Variant

Variant ID Consequence Effect Gene AC AN AF NS NHOM maxEAF
19-15490858-A-AG c.*74dupC splice_region AKAP8L 2 40610 4.9249E-5 20305 0 NA
19-15490864-G-A n.2747C>T splice_region AKAP8L 1 40386 2.47611E-5 20193 0 NA
19-15490941-C-T p.Ala645Thr missense AKAP8L 1 39884 2.50727E-5 19942 0 6.38651E-5
19-15490943-C-T p.Gly644Asp missense AKAP8L 1 40054 2.49663E-5 20027 0 5.5223E-5
19-15490945-C-G p.Gly643Gly synonymous AKAP8L 1 40150 2.49066E-5 20075 0 NA
19-15490949-C-T p.Gly642Asp missense AKAP8L 2 40188 4.97661E-5 20094 0 1.24719E-4
19-15490950-C-T p.Gly642Ser missense AKAP8L 1 40218 2.48645E-5 20109 0 1.23092E-4
19-15490951-G-A p.Gly641Gly synonymous AKAP8L 3 40180 7.4664E-5 20090 0 1.07128E-5
19-15490960-G-C p.Asp638Glu missense AKAP8L 1 40330 2.47954E-5 20165 0 1.14426E-4
19-15490960-G-A p.Asp638Asp synonymous AKAP8L 1 40330 2.47954E-5 20165 0 NA
19-15490966-C-T p.Glu636Glu synonymous AKAP8L 1 40614 2.46221E-5 20307 0 NA
19-15490972-G-A p.Asp634Asp synonymous AKAP8L 2 40518 4.93608E-5 20259 0 NA
19-15490975-G-A p.Leu633Leu synonymous AKAP8L 5 40566 1.23256E-4 20283 0 4.07847E-5
19-15490978-G-A p.Gly632Gly synonymous AKAP8L 16 40658 3.93526E-4 20329 0 1.51097E-4
19-15490984-G-T p.Ile630Ile synonymous AKAP8L 3 40790 7.35474E-5 20395 0 0.00179641
19-15490989-C-T p.Gly629Ser missense AKAP8L 1 40748 2.45411E-5 20374 0 NA
19-15490992-G-A p.Arg628Cys missense AKAP8L 1 40766 2.45302E-5 20383 0 1.02178E-5
19-15491005-C-T p.Leu623Leu synonymous AKAP8L 2 40774 4.90509E-5 20387 0 3.19285E-5
19-15491010-C-T p.Ala622Thr missense AKAP8L 1 40778 2.4523E-5 20389 0 9.58222E-5
19-15491033-CCCT-C p.Glu613del disruptive_inframe_deletion AKAP8L 11 40084 2.74424E-4 20042 0 0.0310306
19-15491046-C-T p.Glu610Lys missense AKAP8L 34 41198 8.25283E-4 20599 1 0.0013089
19-15491047-CTCT-C p.Glu609del disruptive_inframe_deletion AKAP8L 5 41226 1.21283E-4 20613 0 8.08211E-5
19-15491050-T-G p.Pro608Pro synonymous AKAP8L 2 41188 4.85578E-5 20594 0 NA
19-15491050-T-C p.Pro608Pro synonymous AKAP8L 2 41188 4.85578E-5 20594 0 9.6043E-5
19-15491056-CGGCGGCGGT-C p.Pro604_Pro606del disruptive_inframe_deletion AKAP8L 2 41152 4.86003E-5 20576 0 NA
19-15491060-G-A p.Pro605Leu missense AKAP8L 1 41284 2.42225E-5 20642 0 4.45991E-5
19-15491082-C-G p.Gly598Arg missense AKAP8L 6 42104 1.42504E-4 21052 0 9.5865E-5
19-15491083-G-A p.Pro597Pro synonymous AKAP8L 1 42150 2.37248E-5 21075 0 3.69665E-5
19-15491086-G-C p.Ala596Ala synonymous AKAP8L 2 42454 4.71098E-5 21227 0 9.05108E-6
19-15491087-G-A p.Ala596Val missense AKAP8L 2 42558 4.69947E-5 21279 1 9.20946E-6
19-15491091-G-A p.Pro595Ser missense AKAP8L 1 43024 2.32428E-5 21512 0 NA
19-15491101-C-T p.Val591Val synonymous AKAP8L 1 43924 2.27666E-5 21962 0 3.24107E-5
19-15491103-C-G p.Val591Leu missense AKAP8L 1 44194 2.26275E-5 22097 0 NA
19-15491116-C-T p.Pro586Pro synonymous AKAP8L 2 45766 4.37006E-5 22883 0 NA
19-15491125-C-T p.Glu583Glu synonymous AKAP8L 2 47118 4.24466E-5 23559 0 7.46692E-6
19-15491143-C-T p.Gly577Gly synonymous AKAP8L 1 50202 1.99195E-5 25101 0 7.4239E-5
19-15491149-C-T p.Ala575Ala synonymous AKAP8L 1 51264 1.95069E-5 25632 0 NA
19-15491173-C-T p.Leu567Leu synonymous AKAP8L 1 56334 1.77513E-5 28167 0 3.19163E-5
19-15491178-C-T p.Ala566Thr missense AKAP8L 2 56924 3.51346E-5 28462 0 1.48046E-4
19-15491181-C-T p.Gly565Ser missense AKAP8L 1 57892 1.72735E-5 28946 0 0.00253036
19-15491184-C-T p.Gly564Ser missense AKAP8L 1 58778 1.70132E-5 29389 0 0.00101215
19-15491188-A-T p.Ala562Ala synonymous AKAP8L 1 59668 1.67594E-5 29834 0 4.12507E-5
19-15491191-C-T p.Glu561Glu synonymous AKAP8L 2 60776 3.29077E-5 30388 0 NA
19-15491194-C-T p.Glu560Glu synonymous AKAP8L 3 61686 4.86334E-5 30843 0 1.27616E-4
19-15491197-C-T p.Gln559Gln synonymous AKAP8L 3 62660 4.78774E-5 31330 0 1.41084E-4
19-15491205-TCTC-T p.Glu556del conservative_inframe_deletion AKAP8L 3 64968 4.61766E-5 32484 0 9.22736E-5
19-15491209-C-T p.Glu555Glu synonymous AKAP8L 3 66234 4.5294E-5 33117 0 8.06498E-4
19-15491215-G-C p.Pro553Pro synonymous AKAP8L 1 67564 1.48008E-5 33782 0 NA
19-15491219-C-T p.Ser552Asn missense AKAP8L 1 68938 1.45058E-5 34469 0 NA
19-15491240-CCCTGTGGGGAGGGGCGCGGACACTGAAGGGAGGGAGCACAGGCGGGGACTAAGCTGGGGACAGGGCAGGCCCGGACCAGTGCCTCA-C p.Gly545fs frameshift AKAP8L 9 74658 1.2055E-4 37329 1 NA
19-15491248-G-C c.1633-7C>G splice_region AKAP8L 1 76234 1.31175E-5 38117 0 1.49174E-5
19-15491333-G-A p.Leu543Leu synonymous AKAP8L 1 81600 1.22549E-5 40800 0 NA
19-15491336-A-G p.Tyr542His missense AKAP8L 1 81614 1.22528E-5 40807 0 NA
19-15491350-T-C p.Lys537Arg missense AKAP8L 2 81818 2.44445E-5 40909 0 2.41274E-5
19-15491353-C-T p.Ser536Asn missense AKAP8L 1 81800 1.22249E-5 40900 0 4.02091E-6
19-15491354-T-C p.Ser536Gly missense AKAP8L 1 81856 1.22166E-5 40928 0 NA
19-15491355-G-A p.Ile535Ile synonymous AKAP8L 12 81860 1.46592E-4 40930 0 5.03525E-4
19-15491361-CTTG-C p.Asn532del disruptive_inframe_deletion AKAP8L 1 81872 1.22142E-5 40936 0 8.36414E-6
19-15491389-A-G p.Met524Thr missense AKAP8L 2 81776 2.44571E-5 40888 0 NA
19-15491390-T-A p.Met524Leu missense AKAP8L 2 81778 2.44565E-5 40889 0 NA
19-15491394-G-A p.Ser522Ser synonymous AKAP8L 3 81732 3.67053E-5 40866 0 NA
19-15491397-G-A p.Ser521Ser synonymous AKAP8L 7 81700 8.56793E-5 40850 0 7.52962E-5
19-15491398-G-A p.Ser521Phe missense AKAP8L 1 81686 1.2242E-5 40843 0 4.02243E-6
19-15491407-G-C p.Ser518Cys missense AKAP8L 1 81476 1.22736E-5 40738 0 NA
19-15507970-C-T p.Arg509Arg synonymous AKAP8L 51 82482 6.18317E-4 41241 0 7.64331E-4
19-15507972-G-A p.Arg509Trp missense AKAP8L 1 82486 1.21233E-5 41243 0 3.18532E-5
19-15507977-T-G p.His507Pro missense AKAP8L 1 82486 1.21233E-5 41243 0 NA
19-15507980-T-C p.Asp506Gly missense AKAP8L 1 82500 1.21212E-5 41250 0 NA
19-15507985-G-A p.Thr504Thr synonymous AKAP8L 18 82498 2.18187E-4 41249 0 1.0765E-4
19-15508026-T-C p.Ile491Val missense AKAP8L 1 82482 1.21239E-5 41241 0 3.18593E-5
19-15508035-C-T p.Asp488Asn missense AKAP8L 3 82492 3.63672E-5 41246 0 4.01194E-6
19-15508043-G-A p.Ala485Val missense AKAP8L 1 82492 1.21224E-5 41246 0 NA
19-15508046-C-T p.Cys484Tyr missense AKAP8L 1 82496 1.21218E-5 41248 0 NA
19-15508081-C-T p.Met472Ile missense AKAP8L 35 82414 4.24685E-4 41207 0 2.15775E-4
19-15508087-A-G p.Ile470Ile synonymous AKAP8L 1 82374 1.21398E-5 41187 0 NA
19-15508094-G-A c.1406-3C>T splice_region AKAP8L 1 82312 1.21489E-5 41156 0 4.01503E-6
19-15508095-T-C c.1406-4A>G splice_region AKAP8L 4 82302 4.86015E-5 41151 0 4.01506E-6
19-15508097-G-A c.1406-6C>T splice_region AKAP8L 1 82292 1.21518E-5 41146 0 4.15621E-5
19-15508098-T-C c.1406-7A>G splice_region AKAP8L 1 82290 1.21521E-5 41145 0 NA
19-15508322-TCTC-T c.1405+6_1405+8delGAG splice_region AKAP8L 3 82354 3.64281E-5 41177 0 8.04997E-6
19-15508329-A-G c.1405+2T>C splice_donor AKAP8L 1 82402 1.21356E-5 41201 0 4.02055E-6
19-15508347-G-A p.Asp463Asp synonymous AKAP8L 1 82476 1.21247E-5 41238 0 4.01365E-6
19-15508362-G-C p.His458Gln missense AKAP8L 82158 82162 0.999951 41081 41079 1.0
19-15508368-G-A p.Leu456Leu synonymous AKAP8L 2 82544 2.42295E-5 41272 0 3.18593E-5
19-15508388-C-T p.Val450Met missense AKAP8L 3 82572 3.63319E-5 41286 0 9.56206E-5
19-15508396-C-T p.Arg447Gln missense AKAP8L 2 82580 2.42189E-5 41290 0 3.19183E-5
19-15508405-T-C p.Glu444Gly missense AKAP8L 1 82598 1.21068E-5 41299 0 4.01184E-6
19-15508413-C-T p.Lys441Lys synonymous AKAP8L 1 82600 1.21065E-5 41300 0 1.20354E-5
19-15508416-G-A p.Thr440Thr synonymous AKAP8L 1 82602 1.21062E-5 41301 0 4.01194E-6
19-15508417-G-A p.Thr440Ile missense AKAP8L 1 82594 1.21074E-5 41297 0 4.01197E-6
19-15508422-G-C p.Asn438Lys missense AKAP8L 1 82596 1.21071E-5 41298 0 8.28322E-6
19-15508431-G-A p.Tyr435Tyr synonymous AKAP8L 2 82590 2.4216E-5 41295 0 6.37267E-5
19-15508435-TCCTGCAAGGAATATAAAGGTTCATGTGGGCCGCCTTATGTTCTCAGGGGTCCAAGAAACTAAGAGCGGCTGTGTTACTCCAAGGCTCA-T p.Glu434fs frameshift AKAP8L 14 82598 1.69496E-4 41299 6 NA
19-15508443-G-A c.1300-7C>T splice_region AKAP8L 1 82578 1.21098E-5 41289 0 3.18593E-5
19-15508521-T-A c.1299+4A>T splice_region AKAP8L 5 82510 6.05987E-5 41255 0 9.55231E-5
19-15508540-C-T p.Thr428Thr synonymous AKAP8L 67 82524 8.11885E-4 41262 0 0.00229226
19-15508567-G-A p.Thr431Met missense AKAP8L 1 82518 1.21186E-5 41259 0 6.62691E-5
19-15508591-C-A p.Lys411Asn missense AKAP8L 1 82526 1.21174E-5 41263 0 2.40722E-5
19-15508592-T-C p.Lys411Arg missense AKAP8L 2 82526 2.42348E-5 41263 0 NA
19-15508617-C-T p.Glu403Lys missense AKAP8L 2 82516 2.42377E-5 41258 0 8.32044E-6
19-15508624-A-C p.Tyr400* stop_gained AKAP8L 1 82518 1.21186E-5 41259 0 NA
19-15508635-G-A p.Arg397Trp missense AKAP8L 1 82498 1.21215E-5 41249 0 3.37353E-5
19-15508645-C-T p.Cys405Tyr missense AKAP8L 5 82464 6.06325E-5 41232 0 6.25E-4
19-15508648-A-G p.Leu404Pro missense AKAP8L 56 82456 6.7915E-4 41228 1 0.00117894
19-15508672-A-G c.1158-6T>C splice_region AKAP8L 4 82382 4.85543E-5 41191 0 6.37389E-5
19-15509374-G-A n.906C>T splice_region AKAP8L 1 55930 1.78795E-5 27965 0 NA
19-15509375-A-G n.905T>C splice_region AKAP8L 1 55828 1.79122E-5 27914 0 NA
19-15509448-G-A p.Ser395Ser synonymous AKAP8L 1 60874 1.64274E-5 30437 0 NA
19-15509451-C-T p.Thr394Thr synonymous AKAP8L 2 61144 3.27097E-5 30572 0 6.38896E-5
19-15509452-G-A p.Thr394Met missense AKAP8L 2 61240 3.26584E-5 30620 0 NA
19-15509486-G-A p.Pro383Ser missense AKAP8L 1 61216 1.63356E-5 30608 0 NA
19-15509500-C-T p.Arg378Gln missense AKAP8L 5 60112 8.31781E-5 30056 0 NA
19-15509501-G-A p.Arg378Trp missense AKAP8L 15 60188 2.49219E-4 30094 0 NA
19-15509505-G-A p.Gly376Gly synonymous AKAP8L 51 59824 8.52501E-4 29912 1 1.5952E-4
19-15509508-G-A p.Ala375Ala synonymous AKAP8L 1 59782 1.67274E-5 29891 0 NA
19-15509549-C-T p.Ala362Thr missense AKAP8L 2 53000 3.77358E-5 26500 0 3.19081E-5
19-15509550-G-A p.Ser361Ser synonymous AKAP8L 2 53046 3.77031E-5 26523 0 2.17581E-4
19-15509562-C-T p.Ala357Ala synonymous AKAP8L 1 48488 2.06237E-5 24244 0 3.1902E-5
19-15509573-G-A p.Pro354Ser missense AKAP8L 5 45102 1.1086E-4 22551 0 1.91424E-4
19-15510120-C-T p.Val384Met missense AKAP8L 1 81192 1.23165E-5 40596 0 NA
19-15510123-T-C p.Met383Val missense AKAP8L 1 81278 1.23035E-5 40639 0 NA
19-15510124-G-A p.Arg382Arg synonymous AKAP8L 1 81342 1.22938E-5 40671 0 1.21111E-5
19-15510138-G-T p.Arg378Arg synonymous AKAP8L 1 81962 1.22008E-5 40981 0 3.19142E-5
19-15510139-C-T p.Lys377Lys synonymous AKAP8L 1 81980 1.21981E-5 40990 0 NA
19-15510168-C-T p.Gly368Ser missense AKAP8L 1 82358 1.21421E-5 41179 0 3.18837E-5
19-15510183-G-T p.Arg363Ser missense AKAP8L 1 82360 1.21418E-5 41180 0 NA
19-15510218-G-A p.Ala351Val missense AKAP8L 1 82090 1.21818E-5 41045 0 NA
19-15510219-C-G p.Ala351Pro missense+splice_region AKAP8L 86 82058 0.00104804 41029 0 0.00210432
19-15510220-C-T p.Gly350Gly splice_region+synonymous AKAP8L 1 82068 1.2185E-5 41034 0 4.02042E-6
19-15511133-C-G p.Glu341Gln missense AKAP8L 1 82372 1.214E-5 41186 0 NA
19-15511135-C-A p.Arg340Ile missense AKAP8L 1 82370 1.21403E-5 41185 0 NA
19-15511136-T-C p.Arg340Gly missense AKAP8L 26 82362 3.1568E-4 41181 2 8.74694E-4
19-15511166-C-T p.Gly330Arg missense AKAP8L 5 82188 6.08361E-5 41094 0 3.31329E-5
19-15511167-G-A p.Asp329Asp splice_region+synonymous AKAP8L 13 82116 1.58313E-4 41058 0 4.06954E-5
19-15511612-G-T p.Ser326Tyr missense AKAP8L 4 82296 4.8605E-5 41148 0 1.27445E-4
19-15511619-T-C p.Lys324Glu missense AKAP8L 2 82346 2.42878E-5 41173 0 8.8313E-5
19-15511631-C-G p.Glu320Gln missense AKAP8L 3 82388 3.64131E-5 41194 0 1.20421E-5
19-15511632-G-A p.Thr319Thr synonymous AKAP8L 24 82386 2.91312E-4 41193 0 0.00103572
19-15511632-G-C p.Thr319Thr synonymous AKAP8L 1 82386 1.2138E-5 41193 0 NA
19-15511633-G-A p.Thr319Ile missense AKAP8L 1 82382 1.21386E-5 41191 0 6.37024E-5
19-15511636-C-G p.Gly318Ala missense AKAP8L 2 82396 2.4273E-5 41198 0 3.18532E-5
19-15511659-C-G p.Gly310Gly synonymous AKAP8L 1 82410 1.21345E-5 41205 0 8.34543E-6
19-15511665-G-A p.Thr308Thr synonymous AKAP8L 5 82378 6.06958E-5 41189 0 0.001875
19-15511668-G-A p.Gly307Gly synonymous AKAP8L 2 82380 2.42777E-5 41190 0 3.33918E-5
19-15511675-TCTGAAAGGGAAAAGGAGGTAAGCTCAACCCAGGAGTTCCCAGAGGCAGGGGGCAGCCGCCCAGTACCACCTAGTGGGCTCAC-T c.913+1_914-1delGTGAGCCCACTAGGTGGTACTGGGCGGCTGCCCCCTGCCTCTGGGAACTCCTGGGTTGAGCTTACCTCCTTTTCCCTTTCAG splice_acceptor AKAP8L 15 82392 1.82057E-4 41196 7 NA
19-15511750-G-A c.913+8C>T splice_region AKAP8L 1 82410 1.21345E-5 41205 0 3.34085E-5
19-15511758-C-T p.Asp305Asn missense+splice_region AKAP8L 1 82418 1.21333E-5 41209 0 NA
19-15511765-T-A p.Ser302Ser synonymous AKAP8L 1 82434 1.21309E-5 41217 0 8.33736E-6
19-15511768-G-A p.Asp301Asp synonymous AKAP8L 1 82434 1.21309E-5 41217 0 NA
19-15511771-G-A p.Ser300Ser synonymous AKAP8L 1 82450 1.21286E-5 41225 0 8.03219E-6
19-15511776-T-C p.Asn299Asp missense AKAP8L 1 82446 1.21292E-5 41223 0 8.03013E-6
19-15511780-C-T n.530G>A splice_region AKAP8L 3 82442 3.63892E-5 41221 0 5.03525E-4
19-15511781-G-A p.Ser297Leu missense AKAP8L 1 82446 1.21292E-5 41223 0 NA
19-15511789-C-T p.Thr294Thr synonymous AKAP8L 1 82444 1.21294E-5 41222 0 3.18654E-5
19-15511790-G-A p.Thr294Met missense AKAP8L 7 82436 8.49144E-5 41218 0 3.18674E-5
19-15511793-C-T p.Arg293His missense AKAP8L 3 82432 3.63936E-5 41216 0 4.16237E-5
19-15511797-T-C p.Thr292Ala missense AKAP8L 1 82430 1.21315E-5 41215 0 NA
19-15511812-G-T p.Pro287Thr missense AKAP8L 1 82426 1.21321E-5 41213 0 9.14989E-5
19-15511825-G-A p.Gly282Gly synonymous AKAP8L 1 82434 1.21309E-5 41217 0 1.59337E-4
19-15511827-C-T p.Gly282Ser missense AKAP8L 1 82434 1.21309E-5 41217 0 1.20552E-5
19-15511828-G-A p.Gly281Gly synonymous AKAP8L 1 82434 1.21309E-5 41217 0 8.31753E-6
19-15511830-C-G p.Gly281Arg missense AKAP8L 1 82442 1.21297E-5 41221 0 4.01836E-6
19-15511854-TCTGGGTCATAAGGGGGGGAAGCCGTGTCAGGGTGCATGGCACCCGGCCCTTAGCTCCGCCCCAGTGGGAACTAAGCTTCCCAGAGGGGAAGGCTGCCTCCACTCAC-T c.816+1_817-1del splice_acceptor AKAP8L 3 82416 3.64007E-5 41208 1 NA
19-15511858-G-A c.817-4C>T splice_region AKAP8L 19 82418 2.30532E-4 41209 0 1.16533E-4
19-15511861-C-T c.817-7G>A splice_region AKAP8L 2 82408 2.42695E-5 41204 0 NA
19-15511955-A-G c.816+6T>C splice_region AKAP8L 1 82378 1.21392E-5 41189 0 1.23319E-5
19-15511956-C-T c.816+5G>A splice_region AKAP8L 1 82384 1.21383E-5 41192 0 NA
19-15511960-C-T c.816+1G>A splice_donor AKAP8L 2 82406 2.42701E-5 41203 0 NA
19-15511963-G-A p.Arg272* stop_gained AKAP8L 1 82402 1.21356E-5 41201 0 8.36344E-6
19-15511969-C-T p.Asp270Asn missense AKAP8L 2 82426 2.42642E-5 41213 0 NA
19-15511970-G-A p.Ala269Ala synonymous AKAP8L 1 82424 1.21324E-5 41212 0 8.36316E-6
19-15511975-T-C p.Thr268Ala missense AKAP8L 1 82416 1.21336E-5 41208 0 4.0862E-6
19-15511977-G-A p.Thr267Ile missense AKAP8L 1 82422 1.21327E-5 41211 0 NA
19-15511989-C-G p.Trp263Ser missense AKAP8L 4 82442 4.8519E-5 41221 0 1.00324E-4
19-15511995-C-T p.Arg261Gln missense AKAP8L 2 82424 2.42648E-5 41212 0 8.35534E-6
19-15512016-T-C p.Asn254Ser missense AKAP8L 1 82444 1.21294E-5 41222 0 NA
19-15512026-C-G p.Gly251Arg missense AKAP8L 1 82432 1.21312E-5 41216 0 NA
19-15512037-C-T p.Arg247His missense AKAP8L 2 82386 2.4276E-5 41193 0 6.25E-4
19-15512038-G-A p.Arg247Cys missense AKAP8L 2 82398 2.42724E-5 41199 0 8.04531E-6
19-15512044-C-T p.Gly245Ser missense AKAP8L 1 82374 1.21398E-5 41187 0 0.00125
19-15512045-G-A p.Gly244Gly synonymous AKAP8L 1 82374 1.21398E-5 41187 0 7.49988E-5
19-15512048-C-A p.Pro243Pro synonymous AKAP8L 7 82374 8.49783E-5 41187 0 0.00519373
19-15512048-C-T p.Pro243Pro synonymous AKAP8L 2 82374 2.42795E-5 41187 0 4.16542E-5
19-15512049-G-A p.Pro243Leu missense AKAP8L 5 82374 6.06988E-5 41187 0 9.56023E-5
19-15512056-C-T p.Ala241Thr missense AKAP8L 2 82362 2.4283E-5 41181 0 1.20573E-5
19-15512057-G-A p.Gly240Gly synonymous AKAP8L 3 82350 3.64299E-5 41175 0 1.66575E-5
19-15512071-T-C p.Met236Val missense AKAP8L 7 82330 8.50237E-5 41165 0 4.82036E-5
19-15512072-GC-G p.Gly235fs frameshift AKAP8L 1 82328 1.21465E-5 41164 0 NA
19-15512079-A-C p.Phe233Cys missense AKAP8L 1 82314 1.21486E-5 41157 0 NA
19-15512082-A-G p.Met232Thr missense AKAP8L 1 82310 1.21492E-5 41155 0 8.03387E-6
19-15512084-G-C p.Gly231Gly synonymous AKAP8L 2 82294 2.43031E-5 41147 0 NA
19-15512085-C-T p.Gly231Asp missense AKAP8L 1 82294 1.21516E-5 41147 0 NA
19-15512093-G-A p.Pro228Pro synonymous AKAP8L 4 82298 4.86039E-5 41149 0 8.34335E-6
19-15512106-T-C n.312-2A>G splice_acceptor AKAP8L 6 82234 7.29625E-5 41117 0 3.18674E-5
19-15512111-G-A n.312-7C>T splice_region AKAP8L 1 82202 1.21652E-5 41101 0 NA
19-15512118-G-A p.Ser220Phe missense AKAP8L 1 82140 1.21743E-5 41070 0 NA
19-15512121-G-A p.Pro219Leu missense AKAP8L 1 82112 1.21785E-5 41056 0 NA
19-15512123-C-G p.Leu218Leu synonymous AKAP8L 1 82086 1.21823E-5 41043 0 NA
19-15512142-A-G p.Met212Thr missense AKAP8L 1 82024 1.21916E-5 41012 0 NA
19-15512153-C-T p.Arg208Arg synonymous AKAP8L 1 81868 1.22148E-5 40934 0 3.18796E-5
19-15512154-C-T p.Arg208Gln missense AKAP8L 10 81872 1.22142E-4 40936 0 1.21166E-4
19-15512159-C-T p.Gly206Gly synonymous AKAP8L 2 81784 2.44547E-5 40892 0 5.65556E-5
19-15512179-T-C p.Met200Val missense AKAP8L 1 81644 1.22483E-5 40822 0 3.18776E-5
19-15512192-T-C n.514A>G splice_region AKAP8L 1 81580 1.22579E-5 40790 0 NA
19-15512193-G-A p.Ser195Leu missense AKAP8L 19 81584 2.32889E-4 40792 0 0.00100705
19-15512199-A-G p.Met193Thr missense AKAP8L 1 81604 1.22543E-5 40802 0 NA
19-15512205-C-T p.Arg191Gln missense AKAP8L 1 81492 1.22711E-5 40746 0 1.69658E-5
19-15512209-C-T p.Gly190Ser missense AKAP8L 3 81504 3.6808E-5 40752 0 4.22661E-5
19-15512210-G-A p.Ser189Ser synonymous AKAP8L 2 81486 2.45441E-5 40743 0 8.4488E-6
19-15512215-G-A p.Arg188Trp missense AKAP8L 2 81490 2.45429E-5 40745 0 6.38121E-5
19-15512224-G-A p.Arg185Trp missense AKAP8L 2 81584 2.45146E-5 40792 0 4.03551E-6
19-15512248-C-T p.Gly177Ser missense AKAP8L 1 81722 1.22366E-5 40861 0 3.18776E-5
19-15512249-G-A p.Phe176Phe synonymous AKAP8L 2 81780 2.44559E-5 40890 0 4.82882E-5
19-15512257-C-T p.Asp174Asn missense AKAP8L 2 81882 2.44254E-5 40941 0 4.02201E-6
19-15512258-G-A p.Asn162Asn splice_region+synonymous AKAP8L 1 81884 1.22124E-5 40942 0 2.50635E-5
19-15512262-C-T p.Gly172Asp missense AKAP8L 1 81910 1.22085E-5 40955 0 NA
19-15512265-C-T p.Arg109His missense+splice_region AKAP8L 3 81950 3.66077E-5 40975 0 6.37308E-5
19-15512266-G-C p.Arg109Gly missense+splice_region AKAP8L 2 81954 2.44039E-5 40977 0 3.34068E-5
19-15512266-G-A p.Arg109Cys missense+splice_region AKAP8L 2 81954 2.44039E-5 40977 0 NA
19-15512271-C-T p.Arg169His missense AKAP8L 5 81992 6.09816E-5 40996 0 6.25E-4
19-15512272-G-A p.Arg169Cys missense AKAP8L 4 82018 4.87698E-5 41009 0 5.01102E-5
19-15512278-G-T p.Gln167Lys missense AKAP8L 1 82080 1.21832E-5 41040 0 3.18613E-5
19-15512279-G-T p.Asp166Glu missense AKAP8L 5 82088 6.09102E-5 41044 0 1.20548E-4
19-15512281-C-T p.Asp166Asn missense AKAP8L 4 82078 4.87341E-5 41039 0 6.37227E-5
19-15512281-C-A p.Asp166Tyr missense AKAP8L 2 82078 2.43671E-5 41039 0 1.83839E-4
19-15512282-G-A p.Arg165Arg synonymous AKAP8L 5 82076 6.09191E-5 41038 0 5.03525E-4
19-15512284-G-A p.Arg165Cys missense AKAP8L 1 82102 1.218E-5 41051 0 1.67232E-5
19-15512294-G-A p.Tyr161Tyr synonymous AKAP8L 1 82170 1.21699E-5 41085 0 4.01803E-6
19-15512298-T-C p.Gln160Arg missense AKAP8L 2 82206 2.43291E-5 41103 0 NA
19-15512306-A-G p.Tyr157Tyr synonymous AKAP8L 5 82214 6.08169E-5 41107 0 8.41609E-6
19-15512307-T-C p.Tyr157Cys missense AKAP8L 1 82210 1.2164E-5 41105 0 4.01865E-6
19-15512320-T-A p.Met153Leu missense AKAP8L 2 82236 2.43202E-5 41118 0 6.25E-4
19-15512320-T-C p.Met153Val missense AKAP8L 1 82236 1.21601E-5 41118 0 8.49372E-6
19-15512324-A-G p.Pro151Pro synonymous AKAP8L 3 82242 3.64777E-5 41121 0 3.21758E-5
19-15512327-G-C p.Asp150Glu missense AKAP8L 1 82228 1.21613E-5 41114 0 4.28956E-5
19-15512329-C-A p.Asp150Tyr missense AKAP8L 1 82228 1.21613E-5 41114 0 1.20706E-5
19-15512336-G-A p.Ser147Ser synonymous AKAP8L 1 82198 1.21657E-5 41099 0 NA
19-15512355-C-T p.Arg141Gln missense AKAP8L 1 82072 1.21844E-5 41036 0 2.83261E-5
19-15512359-A-G p.Tyr140His missense AKAP8L 1 82026 1.21913E-5 41013 0 NA
19-15512365-C-T p.Asp138Asn missense AKAP8L 1 81906 1.22091E-5 40953 0 2.91014E-5
19-15512366-G-A p.Arg137Arg synonymous AKAP8L 2 81836 2.44391E-5 40918 0 8.12658E-6
19-15512367-C-T p.Arg137His missense AKAP8L 4 81814 4.88914E-5 40907 0 4.47256E-5
19-15512368-G-A p.Arg137Cys missense AKAP8L 2 81804 2.44487E-5 40902 0 0.00100705
19-15512380-C-T p.Val133Ile missense AKAP8L 3 81358 3.68741E-5 40679 0 1.0121E-4
19-15512381-G-A p.Ala132Ala synonymous AKAP8L 3 81266 3.69158E-5 40633 0 6.25E-4
19-15512388-G-A p.Ser130Leu missense AKAP8L 1 80656 1.23983E-5 40328 0 3.18878E-5
19-15512392-C-T p.Asp129Asn missense AKAP8L 1 80176 1.24726E-5 40088 0 3.18695E-5
19-15512393-G-A p.Cys128Cys synonymous AKAP8L 360 79858 0.004508 39929 6 0.00851403
19-15512397-G-A p.Ser127Phe missense AKAP8L 3 79298 3.7832E-5 39649 0 3.18654E-5
19-15512403-T-TA p.Tyr125fs frameshift AKAP8L 2 78374 2.55187E-5 39187 0 NA
19-15512422-G-A c.363-8C>T splice_region AKAP8L 1 73840 1.35428E-5 36920 0 1.63182E-5
19-15514283-C-T c.362+3G>A splice_region AKAP8L 1 82212 1.21637E-5 41106 0 NA
19-15514302-C-T p.Gly116Ser missense AKAP8L 2 82522 2.4236E-5 41261 0 4.01323E-6
19-15514303-G-A p.Tyr115Tyr synonymous AKAP8L 3 82526 3.63522E-5 41263 0 3.31428E-5
19-15514316-T-C p.Gln111Arg missense AKAP8L 9 82622 1.0893E-4 41311 0 6.37186E-5
19-15514324-G-A p.Asp108Asp synonymous AKAP8L 1 82656 1.20983E-5 41328 0 NA
19-15514334-A-C p.Leu105Trp missense AKAP8L 2 82686 2.41879E-5 41343 0 NA
19-15514338-G-A p.His104Tyr missense AKAP8L 1 82694 1.20928E-5 41347 0 4.01178E-6
19-15514340-G-C p.Pro103Arg missense AKAP8L 2 82692 2.41861E-5 41346 0 4.01175E-6
19-15514354-G-C p.Ala66Gly missense AKAP8L 1 82738 1.20863E-5 41369 0 NA
19-15514355-C-T p.Arg98His missense AKAP8L 5 82736 6.04332E-5 41368 0 4.81398E-5
19-15514370-G-A p.Ser93Phe missense AKAP8L 14 82738 1.69209E-4 41369 0 0.00100705
19-15514378-G-A p.Ser90Ser synonymous AKAP8L 17 82724 2.05503E-4 41362 0 1.27478E-4
19-15514383-C-T p.Asp89Asn missense AKAP8L 3 82706 3.62731E-5 41353 0 6.25E-4
19-15514384-G-T p.Ala88Ala synonymous AKAP8L 5 82714 6.04493E-5 41357 0 6.37146E-5
19-15514392-C-T p.Ala86Thr missense AKAP8L 1 82700 1.20919E-5 41350 0 5.21531E-5
19-15514400-G-A p.Ser83Leu missense AKAP8L 5 82682 6.04727E-5 41341 0 NA
19-15514418-T-C p.Asn77Ser missense AKAP8L 1 82664 1.20972E-5 41332 0 3.18613E-5
19-15514433-G-A p.Pro72Leu missense AKAP8L 4 82628 4.84097E-5 41314 0 8.41864E-6
19-15514437-T-C p.Met71Val missense AKAP8L 2 82626 2.42055E-5 41313 1 NA
19-15514460-A-G p.Met1? start_lost AKAP8L 1 82600 1.21065E-5 41300 0 4.04024E-6
19-15514471-A-G p.Tyr59Tyr splice_region+synonymous AKAP8L 1 82586 1.21086E-5 41293 0 NA
19-15514477-G-C p.Thr57Thr synonymous AKAP8L 1 82578 1.21098E-5 41289 0 4.13384E-6
19-15514478-G-A p.Thr57Ile missense AKAP8L 1 82576 1.21101E-5 41288 0 8.28E-6
19-15514481-G-A p.Thr56Ile missense AKAP8L 1 82566 1.21115E-5 41283 0 NA
19-15514482-T-C p.Thr56Ala missense AKAP8L 168 82556 0.00203498 41278 0 0.00135448
19-15514491-G-GGCCATA p.Gly52_Gln53insTyrGly conservative_inframe_insertion AKAP8L 67 82540 8.11728E-4 41270 0 7.96838E-4
19-15514491-GGCCATAGCCATA-G p.Tyr49_Gly52del conservative_inframe_deletion AKAP8L 2 82540 2.42307E-5 41270 0 3.43021E-5
19-15514491-GGCCATA-G p.Tyr51_Gly52del conservative_inframe_deletion AKAP8L 2 82540 2.42307E-5 41270 0 4.28776E-5
19-15514492-G-T p.Gly52Gly synonymous AKAP8L 2 82534 2.42324E-5 41267 0 NA
19-15514501-A-G p.Tyr49Tyr synonymous AKAP8L 1 82524 1.21177E-5 41262 0 1.70155E-5
19-15514516-G-A p.Gly44Gly synonymous AKAP8L 1 82458 1.21274E-5 41229 0 5.04541E-4
19-15514521-C-T p.Glu43Lys missense AKAP8L 1 82448 1.21289E-5 41224 0 4.8546E-5
19-15514522-G-A c.-61C>T 5_prime_UTR_premature_start_codon_gain AKAP8L 1 82444 1.21294E-5 41222 0 5.47627E-6
19-15514530-C-T p.Ala59Thr missense AKAP8L 1 82394 1.21368E-5 41197 0 NA
19-15514541-A-C p.Val55Gly missense AKAP8L 1 82314 1.21486E-5 41157 0 NA
19-15514558-G-C p.His49Gln missense AKAP8L 1 82162 1.21711E-5 41081 0 6.11247E-6
19-15514563-G-A p.Pro48Ser missense AKAP8L 1 82104 1.21797E-5 41052 0 3.70792E-5
19-15514568-G-A p.Ala46Val missense AKAP8L 4 82024 4.87662E-5 41012 0 NA
19-15514574-G-A p.Pro44Leu missense AKAP8L 2 81922 2.44135E-5 40961 0 6.25258E-6
19-15514578-G-A p.Leu43Phe missense AKAP8L 3 81808 3.66712E-5 40904 0 4.53803E-5
19-15514583-A-G p.Val41Ala missense AKAP8L 5 81644 6.12415E-5 40822 0 4.98504E-5
19-15514590-CAG-C p.Ser38fs frameshift AKAP8L 1 81426 1.22811E-5 40713 0 NA
19-15514595-A-G p.Val37Ala missense AKAP8L 10 81156 1.23219E-4 40578 0 0.00187735
19-15514813-AC-A c.121+7delG splice_region AKAP8L 7 82744 8.45983E-5 41372 0 9.12954E-5
19-15514825-A-G p.Asn39Asn synonymous AKAP8L 1 82736 1.20866E-5 41368 0 9.55779E-5
19-15514833-C-G p.Gly37Arg missense AKAP8L 2 82748 2.41698E-5 41374 0 9.23124E-5
19-15514854-C-CA c.89-2_89-1insT splice_acceptor AKAP8L 1 82688 1.20937E-5 41344 0 NA
19-15514856-A-T c.89-3T>A splice_region AKAP8L 1 82650 1.20992E-5 41325 0 NA
19-15514966-C-T n.125+6G>A splice_region AKAP8L 1 75424 1.32584E-5 37712 0 NA
19-15514973-G-A n.124C>T splice_region AKAP8L 7 73596 9.51139E-5 36798 0 3.18431E-5
19-15521333-T-A p.Tyr29Phe missense+splice_region AKAP8L 5 82358 6.07106E-5 41179 0 3.26563E-5
19-15521362-C-T p.Ser19Ser synonymous AKAP8L 2 82484 2.42471E-5 41242 0 1.31096E-4
19-15521371-C-T p.Ser16Ser synonymous AKAP8L 3 82494 3.63663E-5 41247 0 2.49389E-5
19-15521372-G-A p.Ser16Leu missense AKAP8L 2 82496 2.42436E-5 41248 0 4.95614E-5
19-15521412-A-G c.14-7T>C splice_region AKAP8L 6 82352 7.2858E-5 41176 0 5.11326E-5
19-15529727-T-C p.Tyr3Cys missense AKAP8L 2 82070 2.43694E-5 41035 0 1.24289E-5
19-15529741-G-A c.-7C>T 5_prime_UTR_premature_start_codon_gain AKAP8L 34 82162 4.13817E-4 41081 0 2.97902E-4
19-15529749-C-G c.-15G>C 5_prime_UTR_premature_start_codon_gain AKAP8L 1 82198 1.21657E-5 41099 0 NA
19-15529760-G-A c.-26C>T 5_prime_UTR_premature_start_codon_gain AKAP8L 3 82110 3.65364E-5 41055 0 1.24243E-5
19-15529786-T-G c.-52A>C 5_prime_UTR_premature_start_codon_gain AKAP8L 24 81932 2.92926E-4 40966 0 2.2293E-4
19-15529797-G-C c.-63C>G 5_prime_UTR_premature_start_codon_gain AKAP8L 1 81818 1.22222E-5 40909 0 NA
19-15529803-T-A c.-69A>T 5_prime_UTR_premature_start_codon_gain AKAP8L 1 81700 1.22399E-5 40850 0 3.18532E-5
19-15529815-C-G c.-81G>C 5_prime_UTR_premature_start_codon_gain AKAP8L 14 81428 1.71931E-4 40714 0 4.45803E-4
19-15529824-C-A c.-90G>T 5_prime_UTR_premature_start_codon_gain AKAP8L 1 80930 1.23564E-5 40465 0 NA
19-15529831-C-T c.-97G>A 5_prime_UTR_premature_start_codon_gain AKAP8L 1 80510 1.24208E-5 40255 0 NA
19-15529833-C-T c.-99G>A 5_prime_UTR_premature_start_codon_gain AKAP8L 1 80054 1.24916E-5 40027 0 NA
19-15529835-C-A c.-101G>T 5_prime_UTR_premature_start_codon_gain AKAP8L 2 80082 2.49744E-5 40041 0 NA
19-15529877-G-A c.-143C>T 5_prime_UTR_premature_start_codon_gain AKAP8L 3 76094 3.94249E-5 38047 0 NA
19-15529884-C-G c.-150G>C 5_prime_UTR_premature_start_codon_gain AKAP8L 1 75304 1.32795E-5 37652 0 NA