonymous AKNA 2 83038 2.40854E-5 41519 0 4.94984E-5
9-117139420-T-C p.Thr223Ala missense AKNA 1 83074 1.20375E-5 41537 0 NA
9-117139432-A-G p.Trp219Arg missense AKNA 5 83152 6.01308E-5 41576 0 7.95868E-6
9-117139435-T-C p.Thr218Ala missense AKNA 3 83156 3.60768E-5 41578 0 3.18735E-5
9-117139436-A-G p.Ser217Ser synonymous AKNA 2 83174 2.4046E-5 41587 0 3.97905E-6
9-117139447-T-C p.Ser214Gly missense AKNA 1 83206 1.20184E-5 41603 0 3.97909E-6
9-117139457-G-A p.His210His synonymous AKNA 4 83240 4.80538E-5 41620 0 1.59347E-4
9-117139459-G-A p.His210Tyr missense AKNA 1 83242 1.20132E-5 41621 0 NA
9-117139462-C-T p.Asp209Asn missense AKNA 1 83256 1.20111E-5 41628 0 1.64859E-5
9-117139463-G-A p.Leu208Leu synonymous AKNA 2 83252 2.40234E-5 41626 0 6.37511E-5
9-117139475-C-T p.Gly204Gly synonymous AKNA 1 83284 1.20071E-5 41642 0 6.3743E-5
9-117139484-C-A p.Trp201Cys missense AKNA 2 83264 2.402E-5 41632 0 6.25E-4
9-117139491-C-T p.Arg199Lys missense AKNA 1 83270 1.20091E-5 41635 0 8.24076E-6
9-117139496-C-T p.Pro197Pro synonymous AKNA 7 83252 8.40821E-5 41626 0 3.29647E-5
9-117139497-G-A p.Pro197Leu missense AKNA 35 83254 4.204E-4 41627 0 1.75044E-4
9-117139510-C-T p.Val193Ile missense AKNA 6 83264 7.206E-5 41632 0 9.55901E-5
9-117139510-C-G p.Val193Leu missense AKNA 7 83264 8.40699E-5 41632 0 1.11385E-4
9-117139511-G-A p.Ser192Ser synonymous AKNA 1 83260 1.20106E-5 41630 0 8.35455E-5
9-117139512-G-A p.Ser192Phe missense AKNA 34 83258 4.08369E-4 41629 0 0.00125
9-117139523-C-T p.Glu188Glu synonymous AKNA 1 83238 1.20137E-5 41619 0 NA
9-117139525-C-T p.Glu188Lys missense AKNA 3 83228 3.60456E-5 41614 0 3.2969E-5
9-117139526-G-A p.Ser187Ser synonymous AKNA 4 83210 4.80711E-5 41605 0 9.55019E-5
9-117139553-G-A p.Ala178Ala synonymous AKNA 2 83050 2.40819E-5 41525 0 NA
9-117139561-C-T p.Glu176Lys missense AKNA 2 82910 2.41225E-5 41455 0 2.47717E-5
9-117139562-G-A p.Gly175Gly synonymous AKNA 3 82838 3.62153E-5 41419 0 5.03525E-4
9-117139564-C-G p.Gly175Arg missense AKNA 5 82880 6.03282E-5 41440 0 NA
9-117139573-C-T p.Val172Met missense AKNA 12 82846 1.44847E-4 41423 0 1.27478E-4
9-117139581-C-T p.Arg169Lys missense AKNA 2 82830 2.41458E-5 41415 0 NA
9-117139585-C-A p.Ala168Ser missense AKNA 1 82788 1.2079E-5 41394 0 3.18674E-5
9-117139598-A-C p.Leu163Leu synonymous AKNA 1 82828 1.20732E-5 41414 0 NA
9-117139603-C-A p.Ala162Ser missense AKNA 2 82810 2.41517E-5 41405 0 NA
9-117139604-C-T p.Met161Ile missense AKNA 2 82826 2.4147E-5 41413 0 1.59429E-4
9-117139613-G-A p.Thr158Thr synonymous AKNA 3 82776 3.62424E-5 41388 0 1.99113E-5
9-117139617-T-G p.Asn157Thr missense AKNA 1 82792 1.20785E-5 41396 0 1.19494E-5
9-117139642-C-G p.Gly149Arg missense AKNA 99 82922 0.00119389 41461 0 0.00375
9-117139642-C-T p.Gly149Ser missense AKNA 7 82926 8.44126E-5 41463 0 1.91278E-4
9-117139646-C-T p.Glu147Glu synonymous AKNA 3 82962 3.61611E-5 41481 0 2.31074E-4
9-117139647-T-A p.Glu147Val missense AKNA 1 82982 1.20508E-5 41491 0 3.98292E-6
9-117139668-C-A p.Ser140Ile missense AKNA 1 83094 1.20346E-5 41547 0 NA
9-117139676-A-G p.Ala137Ala synonymous AKNA 1 83144 1.20273E-5 41572 0 NA
9-117139679-C-T p.Glu136Glu synonymous AKNA 1 83158 1.20253E-5 41579 0 3.9833E-6
9-117139685-A-G p.Val134Val synonymous AKNA 1 83158 1.20253E-5 41579 0 6.38244E-5
9-117139691-C-T p.Leu132Leu synonymous AKNA 1 83162 1.20247E-5 41581 0 3.98394E-6
9-117139699-CGAG-C p.Leu129del conservative_inframe_deletion AKNA 2 83140 2.40558E-5 41570 0 NA
9-117139700-G-A p.Leu129Leu synonymous AKNA 3 83122 3.60915E-5 41561 0 6.37735E-5
9-117139704-G-A p.Thr128Ile missense AKNA 3 83076 3.61115E-5 41538 0 NA
9-117139726-T-A p.Thr121Ser missense AKNA 2 82840 2.41429E-5 41420 0 1.65813E-5
9-117139730-G-A p.Asp119Asp synonymous AKNA 1 82792 1.20785E-5 41396 0 8.29518E-6
9-117139740-C-T p.Arg116His missense AKNA 1 82608 1.21054E-5 41304 0 3.33017E-5
9-117139741-G-A p.Arg116Cys missense AKNA 15 82594 1.81611E-4 41297 0 5.03525E-4
9-117139748-C-G p.Gln113His missense AKNA 1 82556 1.2113E-5 41278 0 NA
9-117139750-G-T p.Gln113Lys missense AKNA 7 82620 8.47252E-5 41310 0 2.23086E-4
9-117139754-G-A p.Leu111Leu synonymous AKNA 1065 82610 0.0128919 41305 42 0.0286297
9-117139754-G-T p.Leu111Leu synonymous AKNA 4 82634 4.84062E-5 41317 0 4.19872E-5
9-117139773-T-G p.His105Pro missense AKNA 1 82726 1.20881E-5 41363 0 NA
9-117139805-T-G p.Glu94Asp missense AKNA 1 82670 1.20963E-5 41335 0 4.2969E-6
9-117139812-T-C p.Glu92Gly missense+splice_region AKNA 3 82596 3.63214E-5 41298 0 1.36464E-4
9-117139815-G-A p.Pro10Leu missense AKNA 34 82586 4.11692E-4 41293 0 6.05288E-4
9-117139824-G-GACTT p.Pro7fs frameshift AKNA 1 82408 1.21347E-5 41204 0 NA
9-117139839-A-C p.Leu2Arg missense AKNA 1 81872 1.22142E-5 40936 0 9.98243E-6
9-117139858-C-G c.-15G>C 5_prime_UTR_premature_start_codon_gain AKNA 1 80548 1.2415E-5 40274 0 NA
9-117139912-T-A c.-69A>T 5_prime_UTR_premature_start_codon_gain AKNA 1 73722 1.35645E-5 36861 0 NA
9-117139915-C-G c.-72G>C 5_prime_UTR_premature_start_codon_gain AKNA 1 72682 1.37586E-5 36341 0 NA
9-117139915-C-T c.-72G>A 5_prime_UTR_premature_start_codon_gain AKNA 3 72682 4.12757E-5 36341 0 NA
9-117143330-TCA-T c.274+8_274+9delTG splice_region AKNA 5 81164 6.16037E-5 40582 0 6.97301E-5
9-117143339-CCTT-C p.Glu92del disruptive_inframe_deletion AKNA 4 81648 4.89908E-5 40824 0 5.68699E-5
9-117143341-T-A p.Glu91Asp missense+splice_region AKNA 14 81720 1.71317E-4 40860 0 0.00179283
9-117143347-C-T p.Ser89Ser synonymous AKNA 6 81894 7.32654E-5 40947 0 6.86389E-5
9-117143347-C-A p.Ser89Ser synonymous AKNA 1 81896 1.22106E-5 40948 0 NA
9-117143360-G-A p.Ser85Leu missense AKNA 1 82340 1.21448E-5 41170 0 3.33378E-5
9-117143362-C-T p.Glu84Glu synonymous AKNA 1 82382 1.21386E-5 41191 0 5.03525E-4
9-117143369-T-C p.Asp82Gly missense AKNA 1 82586 1.21086E-5 41293 0 3.11993E-5
9-117143377-C-T p.Gly79Gly synonymous AKNA 8 82666 9.6775E-5 41333 0 5.03525E-4
9-117143381-T-G p.Asp78Ala missense AKNA 2 82670 2.41926E-5 41335 0 NA
9-117143382-C-T p.Asp78Asn missense AKNA 5 82668 6.04829E-5 41334 0 1.95872E-4
9-117143389-C-T p.Pro75Pro synonymous AKNA 6 82682 7.25672E-5 41341 0 9.70685E-5
9-117143390-G-A p.Pro75Leu missense AKNA 1 82712 1.20901E-5 41356 0 6.44745E-5
9-117143392-G-A p.His74His synonymous AKNA 1 82716 1.20896E-5 41358 0 NA
9-117143403-A-G p.Trp71Arg missense AKNA 1 82764 1.20825E-5 41382 0 9.15248E-5
9-117143410-G-A p.Pro68Pro synonymous AKNA 8 82862 9.65461E-5 41431 0 5.61109E-5
9-117143413-C-T p.Pro67Pro synonymous AKNA 3 82876 3.61987E-5 41438 0 1.28394E-4
9-117143433-G-A p.Leu61Leu synonymous AKNA 1 83088 1.20354E-5 41544 0 7.96794E-6
9-117143434-G-A p.Arg60Arg synonymous AKNA 1 83088 1.20354E-5 41544 0 NA
9-117143443-C-T p.Glu57Glu synonymous AKNA 2 83162 2.40494E-5 41581 0 9.58957E-5
9-117143449-G-A p.Leu55Leu synonymous AKNA 1 83194 1.20201E-5 41597 0 1.19388E-5
9-117143452-C-T p.Glu54Glu synonymous AKNA 2 83192 2.40408E-5 41596 0 3.19468E-5
9-117143454-C-T p.Glu54Lys missense AKNA 1 83206 1.20184E-5 41603 0 1.19398E-5
9-117143455-G-A p.Pro53Pro synonymous AKNA 8 83206 9.61469E-5 41603 0 6.38284E-5
9-117143456-G-A p.Pro53Leu missense AKNA 1 83214 1.20172E-5 41607 0 8.29256E-6
9-117143462-G-A p.Thr51Ile missense AKNA 1 83218 1.20166E-5 41609 0 NA
9-117143467-A-T p.Asn49Lys missense AKNA 22 83216 2.64372E-4 41608 0 0.00151057
9-117143470-G-A p.Pro48Pro synonymous AKNA 2 83230 2.40298E-5 41615 0 NA
9-117143480-C-G p.Arg45Thr missense AKNA 1 83238 1.20137E-5 41619 0 NA
9-117143484-C-T p.Glu44Lys missense AKNA 1 83240 1.20135E-5 41620 0 3.1904E-5
9-117143493-A-T p.Trp41Arg missense AKNA 7 83226 8.41083E-5 41613 0 5.03525E-4
9-117143500-T-G p.Ser38Ser synonymous AKNA 1 83216 1.20169E-5 41608 0 8.29449E-6
9-117143513-T-A p.Asp34Val missense AKNA 2 83186 2.40425E-5 41593 0 1.59241E-5
9-117143515-C-T p.Val33Val synonymous AKNA 1 83172 1.20233E-5 41586 0 NA
9-117143520-C-T p.Asp32Asn missense AKNA 1 83142 1.20276E-5 41571 0 NA
9-117143533-G-C p.Ala27Ala synonymous AKNA 1 82910 1.20613E-5 41455 0 NA
9-117143547-G-A p.Arg23Cys missense AKNA 1 82584 1.21089E-5 41292 0 8.10255E-6
9-117143549-C-T p.Arg22Gln missense AKNA 8 82682 9.67562E-5 41341 0 5.04032E-4
9-117143550-G-A p.Arg22Trp missense AKNA 10 82672 1.2096E-4 41336 0 0.00125156
9-117143552-C-T p.Arg21Gln missense AKNA 7 82696 8.46474E-5 41348 0 0.00100806
9-117143553-G-A p.Arg21Trp missense AKNA 1 82666 1.20969E-5 41333 0 3.10829E-5
9-117143556-G-A p.Gln20* stop_gained AKNA 2 82704 2.41826E-5 41352 0 NA
9-117143565-T-G p.Lys17Gln missense AKNA 1 82592 1.21077E-5 41296 0 NA
9-117143569-C-A p.Leu15Leu synonymous AKNA 1 82540 1.21153E-5 41270 0 8.25962E-6
9-117143569-C-T p.Leu15Leu synonymous AKNA 1 82540 1.21153E-5 41270 0 NA
9-117143570-A-G p.Leu15Pro missense AKNA 2 82498 2.4243E-5 41249 0 3.18918E-5
9-117143576-G-A p.Pro13Leu missense AKNA 3 82426 3.63963E-5 41213 0 NA
9-117143578-C-T p.Glu12Glu synonymous AKNA 1 82396 1.21365E-5 41198 0 NA
9-117143586-A-G p.Trp10Arg missense AKNA 1 82260 1.21566E-5 41130 0 NA
9-117143588-C-T p.Arg9His missense AKNA 45 82170 5.47645E-4 41085 0 0.00505051
9-117143588-C-A p.Arg9Leu missense AKNA 1 82174 1.21693E-5 41087 0 8.77786E-6
9-117143589-G-A p.Arg9Cys missense AKNA 20 82186 2.4335E-4 41093 0 1.20449E-4
9-117143602-C-T p.Ser4Ser synonymous AKNA 13 81786 1.58951E-4 40893 0 1.12541E-4
9-117143603-G-A p.Ser4Leu missense AKNA 2 81764 2.44606E-5 40882 0 NA
9-117143608-G-T p.Ala2Ala synonymous AKNA 5 81616 6.12625E-5 40808 0 NA
9-117143610-C-G p.Ala2Pro missense AKNA 1 81566 1.226E-5 40783 0 NA
9-117143613-T-C p.Met1? start_lost AKNA 7 81502 8.58875E-5 40751 0 1.6164E-4
9-117143661-G-C c.-48C>G 5_prime_UTR_premature_start_codon_gain AKNA 1 79806 1.25304E-5 39903 0 NA
9-117143709-G-A c.-96C>T 5_prime_UTR_premature_start_codon_gain AKNA 1 76676 1.30419E-5 38338 0 NA
9-117143725-C-G c.-112G>C splice_region AKNA 1 74494 1.34239E-5 37247 0 NA
9-117143728-T-TG c.-113-3_-113-2insC splice_region AKNA 1 74080 1.34989E-5 37040 0 NA
9-117143729-G-GGGCTCCACCACCGTCCTGCCGACCCAGTT c.-113-4_-113-3insAACTGGGTCGGCAGGACGGTGGTGGAGCC splice_region AKNA 1 73710 1.35667E-5 36855 0 NA
9-117150160-G-A c.-134C>T 5_prime_UTR_premature_start_codon_gain AKNA 26 9568 0.00271739 4784 0 0.00261563
9-117150286-G-A c.-260C>T 5_prime_UTR_premature_start_codon_gain AKNA 1 8620 1.16009E-4 4310 0 3.18573E-5