Variant

Variant ID Consequence Effect Gene AC AN AF NS NHOM maxEAF
6-109814587-G-T p.Asp1907Glu missense AK9 2 83176 2.40454E-5 41588 0 3.97969E-6
6-109814598-T-C p.Arg1904Gly missense AK9 1 83214 1.20172E-5 41607 0 NA
6-109814598-T-TGA p.Arg1904fs frameshift AK9 1 83214 1.20172E-5 41607 0 NA
6-109814621-T-C p.Lys1896Arg missense AK9 1 83258 1.20109E-5 41629 0 8.23723E-6
6-109814624-T-C p.His1895Arg missense AK9 2 83256 2.40223E-5 41628 0 6.3674E-5
6-109814628-C-A p.Asp1894Tyr missense AK9 2 83256 2.40223E-5 41628 0 NA
6-109814634-C-G p.Asp1892His missense AK9 1 83260 1.20106E-5 41630 0 NA
6-109814652-G-A p.Pro1886Ser missense AK9 5 83258 6.00543E-5 41629 1 8.2371E-6
6-109814672-A-G p.Met1879Thr missense AK9 1 83266 1.20097E-5 41633 0 3.29489E-5
6-109814677-G-C p.Ala1877Ala synonymous AK9 3 83262 3.60308E-5 41631 0 1.89463E-4
6-109814693-AT-A p.Ile1872fs frameshift AK9 1 83248 1.20123E-5 41624 0 6.3678E-5
6-109814705-C-G p.Ser1868Thr missense AK9 2 83248 2.40246E-5 41624 0 NA
6-109814712-T-C p.Met1866Val missense AK9 2 83240 2.40269E-5 41620 0 NA
6-109814713-A-C p.Phe1865Leu missense AK9 3 83236 3.60421E-5 41618 0 NA
6-109814723-ATCT-A p.Lys1861del disruptive_inframe_deletion AK9 3 83234 3.6043E-5 41617 0 6.36821E-5
6-109814730-TC-AA p.LysLys1859* stop_gained AK9 6 83220 7.20981E-5 41610 0 NA
6-109814735-T-A p.Tyr1858Phe missense AK9 1 83192 1.20204E-5 41596 0 8.24212E-6
6-109814746-T-C p.Thr1854Thr synonymous AK9 4 83168 4.80954E-5 41584 0 1.19429E-5
6-109814754-C-T p.Glu1852Lys missense AK9 3 83122 3.60915E-5 41561 0 1.59346E-5
6-109814755-G-A p.Ser1851Ser synonymous AK9 2 83096 2.40685E-5 41548 0 2.48045E-5
6-109814758-A-T p.Gly1850Gly synonymous AK9 1 83066 1.20386E-5 41533 0 NA
6-109814769-T-G p.Asn1847His missense AK9 1 82976 1.20517E-5 41488 0 NA
6-109815181-T-C c.5533+3A>G splice_region AK9 1 82420 1.2133E-5 41210 0 2.88396E-5
6-109815202-T-C p.Ile1839Val missense AK9 1 82862 1.20683E-5 41431 0 8.25696E-6
6-109815206-T-C p.Leu1837Leu synonymous AK9 1 82882 1.20653E-5 41441 0 8.25341E-6
6-109815207-A-G p.Leu1837Pro missense AK9 2 82920 2.41196E-5 41460 0 NA
6-109815232-A-G p.Leu1829Leu synonymous AK9 1 83046 1.20415E-5 41523 0 3.97845E-6
6-109815260-C-T p.Ala1819Ala synonymous AK9 13 83066 1.56502E-4 41533 0 2.54728E-4
6-109815260-C-A p.Ala1819Ala synonymous AK9 2 83068 2.40767E-5 41534 0 2.47468E-5
6-109815261-G-A p.Ala1819Val missense AK9 1 83076 1.20372E-5 41538 0 8.24919E-6
6-109815262-C-T p.Ala1819Thr missense AK9 1 83080 1.20366E-5 41540 0 NA
6-109815266-A-G p.Asn1817Asn synonymous AK9 1 83068 1.20383E-5 41534 0 NA
6-109815267-T-G p.Asn1817Thr missense AK9 4 83060 4.8158E-5 41530 0 7.4266E-5
6-109815304-G-C c.5419-6C>G splice_region AK9 1 82608 1.21054E-5 41304 0 4.01784E-6
6-109816550-A-C p.Tyr1803* stop_gained AK9 1 82812 1.20755E-5 41406 0 NA
6-109816551-T-C p.Tyr1803Cys missense AK9 2 82832 2.41453E-5 41416 1 NA
6-109816554-C-G p.Gly1802Ala missense AK9 4 82866 4.82707E-5 41433 0 NA
6-109816558-G-C p.Pro1801Ala missense AK9 1 82910 1.20613E-5 41455 0 8.25246E-6
6-109816584-G-A p.Pro1792Leu missense AK9 40 82998 4.81939E-4 41499 0 3.14561E-4
6-109816587-T-A p.Glu1791Val missense AK9 1 83030 1.20438E-5 41515 0 NA
6-109816590-C-T p.Arg1790Lys missense AK9 2 83032 2.40871E-5 41516 0 NA
6-109816596-G-T p.Pro1788Gln missense AK9 1 83028 1.20441E-5 41514 0 NA
6-109816628-G-A p.Tyr1777Tyr synonymous AK9 5 82976 6.02584E-5 41488 0 NA
6-109816630-A-T p.Tyr1777Asn missense AK9 1 82944 1.20563E-5 41472 0 2.80123E-5
6-109816636-G-A p.Leu1775Leu synonymous AK9 23 82934 2.77329E-4 41467 0 3.50475E-4
6-109816640-C-T p.Ser1773Ser synonymous AK9 3 82860 3.62056E-5 41430 0 6.37389E-5
6-109816641-G-A p.Ser1773Leu missense+splice_region AK9 1 82858 1.20688E-5 41429 0 NA
6-109818664-T-C c.5315+4A>G splice_region AK9 1 81192 1.23165E-5 40596 0 NA
6-109818697-C-T p.Glu1762Glu synonymous AK9 1 82180 1.21684E-5 41090 0 3.99466E-6
6-109818706-A-G p.Tyr1759Tyr synonymous AK9 1142 82234 0.0138872 41117 53 0.0273318
6-109818713-C-T p.Arg1757His missense AK9 4 82222 4.86488E-5 41111 0 0.00100806
6-109818713-C-CTAT p.Arg1757delinsHisSer conservative_inframe_insertion AK9 1 82224 1.21619E-5 41112 0 NA
6-109818733-A-G p.Tyr1750Tyr synonymous AK9 2 82286 2.43055E-5 41143 0 NA
6-109818748-A-G p.Pro1745Pro synonymous AK9 7 82080 8.52826E-5 41040 0 1.88408E-4
6-109818756-G-A p.Leu1743Leu synonymous AK9 4 81932 4.8821E-5 40966 0 0.00100908
6-109819017-T-C p.Tyr1733Cys missense AK9 1 83134 1.20288E-5 41567 0 1.6478E-5
6-109819037-C-T p.Gln1726Gln synonymous AK9 1 83182 1.20218E-5 41591 0 NA
6-109819047-G-A p.Ala1723Val missense AK9 2 83184 2.40431E-5 41592 0 3.18654E-5
6-109819056-G-A p.Pro1720Leu missense AK9 1 83222 1.20161E-5 41611 0 NA
6-109819063-G-A p.Arg1718* stop_gained AK9 1 83222 1.20161E-5 41611 0 3.98086E-6
6-109819071-A-G p.Leu1715Pro missense AK9 1 83230 1.20149E-5 41615 0 NA
6-109819103-G-A p.Asp1704Asp synonymous AK9 1 83252 1.20117E-5 41626 0 7.95836E-6
6-109819117-G-A p.Leu1700Phe missense AK9 2 83254 2.40229E-5 41627 0 NA
6-109819135-G-A p.Pro1694Ser missense AK9 35 83242 4.20461E-4 41621 0 3.46118E-4
6-109819142-G-A p.Tyr1691Tyr synonymous AK9 1 83232 1.20146E-5 41616 0 3.18634E-5
6-109819171-A-G c.5047-3T>C splice_region AK9 9 83138 1.08254E-4 41569 0 9.55353E-5
6-109819173-TA-T c.5047-6delT splice_region AK9 1 83104 1.20331E-5 41552 0 1.99403E-5
6-109820285-C-T p.Gly1670Arg missense AK9 4 82914 4.82428E-5 41457 0 3.18451E-5
6-109820312-A-G p.Ser1661Pro missense AK9 1 83060 1.20395E-5 41530 0 8.37437E-6
6-109820332-A-G p.Phe1654Ser missense AK9 1 83182 1.20218E-5 41591 0 5.03525E-4
6-109820370-C-A p.Gln1641His missense AK9 1 83126 1.20299E-5 41563 0 NA
6-109820397-C-T p.Leu1632Leu synonymous AK9 233 82834 0.00281285 41417 1 0.00649723
6-109820426-C-A p.Asp1623Tyr missense AK9 2 81746 2.4466E-5 40873 0 NA
6-109820430-G-A p.Cys1621Cys synonymous AK9 289 81408 0.00355002 40704 3 0.0075
6-109820434-G-A p.Ala1620Val missense AK9 1 81250 1.23077E-5 40625 0 NA
6-109820438-C-T p.Ala1619Thr missense AK9 10 80708 1.23903E-4 40354 0 3.18471E-5
6-109820440-T-G p.Lys1618Thr missense AK9 1 80712 1.23897E-5 40356 0 NA
6-109820446-A-G c.4850-3T>C splice_region AK9 1 80348 1.24459E-5 40174 0 2.71936E-5
6-109820451-T-C c.4850-8A>G splice_region AK9 1 80278 1.24567E-5 40139 0 9.36961E-6
6-109827530-C-T p.Gly1617Arg missense+splice_region AK9 3 82940 3.61707E-5 41470 0 1.59528E-5
6-109827533-C-T p.Ala1616Thr missense AK9 1 83016 1.20459E-5 41508 0 NA
6-109827543-T-G p.Glu1612Asp missense AK9 1 83058 1.20398E-5 41529 0 8.24633E-6
6-109827544-T-C p.Glu1612Gly missense AK9 1 83066 1.20386E-5 41533 0 7.96673E-6
6-109827545-C-T p.Glu1612Lys missense AK9 1 83078 1.20369E-5 41539 0 3.58531E-5
6-109827547-AG-A p.Leu1611fs frameshift AK9 2 83088 2.40709E-5 41544 0 3.98318E-6
6-109827552-T-C p.Thr1609Thr synonymous AK9 1 83104 1.20331E-5 41552 0 NA
6-109827570-C-A p.Val1603Val synonymous AK9 1 83152 1.20262E-5 41576 0 8.24076E-6
6-109827572-C-T p.Val1603Met missense AK9 1 83152 1.20262E-5 41576 0 6.25E-4
6-109827573-C-T p.Met1602Ile missense AK9 1 83156 1.20256E-5 41578 0 8.2409E-6
6-109827589-A-G p.Ile1597Thr missense AK9 2 83158 2.40506E-5 41579 0 1.64818E-5
6-109827606-C-A p.Trp1591Cys missense AK9 738 83148 0.00887574 41574 15 0.0217364
6-109827609-C-T p.Trp1590* stop_gained AK9 2 83166 2.40483E-5 41583 0 3.97991E-6
6-109827610-C-A p.Trp1590Leu missense AK9 1 83162 1.20247E-5 41581 0 9.55901E-5
6-109827659-GATA-G p.Tyr1573del conservative_inframe_deletion AK9 1 83144 1.20273E-5 41572 0 3.98333E-6
6-109827669-C-T p.Arg1570Arg synonymous AK9 1 83124 1.20302E-5 41562 0 NA
6-109827679-C-T p.Gly1567Asp missense AK9 1 83130 1.20294E-5 41565 0 NA
6-109827685-T-A p.Asn1565Ile missense AK9 1 83138 1.20282E-5 41569 0 4.00647E-6
6-109827690-G-A p.Arg1563Arg synonymous AK9 6 83138 7.21692E-5 41569 0 9.17667E-6
6-109827691-C-T p.Arg1563His missense AK9 45 83136 5.41282E-4 41568 0 0.0013064
6-109827692-G-A p.Arg1563Cys missense AK9 2 83140 2.40558E-5 41570 0 3.18654E-5
6-109827696-C-T p.Lys1561Lys synonymous AK9 1 83148 1.20267E-5 41574 0 NA
6-109827707-T-C p.Asn1558Asp missense AK9 1 83152 1.20262E-5 41576 0 6.68832E-4
6-109827716-C-T p.Val1555Ile missense AK9 32244 82590 0.39041 41295 6412 0.447549
6-109827727-C-T p.Ser1551Asn missense AK9 2 83152 2.40523E-5 41576 0 8.20452E-5
6-109827729-A-G p.Asn1550Asn synonymous AK9 492 83146 0.0059173 41573 10 0.0135032
6-109827737-A-G p.Leu1548Leu synonymous AK9 1 83148 1.20267E-5 41574 0 1.88822E-5
6-109827738-T-C p.Pro1547Pro synonymous AK9 1 83150 1.20265E-5 41575 0 NA
6-109827852-A-G c.4628+5T>C splice_region AK9 5 82608 6.05268E-5 41304 0 4.70765E-5
6-109827877-TAGG-T p.Leu1536del disruptive_inframe_deletion AK9 1 82498 1.21215E-5 41249 0 NA
6-109827879-G-A p.Leu1536Leu synonymous AK9 15 82494 1.81831E-4 41247 0 2.66741E-4
6-109827879-G-T p.Leu1536Ile missense AK9 1 82494 1.21221E-5 41247 0 NA
6-109827914-C-T p.Ser1524Asn missense AK9 1 82374 1.21398E-5 41187 0 1.94117E-5
6-109827937-AATGATTGACC-A p.Arg1513fs frameshift AK9 4 82216 4.86523E-5 41108 1 NA
6-109827940-G-A p.Ile1515Ile synonymous AK9 1 82182 1.21681E-5 41091 0 6.50204E-6
6-109827942-T-C p.Ile1515Val missense AK9 2 82162 2.43422E-5 41081 0 3.18431E-5
6-109827945-AC-A p.Arg1513fs frameshift AK9 1 82130 1.21758E-5 41065 0 6.52078E-6
6-109827947-C-G p.Arg1513Thr missense AK9 1 82116 1.21779E-5 41058 0 6.54596E-6
6-109827960-G-T p.Leu1509Ile missense AK9 12 81934 1.46459E-4 40967 0 4.71368E-5
6-109827962-T-C p.Asn1508Ser missense AK9 1 81914 1.22079E-5 40957 0 NA
6-109827967-T-C p.Gln1506Gln synonymous AK9 1 81856 1.22166E-5 40928 0 4.0931E-5
6-109827993-C-T p.Asp1498Asn missense AK9 1 80914 1.23588E-5 40457 0 1.6276E-5
6-109828004-C-A c.4482-1G>T splice_acceptor AK9 1 79924 1.25119E-5 39962 0 NA
6-109830375-C-G c.4481+7G>C splice_region AK9 2 82528 2.42342E-5 41264 0 9.55718E-5
6-109830376-A-G c.4481+6T>C splice_region AK9 1 82540 1.21153E-5 41270 0 NA
6-109830382-C-A p.Gly1494Val missense+splice_region AK9 11 82534 1.33278E-4 41267 0 1.91156E-4
6-109830412-G-GA p.Ser1484fs frameshift AK9 1 82612 1.21048E-5 41306 0 3.18593E-5
6-109830413-A-G p.Ser1484Pro missense AK9 1 82630 1.21021E-5 41315 0 NA
6-109830416-G-T p.Leu1483Ile missense AK9 14 82636 1.69418E-4 41318 0 4.42713E-5
6-109830426-T-C p.Gln1479Gln synonymous AK9 2 82660 2.41955E-5 41330 0 3.18532E-5
6-109830441-A-C p.Asp1474Glu missense AK9 1 82720 1.2089E-5 41360 0 NA
6-109830444-A-G p.Pro1473Pro synonymous AK9 4 82728 4.83512E-5 41364 0 1.91107E-4
6-109830461-T-C p.Lys1468Glu missense AK9 3 82736 3.62599E-5 41368 0 3.18613E-5
6-109830469-T-C p.His1465Arg missense AK9 1 82736 1.20866E-5 41368 0 NA
6-109830478-A-T p.Leu1462* stop_gained AK9 2 82734 2.41739E-5 41367 0 NA
6-109830489-C-T p.Leu1458Leu synonymous AK9 4 82706 4.83641E-5 41353 0 4.5372E-5
6-109830492-C-T p.Glu1457Glu synonymous AK9 1 82712 1.20901E-5 41356 0 NA
6-109830501-C-T p.Pro1454Pro synonymous AK9 2 82684 2.41885E-5 41342 0 2.28269E-4
6-109830502-G-A p.Pro1454Leu missense AK9 11 82686 1.33033E-4 41343 0 1.40186E-4
6-109830523-C-T p.Arg1447His missense AK9 2 82620 2.42072E-5 41310 0 9.2098E-5
6-109830524-G-A p.Arg1447Cys missense AK9 13 82610 1.57366E-4 41305 0 1.27686E-5
6-109830524-G-C p.Arg1447Gly missense AK9 1 82610 1.21051E-5 41305 0 6.38431E-6
6-109830533-C-T p.Gly1444Arg missense AK9 1 82576 1.21101E-5 41288 0 9.24471E-5
6-109830539-TTGATAA-T p.Leu1440_Ser1441del conservative_inframe_deletion AK9 1 82524 1.21177E-5 41262 0 NA
6-109830547-T-A p.His1439Leu missense AK9 42 82454 5.09375E-4 41227 1 0.00118943
6-109830547-T-C p.His1439Arg missense AK9 1 82454 1.2128E-5 41227 0 6.39476E-6
6-109830549-C-G p.Lys1438Asn missense AK9 1 82434 1.21309E-5 41217 0 3.19346E-5
6-109830552-TA-AC p.Leu1437Cys missense AK9 1 82388 1.21377E-5 41194 0 NA
6-109830571-A-AT p.Ile1431fs frameshift AK9 10 82000 1.21951E-4 41000 0 1.89268E-4
6-109830577-T-C p.Lys1429Arg missense AK9 1 81850 1.22175E-5 40925 0 NA
6-109835419-A-ACGCT c.4279+7_4279+8insAGCG splice_region AK9 171 82576 0.00207082 41288 1 0.00149729
6-109835420-C-T c.4279+7G>A splice_region AK9 1 82574 1.21103E-5 41287 0 4.56746E-5
6-109835421-G-A c.4279+6C>T splice_region AK9 7 82576 8.47704E-5 41288 0 9.5584E-5
6-109835424-C-T c.4279+3G>A splice_region AK9 4 82618 4.84156E-5 41309 0 NA
6-109835448-G-A p.Pro1420Ser missense AK9 1 82684 1.20942E-5 41342 0 NA
6-109835448-G-T p.Pro1420Thr missense AK9 1 82684 1.20942E-5 41342 0 NA
6-109835452-C-T p.Gly1418Gly synonymous AK9 17 82684 2.05602E-4 41342 0 5.73358E-4
6-109835476-C-T p.Val1410Val synonymous AK9 2 82708 2.41815E-5 41354 0 1.26453E-5
6-109835486-T-A p.Lys1407Met missense AK9 2 82718 2.41785E-5 41359 0 4.45712E-5
6-109835490-G-C p.Pro1406Ala missense AK9 1 82720 1.2089E-5 41360 0 NA
6-109835492-T-G p.Lys1405Thr missense AK9 2 82722 2.41774E-5 41361 0 NA
6-109835501-C-T p.Arg1402His missense AK9 6 82696 7.25549E-5 41348 0 9.56206E-5
6-109835502-G-A p.Arg1402Cys missense AK9 1 82694 1.20928E-5 41347 0 1.89991E-5
6-109835505-T-C p.Ile1401Val missense AK9 1 82694 1.20928E-5 41347 0 NA
6-109835513-A-G p.Ile1398Thr missense AK9 3 82664 3.62915E-5 41332 0 6.25E-4
6-109835543-T-C p.Glu1388Gly missense AK9 1 82528 1.21171E-5 41264 0 NA
6-109835553-A-T p.Ser1385Thr missense AK9 1 82450 1.21286E-5 41225 0 NA
6-109835563-A-C p.Ile1381Met missense AK9 1 82366 1.21409E-5 41183 0 1.27818E-5
6-109835569-C-G p.Gln1379His missense AK9 1 82294 1.21516E-5 41147 0 6.39239E-6
6-109835573-CG-C p.Arg1378fs frameshift AK9 1 82202 1.21652E-5 41101 0 NA
6-109835583-C-T p.Val1375Ile missense AK9 1 81994 1.2196E-5 40997 0 NA
6-109835586-G-A p.Pro1374Ser missense AK9 3 81960 3.66032E-5 40980 0 6.39411E-6
6-109835594-G-A p.Pro1371Leu missense AK9 1 81808 1.22237E-5 40904 0 NA
6-109835596-A-G p.Asn1370Asn synonymous AK9 1 81740 1.22339E-5 40870 0 NA
6-109835600-T-C p.Glu1369Gly missense AK9 7 81684 8.56961E-5 40842 0 1.38402E-4
6-109835612-A-G p.Val1365Ala missense AK9 1 81470 1.22745E-5 40735 0 6.37836E-5
6-109835615-G-A p.Pro1364Leu missense AK9 1 81450 1.22775E-5 40725 0 4.61979E-5
6-109835623-T-C p.Thr1361Thr synonymous AK9 2 81362 2.45815E-5 40681 0 NA
6-109835628-C-A p.Glu1360* stop_gained AK9 1 81296 1.23007E-5 40648 0 NA
6-109835642-T-G c.4066-2A>C splice_acceptor AK9 1 81066 1.23356E-5 40533 0 1.40546E-5
6-109835646-AC-A c.4066-7delG splice_region AK9 17188 80752 0.212849 40376 1970 0.250873
6-109835648-A-G c.4066-8T>C splice_region AK9 1 80926 1.2357E-5 40463 0 NA
6-109837053-A-T c.4065+7T>A splice_region AK9 5 82354 6.07135E-5 41177 0 1.81209E-4
6-109837075-A-G p.Tyr1350Tyr synonymous AK9 3 82504 3.63619E-5 41252 0 2.53492E-5
6-109837080-C-T p.Gly1349Ser missense AK9 4 82562 4.84484E-5 41281 0 8.94294E-5
6-109837082-A-C p.Phe1348Cys missense AK9 1 82584 1.21089E-5 41292 0 NA
6-109837096-C-G p.Lys1343Asn missense AK9 2 82616 2.42084E-5 41308 0 NA
6-109837099-G-A p.Tyr1342Tyr synonymous AK9 1 82612 1.21048E-5 41306 0 1.33678E-4
6-109837113-G-A p.Leu1338Phe missense AK9 3 82638 3.63029E-5 41319 0 NA
6-109837115-A-G p.Met1337Thr missense AK9 4 82636 4.84051E-5 41318 0 1.89804E-5
6-109837128-G-A p.Leu1333Phe missense AK9 2 82632 2.42037E-5 41316 0 3.1841E-5
6-109837133-G-A p.Ala1331Val missense AK9 14 82616 1.69459E-4 41308 1 0.003125
6-109837134-C-T p.Ala1331Thr missense AK9 1 82626 1.21027E-5 41313 0 1.26622E-5
6-109837135-T-C p.Pro1330Pro synonymous AK9 2 82628 2.42049E-5 41314 0 NA
6-109837137-G-A p.Pro1330Ser missense AK9 2 82608 2.42107E-5 41304 0 6.33272E-6
6-109837147-A-G p.Cys1326Cys synonymous AK9 1158 82576 0.0140234 41288 25 0.04625
6-109837161-T-G p.Ile1322Leu missense AK9 1 82594 1.21074E-5 41297 0 1.26979E-5
6-109837169-C-G p.Arg1319Pro missense AK9 5 82558 6.05635E-5 41279 0 1.01713E-4
6-109837169-C-T p.Arg1319His missense AK9 14 82558 1.69578E-4 41279 0 0.001875
6-109837169-C-A p.Arg1319Leu missense AK9 2 82558 2.42254E-5 41279 0 NA
6-109837170-G-A p.Arg1319Cys missense AK9 1 82554 1.21133E-5 41277 0 NA
6-109837179-C-T p.Val1316Met missense AK9 1 82536 1.21159E-5 41268 0 NA
6-109837199-T-C p.Asn1309Ser missense AK9 1 82438 1.21303E-5 41219 0 6.37918E-6
6-109837215-C-G p.Val1304Leu missense AK9 2 82354 2.42854E-5 41177 0 3.1835E-5
6-109837229-C-T p.Arg1299Gln missense AK9 1830 82200 0.0222628 41100 29 0.053125
6-109837234-T-C p.Gly1297Gly synonymous AK9 1 82226 1.21616E-5 41113 0 NA
6-109837251-T-C p.Ile1292Val missense AK9 1 82006 1.21942E-5 41003 0 NA
6-109837253-G-C p.Pro1291Arg missense AK9 2 81988 2.43938E-5 40994 0 NA
6-109837264-C-T p.Arg1287Arg synonymous AK9 1 81806 1.2224E-5 40903 0 6.4161E-6
6-109837281-GATAAGA-G c.3847-9_3847-4delTCTTAT splice_region AK9 1 81588 1.22567E-5 40794 0 NA
6-109837630-A-T c.3846+3T>A splice_region AK9 1 81828 1.22208E-5 40914 0 6.39672E-6
6-109837632-C-T c.3846+1G>A splice_donor AK9 1 81880 1.2213E-5 40940 0 NA
6-109837652-T-C p.His1276Arg missense AK9 2 82276 2.43084E-5 41138 0 3.80296E-5
6-109837653-G-A p.His1276Tyr missense AK9 1 82302 1.21504E-5 41151 0 NA
6-109837666-A-C p.Phe1271Leu missense AK9 1 82418 1.21333E-5 41209 0 1.74871E-4
6-109837671-T-C p.Lys1270Glu missense AK9 2 82466 2.42524E-5 41233 0 NA
6-109837695-G-A p.Arg1262Cys missense AK9 6 82554 7.26797E-5 41277 0 3.02167E-4
6-109837716-G-A p.Gln1255* stop_gained AK9 1 82584 1.21089E-5 41292 0 6.31154E-6
6-109837721-T-C p.Glu1253Gly missense AK9 2 82588 2.42166E-5 41294 0 NA
6-109837723-A-C p.Asp1252Glu missense AK9 1 82592 1.21077E-5 41296 0 1.30389E-4
6-109837732-G-A p.Gly1249Gly synonymous AK9 1 82578 1.21098E-5 41289 0 NA
6-109837735-A-G p.Ser1248Ser synonymous AK9 1 82586 1.21086E-5 41293 0 NA
6-109837747-C-T p.Glu1244Glu synonymous AK9 2 82576 2.42201E-5 41288 0 3.18532E-5
6-109837748-T-C p.Glu1244Gly missense AK9 1 82576 1.21101E-5 41288 0 NA
6-109837758-G-C p.Pro1241Ala missense AK9 1 82534 1.21162E-5 41267 0 3.80353E-5
6-109837771-A-T p.Leu1236Leu synonymous AK9 2 82530 2.42336E-5 41265 0 NA
6-109837777-GT-G p.Asn1234fs frameshift AK9 4 82486 4.84931E-5 41243 1 NA
6-109837784-A-G p.Ile1232Thr missense AK9 1 82436 1.21306E-5 41218 0 NA
6-109837790-T-C p.Asp1230Gly missense AK9 1 82426 1.21321E-5 41213 0 NA
6-109837799-T-A p.Glu1227Val missense AK9 1 82342 1.21445E-5 41171 0 NA
6-109837801-T-C p.Glu1226Glu synonymous AK9 1 82338 1.21451E-5 41169 0 NA
6-109837803-C-A p.Glu1226* stop_gained AK9 1 82308 1.21495E-5 41154 0 NA
6-109837810-T-C p.Glu1223Glu synonymous AK9 1 82210 1.2164E-5 41105 0 NA
6-109837825-TTCA-T p.Asp1217del disruptive_inframe_deletion AK9 2 81978 2.43968E-5 40989 0 NA
6-109837826-T-C p.Glu1218Gly missense AK9 1 81946 1.22032E-5 40973 0 3.18471E-5
6-109849745-G-A p.Asn360Asn synonymous AK9 1 53266 1.87737E-5 26633 0 2.10911E-4
6-109849755-T-C p.Asn357Ser missense AK9 3 53284 5.63021E-5 26642 0 1.45656E-5
6-109849758-T-C p.Gln356Arg missense AK9 1 53298 1.87624E-5 26649 0 NA
6-109849762-TT-GG p.SerLys354SerGln missense AK9 5 53302 9.38051E-5 26651 0 NA
6-109849762-T-G p.Lys355Gln missense AK9 1 53302 1.8761E-5 26651 0 2.22887E-4
6-109849763-T-G p.Ser354Ser synonymous AK9 1 53300 1.87617E-5 26650 0 2.22859E-4
6-109849772-A-G p.Val351Val synonymous AK9 3 53290 5.62957E-5 26645 0 3.1841E-5
6-109849783-T-C p.Lys348Glu missense AK9 1 53286 1.87667E-5 26643 0 0.00125
6-109849789-C-T p.Gly346Arg missense AK9 1 53248 1.878E-5 26624 0 6.97642E-5
6-109849790-G-A p.Ser345Ser synonymous AK9 14 53238 2.6297E-4 26619 0 6.37105E-4
6-109849810-C-CTGCAGT p.Ala338_Gly339insThrAla conservative_inframe_insertion AK9 2860 53142 0.0538181 26571 86 0.0661795
6-109849810-CTGCAGTTGCAGT-C p.Thr335_Ala338del conservative_inframe_deletion AK9 1 53196 1.87984E-5 26598 0 7.27961E-6
6-109849810-CTGCAGT-C p.Thr337_Ala338del conservative_inframe_deletion AK9 8 53196 1.50387E-4 26598 0 6.37146E-5
6-109849819-C-T p.Ala336Thr missense AK9 1 53164 1.88097E-5 26582 0 NA
6-109849840-A-G p.Leu329Leu synonymous AK9 1 53130 1.88218E-5 26565 0 3.19081E-5
6-109849843-T-TCAGC p.Ile328fs frameshift AK9 2 53104 3.76619E-5 26552 0 NA
6-109849843-T-A p.Ile328Leu missense AK9 2 53104 3.76619E-5 26552 0 7.29246E-6
6-109849846-G-T p.Leu327Met missense AK9 1 53092 1.88352E-5 26546 0 NA
6-109849849-G-C p.Leu326Val missense AK9 1 53108 1.88296E-5 26554 0 7.29448E-6
6-109849859-C-T p.Pro322Pro synonymous AK9 1 53076 1.88409E-5 26538 0 6.36821E-5
6-109849860-G-A p.Pro322Leu missense AK9 5 53064 9.42258E-5 26532 0 7.00967E-5
6-109849876-C-T p.Glu317Lys missense AK9 6 53090 1.13016E-4 26545 0 3.18471E-4
6-109849883-G-C p.Pro314Pro synonymous AK9 7 53116 1.31787E-4 26558 0 3.18512E-5
6-109849894-G-A p.His311Tyr missense AK9 1 53230 1.87864E-5 26615 0 NA
6-109849895-G-A p.Asn310Asn synonymous AK9 7 53234 1.31495E-4 26617 0 1.02087E-4
6-109849895-G-T p.Asn310Lys missense AK9 1 53234 1.8785E-5 26617 0 NA
6-109849899-C-CAGGAAAACAAGTTTAGGGCCCCCACTGATTCT p.Cys309fs frameshift AK9 1 53254 1.87779E-5 26627 0 NA
6-109849905-T-C p.Tyr307Cys missense AK9 6 53346 1.12473E-4 26673 0 3.18431E-5
6-109849914-G-A p.Thr304Ile missense AK9 8 53660 1.49087E-4 26830 1 6.99105E-5
6-109849956-T-G c.871-2A>C splice_acceptor AK9 2 56680 3.52858E-5 28340 0 7.22899E-6
6-109849962-T-A c.871-8A>T splice_region AK9 4 57132 7.00133E-5 28566 0 6.45745E-5
6-109850086-A-T p.Leu333His missense AK9 1 68880 1.4518E-5 34440 0 2.00254E-5
6-109850096-G-C p.His330Asp missense AK9 1 69974 1.4291E-5 34987 0 NA
6-109850100-G-A p.Ser328Ser synonymous AK9 1 70344 1.42159E-5 35172 0 NA
6-109850103-T-A p.Gly327Gly synonymous AK9 1454 70488 0.0206276 35244 11 0.0774487
6-109850122-C-T p.Arg321Gln missense AK9 5 72276 6.91793E-5 36138 0 6.25782E-4
6-109850137-C-T p.Ser316Asn missense AK9 27 74206 3.63852E-4 37103 0 8.0588E-4
6-109850147-G-T p.His313Asn missense AK9 1 75152 1.33064E-5 37576 0 NA
6-109850156-C-A p.Val310Leu missense AK9 14 76224 1.83669E-4 38112 0 1.31437E-4
6-109850181-C-A p.Gly301Gly synonymous AK9 4 78932 5.06765E-5 39466 0 4.64166E-5
6-109850190-G-GA p.Lys299fs frameshift AK9 8 78014 1.02546E-4 39007 0 0.0097497
6-109850190-GA-G p.Phe298fs frameshift AK9 2 79744 2.50803E-5 39872 0 9.6489E-4
6-109850190-GAA-G p.Phe298fs frameshift AK9 4 79748 5.0158E-5 39874 0 7.20067E-5
6-109850195-A-C p.Phe297Val missense AK9 3 80558 3.72403E-5 40279 0 8.51223E-6
6-109850198-AAAC-A p.Val295del conservative_inframe_deletion AK9 26 79882 3.2548E-4 39941 0 0.0506103
6-109850198-A-G p.Phe296Leu missense AK9 1 80780 1.23793E-5 40390 0 6.81431E-5
6-109850199-AAC-A p.Val295fs frameshift AK9 24137 59368 0.406566 29684 2057 0.533684
6-109850200-AC-A p.Val295fs frameshift AK9 218 52912 0.00412005 26456 1 0.232099
6-109850200-A-C p.Val295Gly missense AK9 9 66438 1.35465E-4 33219 0 1.69237E-4
6-109850201-C-A p.Val295Phe missense AK9 4 59442 6.72925E-5 29721 0 0.0200121
6-109850201-CAA-C p.Phe294fs frameshift AK9 3 59516 5.04066E-5 29758 0 4.09587E-5
6-109850203-A-G p.Phe294Ser missense AK9 1 80966 1.23509E-5 40483 0 NA
6-109850221-C-CT p.Arg288fs frameshift AK9 2 81798 2.44505E-5 40899 0 3.22331E-5
6-109850221-C-A p.Arg288Met missense AK9 1 81800 1.22249E-5 40900 0 NA
6-109850229-A-C p.Asp285Glu missense AK9 1 81694 1.22408E-5 40847 0 5.03525E-4
6-109850233-C-A p.Arg284Ile missense AK9 72 81814 8.80045E-4 40907 0 0.00188206
6-109850241-T-C p.Ile281Met missense AK9 2 82038 2.43789E-5 41019 0 6.40164E-5
6-109850242-A-G p.Ile281Thr missense AK9 3 81918 3.6622E-5 40959 0 6.26566E-4
6-109850246-G-A p.Leu280Phe missense AK9 2 82026 2.43825E-5 41013 0 NA
6-109850253-C-T p.Arg277Arg synonymous AK9 1 82024 1.21916E-5 41012 0 3.21481E-5
6-109850258-T-C p.Arg276Gly missense AK9 2 82088 2.43641E-5 41044 0 9.11777E-6
6-109850264-C-T p.Ala274Thr missense AK9 1 82024 1.21916E-5 41012 0 6.42674E-5
6-109850268-C-T p.Thr272Thr synonymous AK9 2 82020 2.43843E-5 41010 0 3.48523E-5
6-109854452-A-T c.807+2T>A splice_donor AK9 5 82562 6.05605E-5 41281 0 3.18552E-5
6-109854453-C-T c.807+1G>A splice_donor AK9 1 82586 1.21086E-5 41293 0 1.63926E-5
6-109854459-T-G p.Ile268Leu missense AK9 4 82682 4.83781E-5 41341 0 1.27146E-4
6-109854474-C-A p.Asp263Tyr missense AK9 1 82854 1.20694E-5 41427 0 NA
6-109854476-T-C p.Lys262Arg missense AK9 1 82862 1.20683E-5 41431 0 4.0563E-6
6-109854496-T-C p.Leu255Leu synonymous AK9 1 82936 1.20575E-5 41468 0 NA
6-109854502-C-A p.Lys253Asn missense AK9 8 82958 9.64343E-5 41479 0 0.00100806
6-109854502-C-T p.Lys253Lys synonymous AK9 1 82960 1.2054E-5 41480 0 NA
6-109854505-C-T p.Lys252Lys synonymous AK9 1 82948 1.20557E-5 41474 0 NA
6-109854514-T-C p.Leu249Leu synonymous AK9 1 82932 1.20581E-5 41466 0 6.25E-4
6-109854520-CCAC-TTAT p.LysTrp246* stop_gained AK9 1 82920 1.20598E-5 41460 0 NA
6-109854528-C-T p.Glu245Lys missense AK9 1 82930 1.20584E-5 41465 0 NA
6-109854531-T-C p.Ile244Val missense AK9 1 82920 1.20598E-5 41460 0 6.62866E-5
6-109854540-G-A p.Pro241Ser missense AK9 1 82928 1.20587E-5 41464 0 NA
6-109854548-C-T p.Arg238His missense AK9 2 82924 2.41185E-5 41462 0 6.25E-4
6-109854549-G-A p.Arg238Cys missense AK9 3 82932 3.61742E-5 41466 0 0.00100705
6-109854578-A-G p.Ile228Thr missense AK9 7 82936 8.44024E-5 41468 0 4.95909E-5
6-109854579-T-C p.Ile228Val missense AK9 1 82932 1.20581E-5 41466 0 4.82121E-5
6-109854585-C-G p.Val226Leu missense AK9 4 82944 4.82253E-5 41472 1 1.20533E-5
6-109854586-A-G p.Ala225Ala synonymous AK9 2 82946 2.41121E-5 41473 0 NA
6-109854605-C-G p.Gly219Ala missense AK9 1 82886 1.20648E-5 41443 0 NA
6-109854605-C-A p.Gly219Val missense AK9 1 82896 1.20633E-5 41448 0 3.18756E-5
6-109854606-C-CATTGAAT p.Gly219fs frameshift AK9 1 82880 1.20656E-5 41440 0 NA
6-109854608-C-T p.Arg218His missense AK9 18 82866 2.17218E-4 41433 0 5.03525E-4
6-109854609-G-T p.Arg218Ser missense AK9 1 82878 1.20659E-5 41439 0 NA
6-109854609-G-C p.Arg218Gly missense AK9 1 82878 1.20659E-5 41439 0 NA
6-109854612-C-A p.Asp217Tyr missense AK9 2 82890 2.41284E-5 41445 0 NA
6-109854626-G-A p.Ala212Val missense AK9 1 82854 1.20694E-5 41427 0 1.20588E-5
6-109854633-C-T p.Glu210Lys missense AK9 6 82864 7.24078E-5 41432 0 6.37308E-5
6-109854641-C-T p.Arg207Gln missense AK9 10 82798 1.20776E-4 41399 0 9.15781E-5
6-109854651-C-A p.Gly204Cys missense AK9 1 82782 1.20799E-5 41391 0 NA
6-109854661-A-T p.Phe200Leu missense AK9 1 82690 1.20934E-5 41345 0 NA
6-109854666-C-T p.Gly199Ser missense AK9 1 82648 1.20995E-5 41324 0 NA
6-109854671-G-A p.Ser197Phe missense+splice_region AK9 2 82548 2.42283E-5 41274 1 9.34221E-6
6-109854676-G-A c.588-3C>T splice_region AK9 1 82434 1.21309E-5 41217 0 2.84215E-5
6-109854676-G-T c.588-3C>A splice_region AK9 1 82434 1.21309E-5 41217 0 NA
6-109863248-AC-A c.587+1delG splice_donor AK9 1 82528 1.21171E-5 41264 0 NA
6-109863250-CGTATTG-C p.Pro194_Ile195del disruptive_inframe_deletion AK9 1 82494 1.21221E-5 41247 0 NA
6-109863250-C-T p.Arg196His missense+splice_region AK9 8 82494 9.69767E-5 41247 0 3.77686E-5
6-109863251-G-A p.Arg196Cys missense+splice_region AK9 34 82614 4.11553E-4 41307 0 9.8745E-4
6-109863262-T-G p.Lys192Thr missense AK9 1 82792 1.20785E-5 41396 0 NA
6-109863292-A-C p.Leu182Arg missense AK9 1 82974 1.2052E-5 41487 0 NA
6-109863293-G-T p.Leu182Ile missense AK9 21 82976 2.53085E-4 41488 0 6.05057E-4
6-109863301-G-T p.Pro179His missense AK9 3 82994 3.61472E-5 41497 0 1.21773E-4
6-109863324-T-G p.Leu171Leu synonymous AK9 1 82976 1.20517E-5 41488 0 4.07777E-6
6-109863336-G-T p.Ile167Ile synonymous AK9 1 82948 1.20557E-5 41474 0 NA
6-109863340-ACTT-A p.Glu165del disruptive_inframe_deletion AK9 3 82936 3.61725E-5 41468 0 3.77583E-5
6-109863360-T-C p.Gln159Gln synonymous AK9 1 82782 1.20799E-5 41391 0 1.00766E-5
6-109863370-G-A p.Pro156Leu missense AK9 1 82686 1.20939E-5 41343 0 2.0749E-5
6-109863372-A-T p.Leu155Leu splice_region+synonymous AK9 1 82652 1.20989E-5 41326 0 4.5056E-6
6-109863376-T-TA c.463-3_463-2insT splice_region AK9 1 82600 1.21065E-5 41300 0 NA
6-109867062-A-T c.462+8T>A splice_region AK9 1 82940 1.20569E-5 41470 0 NA
6-109867064-T-C c.462+6A>G splice_region AK9 3 82988 3.61498E-5 41494 0 4.41591E-6
6-109867069-C-T c.462+1G>A splice_donor AK9 2 83058 2.40796E-5 41529 0 5.85333E-5
6-109867071-T-C p.Gln154Arg missense+splice_region AK9 2 83058 2.40796E-5 41529 0 NA
6-109867073-C-A p.Lys153Asn missense AK9 2 83080 2.40732E-5 41540 0 NA
6-109867108-C-T p.Ala142Thr missense AK9 1 83262 1.20103E-5 41631 0 NA
6-109867116-G-T p.Ala139Glu missense AK9 1 83274 1.20085E-5 41637 0 NA
6-109867120-G-A p.Leu138Phe missense AK9 1 83278 1.2008E-5 41639 0 8.24171E-6
6-109867135-G-C p.Gln133Glu missense AK9 6 83286 7.20409E-5 41643 0 2.3873E-5
6-109867149-T-G p.Glu128Ala missense AK9 2 83294 2.40113E-5 41647 0 NA
6-109867150-C-T p.Glu128Lys missense AK9 3 83294 3.6017E-5 41647 0 6.25E-4
6-109867151-G-A p.Asn127Asn synonymous AK9 7 83298 8.40356E-5 41649 0 7.16082E-5
6-109867160-A-C p.Asp124Glu missense AK9 1 83304 1.20042E-5 41652 0 NA
6-109867186-T-C p.Lys116Glu missense AK9 1 83310 1.20034E-5 41655 0 8.23968E-6
6-109867190-T-C p.Glu114Glu synonymous AK9 1 83308 1.20036E-5 41654 0 3.97753E-5
6-109867195-T-A p.Thr113Ser missense AK9 1 83304 1.20042E-5 41652 0 NA
6-109867197-T-G p.Lys112Thr missense AK9 56 83310 6.72188E-4 41655 0 5.56859E-4
6-109867216-G-A p.Gln106* stop_gained AK9 1 83292 1.2006E-5 41646 0 7.95659E-6
6-109867222-C-T p.Val104Ile missense AK9 1 83280 1.20077E-5 41640 0 NA
6-109867236-A-G p.Ile99Thr missense AK9 1 83256 1.20111E-5 41628 0 NA
6-109867236-A-ATG p.Ile99fs frameshift AK9 1 83256 1.20111E-5 41628 0 NA
6-109867239-T-G p.His98Pro missense AK9 1 83248 1.20123E-5 41624 0 NA
6-109867265-C-T p.Gln89Gln synonymous AK9 9 83104 1.08298E-4 41552 0 NA
6-109867273-C-T p.Gly87Arg missense AK9 1 82930 1.20584E-5 41465 0 3.98867E-6
6-109867279-T-G p.Met85Leu missense AK9 5 82774 6.04054E-5 41387 0 9.56389E-5
6-109867294-C-T p.Gly80Ser missense AK9 1 82338 1.21451E-5 41169 0 NA
6-109867296-T-TG p.Gln79fs frameshift AK9 2 82264 2.4312E-5 41132 1 NA
6-109867303-C-T p.Gly77Ser missense AK9 11 81914 1.34287E-4 40957 0 1.10672E-4
6-109867306-C-A p.Val76Phe missense AK9 5 81836 6.10978E-5 40918 0 1.52637E-4
6-109867311-C-A p.Cys74Phe missense AK9 1 81584 1.22573E-5 40792 0 NA
6-109867312-A-G p.Cys74Arg missense AK9 1 81472 1.22742E-5 40736 0 3.18695E-5
6-109867329-G-A p.Ala68Val missense+splice_region AK9 3 80348 3.73376E-5 40174 0 NA
6-109867338-A-G c.202-8T>C splice_region AK9 2 78698 2.54136E-5 39349 0 1.80299E-5
6-109870886-TGAGACGGAG-T n.2073_2081delCTCCGTCTC splice_region AK9 1 432 0.00231481 216 0 0.00125504
6-109870886-TGAGACGGA-T n.2074_2081delTCCGTCTC splice_region AK9 1 432 0.00231481 216 0 0.00110291
6-109871287-T-TCTCAA c.201+5_201+6insTTGAG splice_region AK9 9 83218 1.0815E-4 41609 0 4.95769E-5
6-109871292-C-T c.201+1G>A splice_donor AK9 2 83240 2.40269E-5 41620 0 NA
6-109871294-T-G p.Lys67Thr missense+splice_region AK9 1 83250 1.2012E-5 41625 0 NA
6-109871296-C-G p.Leu66Phe missense AK9 24 83260 2.88254E-4 41630 0 8.28395E-4
6-109871298-A-G p.Leu66Leu synonymous AK9 3 83264 3.603E-5 41632 0 6.25E-4
6-109871304-CT-C p.Glu64fs frameshift AK9 2 83272 2.40177E-5 41636 0 7.96737E-6
6-109871305-T-C p.Glu63Glu synonymous AK9 3 83270 3.60274E-5 41635 0 3.18451E-5
6-109871314-C-A p.Val60Val synonymous AK9 1 83290 1.20062E-5 41645 0 NA
6-109871321-T-C p.Asp58Gly missense AK9 1 83286 1.20068E-5 41643 0 2.47439E-5
6-109871355-C-G p.Glu47Gln missense AK9 1 83256 1.20111E-5 41628 0 3.97918E-6
6-109871356-A-G p.Ala46Ala synonymous AK9 1 83254 1.20114E-5 41627 0 8.2702E-6
6-109871384-C-T p.Arg37Gln missense AK9 4 82936 4.823E-5 41468 0 5.98239E-5
6-109871387-T-C p.Tyr36Cys missense AK9 2 82862 2.41365E-5 41431 0 3.9896E-6
6-109871389-C-T p.Lys35Lys synonymous AK9 3 82816 3.62249E-5 41408 0 8.30606E-6
6-109871393-G-T p.Ala34Asp missense AK9 2 82720 2.41779E-5 41360 0 8.30937E-6
6-109871399-T-G p.Glu32Ala missense AK9 57 82526 6.90691E-4 41263 0 0.00100705
6-109871405-G-C p.Thr30Arg missense AK9 1 82362 1.21415E-5 41181 0 NA
6-109871427-A-C p.Phe23Val missense AK9 1 81464 1.22754E-5 40732 0 NA
6-109871430-T-C p.Asn22Asp missense AK9 1 81340 1.22941E-5 40670 0 NA
6-109871446-C-T p.Pro16Pro synonymous AK9 3 80206 3.74037E-5 40103 0 2.82272E-5
6-109871447-G-A p.Pro16Leu missense AK9 1 80074 1.24884E-5 40037 0 3.19081E-5
6-109871476-C-T p.Arg6Arg synonymous AK9 1 76912 1.30019E-5 38456 0 NA
6-109871484-T-G p.Arg4Arg synonymous AK9 1 75294 1.32813E-5 37647 0 NA
6-109871508-A-G c.-12-3T>C splice_region AK9 219 70806 0.00309296 35403 0 0.00267533
6-109871513-C-T c.-12-8G>A splice_region AK9 9 70024 1.28527E-4 35012 0 8.38631E-5
6-109871516-T-C c.-23A>G 5_prime_UTR_premature_start_codon_gain AK9 2 69596 2.87373E-5 34798 0 4.36586E-6
6-109884798-G-GCCTCTT c.-13+1_-13+2insAAGAGG splice_donor AK9 10 80922 1.23576E-4 40461 0 0.00151638
6-109884798-GCCTCTTCCTCTT-G p.Glu914fs frameshift AK9 3 80922 3.70727E-5 40461 0 2.60193E-5
6-109884824-C-T p.Glu909Glu synonymous AK9 2 81236 2.46196E-5 40618 0 NA
6-109884854-GTCTTCTGTT-G p.Glu896_Glu898del disruptive_inframe_deletion AK9 1 81296 1.23007E-5 40648 0 NA
6-109884868-C-T p.Glu895Lys missense AK9 1 81316 1.22977E-5 40658 0 6.47023E-6
6-109884890-C-G p.Glu887Asp missense AK9 1 81302 1.22998E-5 40651 0 6.48416E-6
6-109884891-T-A p.Glu887Val missense AK9 9 81282 1.10726E-4 40641 0 0.00216341
6-109884895-A-G p.Trp886Arg missense AK9 1 81272 1.23044E-5 40636 0 5.0317E-5
6-109884903-T-C p.Tyr883Cys missense AK9 7 81242 8.61623E-5 40621 0 1.10582E-4
6-109884905-T-C p.Gln882Gln synonymous AK9 1 81242 1.23089E-5 40621 0 8.46299E-5
6-109884922-A-G c.-128-7T>C splice_region AK9 1 81106 1.23295E-5 40553 0 NA
6-109885276-C-T c.-129+7G>A splice_region AK9 2 80336 2.48954E-5 40168 0 6.58779E-6
6-109885327-C-G p.Arg864Thr missense AK9 1 81066 1.23356E-5 40533 0 6.50144E-6
6-109885331-C-T p.Asp863Asn missense AK9 1 81078 1.23338E-5 40539 0 NA
6-109885334-C-T p.Ala862Thr missense AK9 3 81086 3.69978E-5 40543 0 NA
6-109885338-C-A p.Glu860Asp missense AK9 1 81106 1.23295E-5 40553 0 1.0102E-4
6-109885343-A-C p.Leu859Val missense AK9 3 81102 3.69905E-5 40551 0 NA
6-109885344-G-A p.Asn858Asn synonymous AK9 2 81096 2.46621E-5 40548 0 NA
6-109885363-G-A p.Ala852Val missense AK9 10 81100 1.23305E-4 40550 0 4.87475E-4
6-109885364-C-T p.Ala852Thr missense AK9 2 81098 2.46615E-5 40549 0 NA
6-109885387-T-C p.Gln844Arg missense AK9 1 81090 1.2332E-5 40545 0 NA
6-109885395-G-C c.-241C>G 5_prime_UTR_premature_start_codon_gain AK9 1 81064 1.23359E-5 40532 0 NA
6-109885396-A-G p.Leu841Pro missense AK9 127 81058 0.00156678 40529 0 0.00796128
6-109885397-G-C p.Leu841Val missense AK9 1 81056 1.23371E-5 40528 0 NA
6-109885413-A-G p.Ile835Ile synonymous AK9 1 80998 1.2346E-5 40499 0 NA
6-109885416-C-T p.Lys834Lys synonymous AK9 1 80980 1.23487E-5 40490 0 NA
6-109885417-T-G p.Lys834Thr missense AK9 141 80982 0.00174113 40491 0 0.00130557
6-109885431-C-T p.Glu829Glu synonymous AK9 1 80898 1.23612E-5 40449 0 6.50669E-6
6-109885439-C-T p.Glu827Lys missense AK9 1 80822 1.23729E-5 40411 0 5.0638E-5
6-109885440-G-A c.-286C>T 5_prime_UTR_premature_start_codon_gain AK9 3 80810 3.71241E-5 40405 0 0.0031348
6-109885442-G-T p.Pro826Thr missense AK9 1 80792 1.23775E-5 40396 0 NA
6-109885460-C-T p.Asp820Asn missense AK9 2 80592 2.48164E-5 40296 0 NA
6-109885464-T-G p.Pro818Pro synonymous AK9 2 80528 2.48361E-5 40264 0 NA
6-109885475-G-A p.Pro815Ser missense AK9 17088 77028 0.221841 38514 1502 0.311897
6-109885479-T-C p.Val813Val synonymous AK9 1683 80062 0.0210212 40031 48 0.0356095
6-109885481-C-A p.Val813Leu missense+splice_region AK9 1 80178 1.24722E-5 40089 0 6.37592E-5
6-109885967-G-T p.Ser809Tyr missense AK9 18 80260 2.24271E-4 40130 0 2.62814E-4
6-109885979-A-G p.Ile805Thr missense AK9 1 80360 1.2444E-5 40180 0 5.07048E-5
6-109885982-T-G p.Glu804Ala missense AK9 1 80392 1.2439E-5 40196 0 6.65735E-6
6-109885985-A-G p.Leu803Pro missense AK9 2 80426 2.48676E-5 40213 0 6.36983E-5
6-109885992-C-G p.Glu801Gln missense AK9 4 80432 4.97315E-5 40216 0 5.99217E-5
6-109886000-C-T p.Gly798Glu missense AK9 5 80424 6.21705E-5 40212 0 6.25E-4
6-109886001-C-T p.Gly798Arg missense AK9 523 80398 0.00650514 40199 12 0.0114686
6-109886002-T-G p.Lys797Asn missense AK9 1 80468 1.24273E-5 40234 0 6.64055E-6
6-109886005-T-C p.Pro796Pro synonymous AK9 16932 79900 0.211915 39950 1977 0.29125
6-109886005-T-A p.Pro796Pro synonymous AK9 1 80434 1.24326E-5 40217 0 5.0597E-5
6-109886015-G-C p.Thr793Arg missense AK9 1 80374 1.24418E-5 40187 0 6.67931E-6
6-109886021-A-C p.Val791Gly missense AK9 2 80352 2.48905E-5 40176 0 NA
6-109886030-TCCTCGATAGGCTC-T p.Glu784fs frameshift AK9 2 80286 2.49109E-5 40143 0 NA
6-109886034-C-T p.Glu787Lys missense AK9 2 80192 2.49401E-5 40096 0 6.25E-4
6-109886035-G-A c.-406C>T 5_prime_UTR_premature_start_codon_gain AK9 2 80186 2.4942E-5 40093 0 6.83013E-6
6-109886035-G-C p.Ile786Met missense AK9 5 80186 6.2355E-5 40093 1 5.09632E-5
6-109894642-A-G c.-420+3T>C splice_region AK9 5 81336 6.14734E-5 40668 0 2.86533E-4
6-109894645-C-T p.Val782Ile missense+splice_region AK9 2 81344 2.45869E-5 40672 0 NA
6-109894648-C-T p.Ala781Thr missense AK9 1 81378 1.22883E-5 40689 0 NA
6-109894674-G-A p.Ser772Phe missense AK9 2 81430 2.4561E-5 40715 0 6.52997E-6
6-109894686-T-A p.Glu768Val missense AK9 8 81438 9.82342E-5 40719 0 3.56961E-4
6-109894687-C-T p.Glu768Lys missense AK9 1 81444 1.22784E-5 40722 0 6.50694E-6
6-109894703-C-T p.Gly762Gly synonymous AK9 2 81434 2.45598E-5 40717 0 9.55353E-5
6-109894708-G-A p.Arg761* stop_gained AK9 1 81436 1.22796E-5 40718 0 NA
6-109894709-G-A p.Thr760Thr synonymous AK9 478 81428 0.00587022 40714 5 0.0141756
6-109894714-C-T p.Asp759Asn missense AK9 1 81440 1.2279E-5 40720 0 6.49933E-6
6-109894735-C-T p.Glu752Lys missense AK9 2 81422 2.45634E-5 40711 0 1.01204E-4
6-109894736-G-A c.-511C>T 5_prime_UTR_premature_start_codon_gain AK9 2 81420 2.4564E-5 40710 0 5.0597E-5
6-109894745-C-A p.Leu748Phe missense AK9 25 81416 3.07065E-4 40708 0 0.00125
6-109894773-T-A p.Asp739Val missense AK9 17897 80678 0.221832 40339 2015 0.29375
6-109894781-A-G p.Asp736Asp synonymous AK9 4 81188 4.92684E-5 40594 0 3.18471E-5
6-109894782-T-C p.Asp736Gly missense AK9 2 81164 2.46415E-5 40582 0 NA
6-109894787-C-G p.Glu734Asp missense AK9 1 81114 1.23283E-5 40557 0 1.37482E-5
6-109894789-C-T p.Glu734Lys missense AK9 1 81064 1.23359E-5 40532 0 NA
6-109894799-T-TA c.-572-3_-572-2insT splice_region AK9 240 80784 0.00297089 40392 2 0.00691479
6-109900548-CA-AT c.*184_*185delTGinsAT splice_region AK9 8 50396 1.58743E-4 25198 0 NA
6-109900735-A-G p.Ter737Argext*? stop_lost AK9 214 81916 0.00261243 40958 2 0.00560545
6-109900744-T-C p.Arg734Gly missense AK9 3 82080 3.65497E-5 41040 0 4.37905E-5
6-109900752-C-T c.-573+1G>A splice_donor AK9 1 82166 1.21705E-5 41083 0 NA
6-109900765-C-A p.Val727Leu missense AK9 4139 82140 0.0503896 41070 125 0.0602366
6-109900768-T-A p.Lys726* stop_gained AK9 1 82264 1.2156E-5 41132 0 6.32871E-6
6-109900775-T-C p.Glu723Glu synonymous AK9 1 82288 1.21524E-5 41144 0 NA
6-109900784-C-G p.Arg720Ser missense AK9 6 82276 7.29253E-5 41138 0 1.59236E-4
6-109900784-C-A p.Arg720Ser missense AK9 1 82276 1.21542E-5 41138 0 NA
6-109900788-C-A p.Arg719Leu missense AK9 3 82272 3.64644E-5 41136 0 0.00372208
6-109900788-C-T p.Arg719Gln missense AK9 8 82272 9.72384E-5 41136 0 0.003125
6-109900789-G-T p.Arg719Arg synonymous AK9 2 82288 2.43049E-5 41144 0 NA
6-109900792-TTTC-T p.Glu717del conservative_inframe_deletion AK9 9 82308 1.09345E-4 41154 0 1.91046E-4
6-109900800-T-C p.Glu715Gly missense AK9 3 82292 3.64555E-5 41146 0 6.35469E-6
6-109900801-C-T p.Glu715Lys missense AK9 14 82272 1.70167E-4 41136 0 3.12193E-4
6-109900802-G-A c.-622C>T 5_prime_UTR_premature_start_codon_gain AK9 4 82280 4.86145E-5 41140 0 1.0176E-4
6-109906329-GCTT-G p.Glu703del disruptive_inframe_deletion AK9 27317 71920 0.379825 35960 5266 0.471446
6-109906329-GCTTCTT-G p.Glu702_Glu703del disruptive_inframe_deletion AK9 4 72820 5.493E-5 36410 0 3.79766E-5
6-109906329-G-C p.Ala704Gly missense AK9 1 72820 1.37325E-5 36410 0 6.84932E-4
6-109906332-T-G p.Glu703Ala missense AK9 304 62242 0.00488416 31121 1 0.00834461
6-109906342-C-CT p.Glu700fs frameshift AK9 1 72790 1.37382E-5 36395 0 0.00953679
6-109906342-C-G p.Glu700Gln missense AK9 2 72814 2.74672E-5 36407 0 9.58222E-5
6-109906344-T-A p.Lys699Ile missense AK9 1 73012 1.36964E-5 36506 0 NA
6-109906345-T-C p.Lys699Glu missense AK9 2 73088 2.73643E-5 36544 0 2.93169E-4
6-109906387-T-TA p.Lys685fs frameshift AK9 2 71698 2.78948E-5 35849 0 5.11771E-5
6-109906389-G-C p.Ser684Cys missense AK9 10 71432 1.39993E-4 35716 0 7.54815E-5
6-109906411-G-A p.Gln677* stop_gained AK9 1 70240 1.42369E-5 35120 0 NA
6-109906416-T-C p.Tyr675Cys missense AK9 2 70136 2.8516E-5 35068 0 NA
6-109906423-T-C p.Arg673Gly missense AK9 1 69422 1.44047E-5 34711 0 3.1998E-5
6-109906441-C-T c.-764-1G>A splice_acceptor AK9 2 67184 2.9769E-5 33592 0 NA
6-109906445-A-T c.-764-5T>A splice_region AK9 1 66852 1.49584E-5 33426 0 NA
6-109906446-A-G c.-764-6T>C splice_region AK9 7 66848 1.04715E-4 33424 0 NA
6-109907115-C-A c.-765+4G>T splice_region AK9 1 81998 1.21954E-5 40999 0 6.37389E-5
6-109907118-C-T c.-765+1G>A splice_donor AK9 1 82062 1.21859E-5 41031 0 9.55901E-5
6-109907142-T-C p.Tyr659Cys missense AK9 3 82340 3.64343E-5 41170 0 1.97239E-5
6-109907169-T-C p.Lys650Arg missense AK9 1 82468 1.21259E-5 41234 0 6.39452E-6
6-109907176-T-C p.Ile648Val missense AK9 1 82460 1.21271E-5 41230 0 4.6083E-5
6-109907189-C-A p.Leu643Phe missense AK9 1 82462 1.21268E-5 41231 0 2.81265E-4
6-109907193-T-A p.Glu642Val missense AK9 1 82462 1.21268E-5 41231 0 6.39337E-6
6-109907198-T-C p.Val640Val synonymous AK9 3 82470 3.63769E-5 41235 0 NA
6-109907221-T-G p.Ile633Leu missense AK9 7 82404 8.49473E-5 41202 0 3.18613E-5
6-109907232-T-C p.Tyr629Cys missense AK9 2 82396 2.4273E-5 41198 0 NA
6-109907234-T-A p.Lys628Asn missense AK9 1 82390 1.21374E-5 41195 0 NA
6-109907238-G-A p.Pro627Leu missense AK9 1 82380 1.21389E-5 41190 0 4.61127E-5
6-109907241-G-A p.Ala626Val missense AK9 2 82354 2.42854E-5 41177 0 4.61255E-5
6-109907248-G-A p.Pro624Ser missense AK9 1 82348 1.21436E-5 41174 0 NA
6-109907252-C-T p.Arg622Arg synonymous AK9 1 82332 1.21459E-5 41166 0 9.25069E-5
6-109907256-T-C p.Asp621Gly missense AK9 1 82326 1.21468E-5 41163 0 6.43666E-6
6-109907257-C-A p.Asp621Tyr missense AK9 1 82320 1.21477E-5 41160 0 NA
6-109907263-T-C p.Asn619Asp missense AK9 1 82276 1.21542E-5 41138 0 6.25E-4
6-109907267-T-C p.Glu617Glu synonymous AK9 1 82260 1.21566E-5 41130 0 3.23453E-5
6-109907276-C-T c.-921-1G>A splice_acceptor AK9 1 82148 1.21732E-5 41074 0 NA
6-109907276-C-G c.-921-1G>C splice_acceptor AK9 2 82148 2.43463E-5 41074 0 6.52963E-6
6-109931559-A-AT c.-922+8_-922+9insA splice_region AK9 1 82328 1.21465E-5 41164 0 3.18613E-5
6-109931560-T-A c.-922+8A>T splice_region AK9 2 82328 2.42931E-5 41164 0 3.18532E-5
6-109931560-T-C c.-922+8A>G splice_region AK9 1 82328 1.21465E-5 41164 0 2.53363E-5
6-109931580-T-C p.Glu610Glu synonymous AK9 4303 82288 0.052292 41144 128 0.0621909
6-109931585-G-A p.Gln609* stop_gained AK9 2 82412 2.42683E-5 41206 0 NA
6-109931586-T-C c.-940A>G 5_prime_UTR_premature_start_codon_gain AK9 1 82410 1.21345E-5 41205 0 NA
6-109931595-A-G p.Ala605Ala synonymous AK9 3 82440 3.63901E-5 41220 0 NA
6-109931596-G-A p.Ala605Val missense AK9 2 82446 2.42583E-5 41223 0 NA
6-109931608-T-C p.Tyr601Cys missense AK9 2 82448 2.42577E-5 41224 0 4.43931E-5
6-109931623-T-C p.Asn596Ser missense AK9 1 82474 1.2125E-5 41237 0 NA
6-109931627-T-C p.Ile595Val missense AK9 4 82480 4.84966E-5 41240 0 NA
6-109931647-G-A p.Thr588Ile missense AK9 2 82508 2.42401E-5 41254 0 NA
6-109931657-T-C p.Ile585Val missense AK9 1 82514 1.21192E-5 41257 0 NA
6-109931666-C-A p.Val582Leu missense AK9 1 82506 1.21203E-5 41253 0 3.1835E-5
6-109931669-C-T p.Val581Ile missense AK9 4 82494 4.84884E-5 41247 0 4.5708E-5
6-109931675-G-A p.Pro579Ser missense AK9 2 82506 2.42407E-5 41253 0 4.5754E-5
6-109931678-G-A p.His578Tyr missense AK9 1 82504 1.21206E-5 41252 0 3.18492E-5
6-109931679-A-G p.Asp577Asp synonymous AK9 7 82500 8.48485E-5 41250 0 9.16338E-5
6-109931683-G-C p.Ala576Gly missense AK9 1 82502 1.21209E-5 41251 0 1.91617E-5
6-109931690-C-T p.Val574Ile missense AK9 3 82480 3.63725E-5 41240 0 1.27866E-5
6-109931698-A-G p.Ile571Thr missense AK9 3 82466 3.63786E-5 41233 0 1.92007E-5
6-109931710-G-A p.Thr567Ile missense AK9 20 82444 2.42589E-4 41222 0 2.54728E-4
6-109931715-G-A p.Ala565Ala splice_region+synonymous AK9 1 82432 1.21312E-5 41216 0 NA
6-109931720-A-G c.-1070-4T>C splice_region AK9 245 82424 0.00297244 41212 2 0.00687679
6-109933210-T-C c.-1071+3A>G splice_region AK9 1 80034 1.24947E-5 40017 0 NA
6-109933218-T-A p.Asp563Val missense AK9 1 80478 1.24258E-5 40239 0 NA
6-109933221-G-T p.Ser562* stop_gained AK9 1 80602 1.24066E-5 40301 0 NA
6-109933235-A-G p.Asp557Asp synonymous AK9 1 80848 1.23689E-5 40424 0 NA
6-109933252-G-A p.Gln552* stop_gained AK9 2 81012 2.46877E-5 40506 0 6.6912E-6
6-109933254-G-A p.Ser551Phe missense AK9 1 81020 1.23426E-5 40510 0 NA
6-109933259-C-T p.Arg549Arg synonymous AK9 1 81078 1.23338E-5 40539 0 NA
6-109933267-A-G p.Phe547Leu missense AK9 1 81018 1.23429E-5 40509 0 NA
6-109933268-T-C p.Thr546Thr synonymous AK9 2 81028 2.46828E-5 40514 0 6.6394E-6
6-109933283-A-G p.Thr541Thr synonymous AK9 8 80834 9.89683E-5 40417 0 3.18573E-4
6-109933295-A-G p.Asp537Asp splice_region+synonymous AK9 2 80488 2.48484E-5 40244 0 0.00128205
6-109935379-T-C c.-1155+7A>G splice_region AK9 1 82122 1.2177E-5 41061 0 NA
6-109935388-T-C p.Asp536Gly missense+splice_region AK9 1 82212 1.21637E-5 41106 0 NA
6-109935411-A-G p.Asp528Asp synonymous AK9 3 82330 3.64387E-5 41165 0 4.59601E-5
6-109935415-T-C p.His527Arg missense AK9 2 82362 2.4283E-5 41181 0 6.37584E-6
6-109935432-C-T p.Lys521Lys synonymous AK9 1 82378 1.21392E-5 41189 0 NA
6-109935441-G-A p.Ala518Ala synonymous AK9 4 82400 4.85437E-5 41200 0 0.00125945
6-109935450-G-A c.-1219C>T 5_prime_UTR_premature_start_codon_gain AK9 1 82366 1.21409E-5 41183 0 3.18837E-5
6-109935453-G-C p.Asp514Glu missense AK9 478 82374 0.0058028 41187 9 0.0133223
6-109935470-C-T p.Gly509Ser missense AK9 1 82350 1.21433E-5 41175 0 4.94204E-4
6-109935474-G-A p.Asp507Asp synonymous AK9 1 82334 1.21457E-5 41167 0 NA
6-109935479-T-C p.Arg506Gly missense AK9 1 82328 1.21465E-5 41164 0 NA
6-109935484-G-A p.Ser504Phe missense AK9 1807 82270 0.0219643 41135 28 0.051875
6-109935494-T-C p.Ile501Val missense AK9 10 82260 1.21566E-4 41130 0 1.34795E-4
6-109935600-TTGA-T p.Ser494del conservative_inframe_deletion AK9 1 82108 1.21791E-5 41054 0 NA
6-109935606-A-G p.Ser493Pro missense AK9 1674 82062 0.0203992 41031 24 0.0525
6-109935608-T-A p.His492Leu missense AK9 1 82092 1.21815E-5 41046 0 3.18532E-5
6-109935621-T-C p.Met488Val missense AK9 1 82072 1.21844E-5 41036 0 0.00125313
6-109935630-C-T p.Val485Ile missense AK9 1 82036 1.21898E-5 41018 0 2.43275E-4
6-109935635-A-G p.Phe483Ser missense AK9 3 82034 3.65702E-5 41017 0 6.36821E-5
6-109935639-C-T p.Glu482Lys missense AK9 1 82012 1.21933E-5 41006 0 6.40213E-6
6-109935667-T-C p.Arg472Arg synonymous AK9 6 81800 7.33496E-5 40900 0 NA
6-109935673-A-G p.Ala470Ala synonymous AK9 7 81720 8.56583E-5 40860 0 6.36943E-5
6-109935689-A-C c.-1364-6T>G splice_region AK9 1 81404 1.22844E-5 40702 0 NA
6-109935691-A-G c.-1364-8T>C splice_region AK9 2 81352 2.45845E-5 40676 0 3.18431E-5
6-109940287-T-C c.-1365+8A>G splice_region AK9 2 82264 2.4312E-5 41132 0 3.1841E-5
6-109940289-T-C c.-1365+6A>G splice_region AK9 485 82298 0.00589322 41149 10 0.0134412
6-109940294-C-T c.-1365+1G>A splice_donor AK9 1 82336 1.21454E-5 41168 0 1.44515E-5
6-109940311-C-A p.Leu461Leu synonymous AK9 1 82410 1.21345E-5 41205 0 6.8197E-6
6-109940328-T-A p.Lys456* stop_gained AK9 1 82448 1.21289E-5 41224 0 NA
6-109940334-T-A p.Lys454* stop_gained AK9 1 82454 1.2128E-5 41227 0 NA
6-109940340-C-A p.Val452Phe missense AK9 2 82436 2.42612E-5 41218 0 1.97876E-5
6-109940369-A-G p.Ile442Thr missense AK9 3 82442 3.63892E-5 41221 0 3.18431E-5
6-109940380-T-C p.Val438Val synonymous AK9 6 82432 7.27873E-5 41216 0 4.60745E-5
6-109940382-C-T p.Val438Ile missense AK9 1 82418 1.21333E-5 41209 0 NA
6-109940383-T-C c.-1453A>G 5_prime_UTR_premature_start_codon_gain AK9 1 82422 1.21327E-5 41211 0 NA
6-109940384-A-C p.Leu437* stop_gained AK9 1 82424 1.21324E-5 41212 0 3.1839E-5
6-109940385-A-G p.Leu437Leu synonymous AK9 2 82424 2.42648E-5 41212 0 NA
6-109940393-C-T p.Arg434His missense AK9 3 82374 3.64193E-5 41187 0 1.38607E-4
6-109940397-C-T p.Ala433Thr missense AK9 1 82368 1.21406E-5 41184 0 0.00125
6-109940409-G-A p.Arg429Cys missense AK9 4 82326 4.85873E-5 41163 0 3.18512E-5
6-109940409-G-T p.Arg429Ser missense AK9 1 82326 1.21468E-5 41163 0 NA
6-109940427-C-T p.Ala423Thr missense AK9 1 82310 1.21492E-5 41155 0 NA
6-109940428-A-G p.Tyr422Tyr synonymous AK9 7 82300 8.50547E-5 41150 0 6.02015E-5
6-109940429-T-C p.Tyr422Cys missense AK9 1 82282 1.21533E-5 41141 0 1.33828E-5
6-109940431-G-T p.Asp421Glu missense AK9 1 82284 1.2153E-5 41142 0 3.18492E-5
6-109940433-C-A p.Asp421Tyr missense AK9 1 82250 1.21581E-5 41125 0 NA
6-109940439-C-T p.Val419Ile missense+splice_region AK9 22 82200 2.6764E-4 41100 0 4.13907E-4
6-109954110-ATAGT-A p.Ter422fs frameshift AK9 10 83160 1.2025E-4 41580 0 5.55819E-4
6-109954114-T-A p.Ter422Tyrext*? stop_lost AK9 21 83170 2.52495E-4 41585 0 0.0352467
6-109954115-T-G p.Ter422Serext*? stop_lost AK9 1 83168 1.20239E-5 41584 0 NA
6-109954118-T-C p.Asn421Ser missense AK9 6 83190 7.21241E-5 41595 0 6.25E-4
6-109954139-T-C p.Asn414Ser missense AK9 1 83256 1.20111E-5 41628 0 7.98193E-6
6-109954145-G-A p.Ala412Val missense AK9 152 83248 0.00182587 41624 0 0.0015489
6-109954148-A-G p.Leu411Pro missense AK9 2 83260 2.40211E-5 41630 0 7.98218E-6
6-109954150-C-T p.Met410Ile missense AK9 2 83260 2.40211E-5 41630 0 9.55962E-5
6-109954163-G-A p.Thr406Ile missense AK9 2 83276 2.40165E-5 41638 0 NA
6-109954168-T-C p.Lys404Lys synonymous AK9 1 83282 1.20074E-5 41641 0 3.99316E-6
6-109954180-T-C p.Gln400Gln synonymous AK9 3 83294 3.6017E-5 41647 0 8.33042E-6
6-109954216-T-C p.Pro388Pro synonymous AK9 5 83308 6.00182E-5 41654 0 2.5481E-4
6-109954219-C-T p.Met387Ile missense AK9 1 83310 1.20034E-5 41655 0 NA
6-109954224-G-C p.Pro386Ala missense AK9 1 83302 1.20045E-5 41651 0 4.27434E-6
6-109954230-G-A p.Leu384Phe missense AK9 1 83304 1.20042E-5 41652 0 3.18431E-5
6-109954236-A-G p.Tyr382His missense AK9 5 83302 6.00226E-5 41651 0 5.03525E-4
6-109954241-C-T p.Arg380His missense AK9 2 83310 2.40067E-5 41655 0 9.41942E-5
6-109954242-G-A p.Arg380Cys missense AK9 5 83314 6.00139E-5 41657 0 2.85152E-5
6-109954244-G-A p.Pro379Leu missense AK9 1 83310 1.20034E-5 41655 0 9.58644E-6
6-109954252-C-T p.Leu376Leu synonymous AK9 52008 82972 0.626814 41486 16791 0.73375
6-109954252-C-CA p.Leu376fs frameshift AK9 1 83288 1.20065E-5 41644 0 NA
6-109954257-A-C p.Phe375Val missense AK9 2 83286 2.40136E-5 41643 0 6.36943E-5
6-109954258-T-C p.Pro374Pro synonymous AK9 1 83282 1.20074E-5 41641 0 1.76072E-5
6-109954264-T-C c.-1648A>G 5_prime_UTR_premature_start_codon_gain AK9 594 83268 0.00713359 41634 5 0.0166163
6-109954271-T-G p.Glu370Ala missense AK9 2 83258 2.40217E-5 41629 0 5.15724E-6
6-109954279-T-A p.Ser367Ser synonymous AK9 1 83268 1.20094E-5 41634 0 NA
6-109954378-C-CT c.1073+8_1073+9insA splice_region AK9 1 83130 1.20294E-5 41565 0 NA
6-109954383-T-C c.1073+4A>G splice_region AK9 8 83122 9.62441E-5 41561 0 6.25E-4
6-109954386-C-T c.1073+1G>A splice_donor AK9 2 83136 2.4057E-5 41568 0 NA
6-109954389-C-G p.Val357Val splice_region+synonymous AK9 1 83124 1.20302E-5 41562 0 NA
6-109954416-A-C p.Ile348Met missense AK9 22 83160 2.6455E-4 41580 0 5.09424E-4
6-109954419-G-A p.Asn347Asn synonymous AK9 17 83154 2.0444E-4 41577 0 0.00100806
6-109954420-T-C p.Asn347Ser missense AK9 1 83156 1.20256E-5 41578 0 4.20507E-6
6-109954422-A-C p.Gly346Gly synonymous AK9 1 83158 1.20253E-5 41579 0 NA
6-109954427-C-T p.Asp345Asn missense AK9 8 83156 9.62047E-5 41578 0 6.25E-4
6-109954427-C-A p.Asp345Tyr missense AK9 1 83156 1.20256E-5 41578 0 NA
6-109954428-T-G p.Lys344Asn missense AK9 1 83158 1.20253E-5 41579 0 NA
6-109954444-C-T p.Cys339Tyr missense AK9 1 83170 1.20236E-5 41585 0 NA
6-109954445-A-T p.Cys339Ser missense AK9 32 83172 3.84745E-4 41586 0 1.70486E-4
6-109954450-C-T p.Arg337His missense AK9 1 83162 1.20247E-5 41581 0 2.43108E-5
6-109954451-G-A p.Arg337Cys missense AK9 2 83166 2.40483E-5 41583 0 5.83898E-5
6-109954456-C-T p.Trp335* stop_gained AK9 3 83162 3.60742E-5 41581 0 8.34613E-6
6-109954457-A-G p.Trp335Arg missense AK9 1 83158 1.20253E-5 41579 0 NA
6-109954482-T-C p.Pro326Pro synonymous AK9 1 83138 1.20282E-5 41569 0 NA
6-109954483-G-T p.Pro326Gln missense AK9 1 83142 1.20276E-5 41571 0 3.68961E-5
6-109954489-A-G p.Ile324Thr missense AK9 1 83126 1.20299E-5 41563 0 8.37619E-6
6-109954498-T-C p.Tyr321Cys missense AK9 483 83090 0.00581297 41545 10 0.0134722
6-109954503-T-C p.Ala319Ala synonymous AK9 1 83078 1.20369E-5 41539 0 NA
6-109954508-G-C p.Leu318Val missense AK9 1 83066 1.20386E-5 41533 0 4.21067E-5
6-109954513-C-T p.Arg316His missense AK9 12 83044 1.44502E-4 41522 0 1.01334E-4
6-109954514-G-A p.Arg316Cys missense AK9 1 83050 1.20409E-5 41525 0 5.91186E-5
6-109954514-GAAATAGCTCATCCTGTGAATTGC-G p.Asp312_Arg316del splice_acceptor AK9 2 83050 2.40819E-5 41525 0 4.22276E-5
6-109954518-T-C c.-1822A>G 5_prime_UTR_premature_start_codon_gain AK9 18267 82410 0.22166 41205 2034 0.293125
6-109954519-A-G p.Leu314Pro missense AK9 1 83012 1.20465E-5 41506 0 4.35863E-6
6-109954521-C-T p.Glu313Glu synonymous AK9 8 83002 9.63832E-5 41501 0 7.41756E-5
6-109954521-C-G p.Glu313Asp missense AK9 1 83002 1.20479E-5 41501 0 NA
6-109954523-C-T p.Glu313Lys missense AK9 3 82986 3.61507E-5 41493 0 8.65966E-6
6-109962717-T-C c.933+4A>G splice_region AK9 2 82672 2.4192E-5 41336 0 3.98368E-6
6-109962731-G-C p.Thr308Arg missense AK9 1 82808 1.20761E-5 41404 0 NA
6-109962736-A-T p.Asn306Lys missense AK9 2 82886 2.41295E-5 41443 0 NA
6-109962746-T-C p.Glu303Gly missense AK9 1 82976 1.20517E-5 41488 0 NA
6-109962787-T-C c.-1897A>G 5_prime_UTR_premature_start_codon_gain AK9 6 83020 7.22717E-5 41510 0 8.32196E-6
6-109962788-A-G p.Leu289Pro missense AK9 2 83016 2.40917E-5 41508 0 NA
6-109962806-C-T p.Arg283Gln missense AK9 41 82864 4.94787E-4 41432 0 0.0010846
6-109962807-G-A p.Arg283* stop_gained AK9 9 82852 1.08627E-4 41426 0 5.97334E-5
6-109965695-TTGTTCAAAGATAAATGG-T p.His135fs frameshift AK9 1 70252 1.42345E-5 35126 0 3.1841E-5
6-109965714-G-A p.His135Tyr missense AK9 1 74006 1.35124E-5 37003 0 NA
6-109965717-C-G p.Glu134Gln missense AK9 1 74392 1.34423E-5 37196 0 NA
6-109965730-G-A p.Ser129Ser synonymous AK9 2 76600 2.61097E-5 38300 0 6.36983E-5
6-109965734-C-G p.Arg128Thr missense AK9 2 77434 2.58284E-5 38717 0 1.16158E-5
6-109965741-T-A p.Ile126Leu missense AK9 1 78488 1.27408E-5 39244 0 NA
6-109965753-C-T p.Val122Ile missense AK9 2 80562 2.48256E-5 40281 0 9.29247E-6
6-109965765-T-A p.Ile118Phe missense AK9 1 81464 1.22754E-5 40732 0 8.87091E-6
6-109965782-T-C p.His112Arg missense AK9 5 82122 6.0885E-5 41061 0 8.54876E-6
6-109965787-T-C p.Ser110Ser synonymous AK9 34 82256 4.13344E-4 41128 0 0.00198416
6-109965790-A-G p.Thr109Thr synonymous AK9 1 82332 1.21459E-5 41166 0 NA
6-109965799-G-A p.Ser106Ser synonymous AK9 1 82518 1.21186E-5 41259 0 NA
6-109965801-T-C p.Ser106Gly missense AK9 1 82566 1.21115E-5 41283 0 NA
6-109965807-C-T p.Val104Met missense AK9 2 82684 2.41885E-5 41342 0 8.08166E-6
6-109965820-A-G p.Phe277Phe synonymous AK9 2 82772 2.41628E-5 41386 0 NA
6-109965841-A-G p.Asn270Asn synonymous AK9 2 82850 2.414E-5 41425 0 7.98174E-6
6-109965857-A-G p.Ile265Thr missense AK9 2 82866 2.41354E-5 41433 0 6.3674E-5
6-109965870-G-T p.Pro261Thr missense AK9 1 82838 1.20718E-5 41419 0 NA
6-109965872-T-C p.Asn260Ser missense AK9 1 82830 1.20729E-5 41415 0 8.24865E-6
6-109965891-C-T p.Glu254Lys missense+splice_region AK9 7 82694 8.46494E-5 41347 0 3.5043E-4
6-109977967-T-C p.Thr251Ala missense AK9 7 82742 8.46003E-5 41371 0 3.50318E-4
6-109977976-T-C p.Ile248Val missense AK9 3 82774 3.62433E-5 41387 0 5.05519E-4
6-109977977-T-C p.Thr247Thr synonymous AK9 35 82784 4.22787E-4 41392 0 7.37561E-4
6-109977995-A-T p.Val241Val synonymous AK9 1 82820 1.20744E-5 41410 0 NA
6-109978000-T-C p.Ile240Val missense AK9 1 82830 1.20729E-5 41415 0 NA
6-109978007-A-G p.Val237Val synonymous AK9 1 82812 1.20755E-5 41406 0 8.28391E-6
6-109978012-T-C p.Asn236Asp missense AK9 1 82828 1.20732E-5 41414 0 3.18451E-5
6-109978018-A-C p.Leu234Val missense AK9 1 82820 1.20744E-5 41410 0 7.99271E-6
6-109978036-G-C p.Gln228Glu missense AK9 1 82774 1.20811E-5 41387 0 NA
6-109978044-T-C p.His225Arg missense AK9 2 82760 2.41663E-5 41380 0 NA
6-109978058-A-C p.Ala220Ala synonymous AK9 1 82790 1.20788E-5 41395 0 NA
6-109978076-G-A c.-2122C>T 5_prime_UTR_premature_start_codon_gain AK9 2 82778 2.4161E-5 41389 0 0.00100705
6-109978077-G-A p.Ala214Val missense AK9 1 82772 1.20814E-5 41386 0 NA
6-109980431-CTCT-C p.Glu210del disruptive_inframe_deletion AK9 1 82966 1.20531E-5 41483 0 1.93458E-4
6-109980445-GCTCTTCTTC-G p.Glu203_Glu205del conservative_inframe_deletion AK9 22 83048 2.64907E-4 41524 0 2.13362E-4
6-109980465-T-C p.Glu199Gly missense AK9 3 83118 3.60933E-5 41559 0 NA
6-109980478-C-T p.Gly195Arg missense AK9 10 83120 1.20308E-4 41560 0 0.00375
6-109980479-G-A c.-2182C>T 5_prime_UTR_premature_start_codon_gain AK9 22 83102 2.64735E-4 41551 0 2.50217E-4
6-109980487-G-C p.Gln192Glu missense AK9 14 83150 1.6837E-4 41575 0 6.25E-4
6-109980489-G-C p.Ala191Gly missense AK9 1 83148 1.20267E-5 41574 0 6.38855E-5
6-109980489-G-A p.Ala191Val missense AK9 1 83148 1.20267E-5 41574 0 NA
6-109980495-T-C p.Lys189Arg missense AK9 1 83174 1.2023E-5 41587 0 8.28555E-6
6-109980500-C-A p.Lys187Asn missense AK9 1 83182 1.20218E-5 41591 0 8.28048E-6
6-109980513-T-C p.Asn183Ser missense AK9 1 83172 1.20233E-5 41586 0 1.6518E-5
6-109980517-C-G p.Glu182Gln missense AK9 2 83166 2.40483E-5 41583 0 1.65147E-5
6-109980520-T-C p.Ile181Val missense AK9 1 83170 1.20236E-5 41585 0 NA
6-109980521-G-A p.Val180Val synonymous AK9 1 83176 1.20227E-5 41588 0 NA
6-109980532-C-A p.Asp177Tyr missense AK9 3 83178 3.60672E-5 41589 0 4.29142E-4
6-109980546-C-T p.Ser172Asn missense AK9 1 83158 1.20253E-5 41579 0 8.25082E-6
6-109980549-T-G p.Tyr171Ser missense AK9 1 83164 1.20244E-5 41582 0 NA
6-109980550-A-G p.Tyr171His missense AK9 5 83160 6.01251E-5 41580 0 4.00288E-6
6-109980551-T-C p.Ile170Met missense AK9 3 83156 3.60768E-5 41578 0 1.65011E-5
6-109980557-T-G p.Gly168Gly synonymous AK9 4 83120 4.81232E-5 41560 0 6.36983E-5
6-109980557-T-A p.Gly168Gly synonymous AK9 1 83120 1.20308E-5 41560 0 NA
6-109980560-C-T p.Thr167Thr synonymous AK9 4 83124 4.81209E-5 41562 0 8.25055E-5
6-109980561-G-A p.Thr167Met missense AK9 1 83112 1.2032E-5 41556 0 8.25028E-6
6-109980564-T-C p.Asn166Ser missense AK9 1 83110 1.20322E-5 41555 0 NA
6-109980579-T-C p.Gln161Arg missense AK9 1 83054 1.20404E-5 41527 0 2.00362E-5
6-109980607-A-C p.Tyr152Asp missense AK9 1 82950 1.20555E-5 41475 0 NA
6-109980608-G-A p.Asp151Asp synonymous AK9 2 82946 2.41121E-5 41473 0 3.1839E-5
6-109980622-A-G c.445-6T>C splice_region AK9 1 82734 1.20869E-5 41367 0 8.29229E-6
6-109983765-T-C p.Ile145Val missense AK9 1 76858 1.3011E-5 38429 0 NA
6-109983785-TTTAAG-T p.Asn136fs frameshift AK9 2 78868 2.53588E-5 39434 0 NA
6-109983800-A-C p.Leu133* stop_gained AK9 3 79400 3.77834E-5 39700 0 NA
6-109983801-A-G p.Leu133Leu synonymous AK9 1 79428 1.259E-5 39714 0 3.75927E-5
6-109983811-C-T p.Gln129Gln synonymous AK9 1 79482 1.25815E-5 39741 0 8.39018E-6
6-109983819-T-C p.Thr127Ala missense AK9 1 79444 1.25875E-5 39722 0 8.42659E-6
6-109983823-CA-C p.Met125fs frameshift AK9 2 79344 2.52067E-5 39672 0 4.23811E-6
6-109983848-A-AGTTAAATTCAAGGAATGC p.Ile117delinsSerIleProTerIleTerLeu stop_gained AK9 1 78230 1.27828E-5 39115 0 NA
6-109983871-A-G c.332-5T>C splice_region AK9 1 73394 1.36251E-5 36697 0 NA
6-109993117-C-A c.331+5G>T splice_region AK9 4 82792 4.83138E-5 41396 0 8.3033E-6
6-109993119-T-C c.331+3A>G splice_region AK9 1 82802 1.2077E-5 41401 0 3.18512E-5
6-109993126-G-A p.His109His synonymous AK9 1 82880 1.20656E-5 41440 0 3.18532E-5
6-109993145-T-G p.Asn103Thr missense AK9 2 82962 2.41074E-5 41481 0 2.78718E-5
6-109993158-A-G c.-2469T>C 5_prime_UTR_premature_start_codon_gain AK9 1 83036 1.2043E-5 41518 0 NA
6-109993164-G-C p.Leu97Val missense AK9 2 83036 2.40859E-5 41518 0 1.35351E-4
6-109993166-T-C p.Lys96Arg missense AK9 1 83038 1.20427E-5 41519 0 7.9614E-6
6-109993170-T-A p.Ile95Leu missense AK9 1235 83018 0.0148763 41509 53 0.0355437
6-109993198-G-A p.Ser85Ser synonymous AK9 10 83036 1.2043E-4 41518 0 4.95188E-5
6-109993200-T-C p.Ser85Gly missense AK9 82 83040 9.87476E-4 41520 0 0.00181471
6-109993213-T-G p.Gln80His missense AK9 4 83016 4.81835E-5 41508 0 3.1839E-5
6-109993218-ACTAAGGACAAGCATAGATATTGTACATTACTGTATAATATATCTATGATACAGAGCTTTTTTTGTAATCATAGTTACTTTGAAATTTAGGTTTGTTTAC-A c.234+1_235-1delGTAAACAAACCTAAATTTCAAAGTAACTATGATTACAAAAAAAGCTCTGTATCATAGATATATTATACAGTAATGTACAATATCTATGCTTGTCCTTAG splice_acceptor AK9 2 82998 2.4097E-5 41499 1 NA
6-109993312-G-GT c.234+5_234+6insA splice_region AK9 8 82868 9.65391E-5 41434 0 4.79846E-5
6-109993319-A-G p.Met1? start_lost AK9 1 82914 1.20607E-5 41457 0 NA
6-109993320-T-C p.Met1? start_lost AK9 1 82912 1.2061E-5 41456 0 6.37064E-5
6-109993332-C-T p.Glu74Lys missense AK9 1 82892 1.20639E-5 41446 0 1.59266E-4
6-109993333-G-A c.-2545C>T 5_prime_UTR_premature_start_codon_gain AK9 2 82890 2.41284E-5 41445 0 0.00100908
6-109993350-G-T p.Gln68Lys missense AK9 2 82832 2.41453E-5 41416 0 NA
6-109993363-T-G p.Pro63Pro synonymous AK9 1 82768 1.2082E-5 41384 0 4.03151E-6
6-109993368-A-C p.Leu62Val missense+splice_region AK9 1 82740 1.20861E-5 41370 0 NA
6-109993369-A-C p.Ala61Ala splice_region+synonymous AK9 2 82742 2.41715E-5 41371 0 NA
6-109993370-GC-G c.182-1delG splice_acceptor AK9 2 82720 2.41779E-5 41360 0 NA
6-109993373-A-T c.182-3T>A splice_region AK9 2 82642 2.42008E-5 41321 0 NA
6-109995397-T-G c.181+4A>C splice_region AK9 2 80738 2.47715E-5 40369 0 NA
6-109995407-C-T p.Val59Ile missense AK9 2 81156 2.46439E-5 40578 0 8.80685E-6
6-109995409-C-T