Variant

Variant ID Consequence Effect Gene AC AN AF NS NHOM maxEAF
1-77747738-G-T c.-261G>T 5_prime_UTR_premature_start_codon_gain AK5 2135 20172 0.10584 10086 12 0.115004
1-77747832-G-T c.-167G>T 5_prime_UTR_premature_start_codon_gain AK5 12 57798 2.0762E-4 28899 0 NA
1-77747876-G-A c.-123G>A 5_prime_UTR_premature_start_codon_gain AK5 30 71980 4.16782E-4 35990 0 0.00252845
1-77747886-G-T c.-113G>T 5_prime_UTR_premature_start_codon_gain AK5 1 74848 1.33604E-5 37424 0 NA
1-77747913-C-G c.-86C>G 5_prime_UTR_premature_start_codon_gain AK5 1 77086 1.29725E-5 38543 0 NA
1-77747935-C-T c.-64C>T 5_prime_UTR_premature_start_codon_gain AK5 3 77780 3.85703E-5 38890 0 NA
1-77747970-T-C c.-29T>C 5_prime_UTR_premature_start_codon_gain AK5 1 78270 1.27763E-5 39135 0 NA
1-77748002-A-G p.Asn2Asp missense AK5 1 78414 1.27528E-5 39207 0 5.93099E-6
1-77748004-C-T p.Asn2Asn synonymous AK5 6 78430 7.65013E-5 39215 0 6.25E-4
1-77748006-C-T p.Thr3Ile missense AK5 4 78426 5.10035E-5 39213 0 8.9222E-5
1-77748006-C-A p.Thr3Asn missense AK5 2 78426 2.55017E-5 39213 0 NA
1-77748008-A-G p.Asn4Asp missense AK5 1 78424 1.27512E-5 39212 0 NA
1-77748037-G-A p.Arg13Arg synonymous AK5 4 78482 5.09671E-5 39241 0 NA
1-77748058-G-GAGCCTTTTGAATGGACTGATGTGTTCTAAGCCCGAAGATCCA n.316_316+1insAGCCTTTTGAATGGACTGATGTGTTCTAAGCCCGAAGATCCA splice_donor AK5 2 78410 2.55069E-5 39205 1 NA
1-77748325-C-G c.-988C>G 5_prime_UTR_premature_start_codon_gain AK5 1 37938 2.63588E-5 18969 0 NA
1-77748334-C-T c.-979C>T 5_prime_UTR_premature_start_codon_gain AK5 4 36018 1.11056E-4 18009 0 NA
1-77748480-C-T c.-833C>T 5_prime_UTR_premature_start_codon_gain AK5 2 27398 7.2998E-5 13699 0 NA
1-77748666-C-T c.-647C>T 5_prime_UTR_premature_start_codon_gain AK5 1 27218 3.67404E-5 13609 0 NA
1-77748691-A-T c.-622A>T 5_prime_UTR_premature_start_codon_gain AK5 1 27214 3.67458E-5 13607 0 NA
1-77748707-C-G c.-606C>G 5_prime_UTR_premature_start_codon_gain AK5 2 27224 7.34646E-5 13612 0 6.37024E-5
1-77748762-C-G c.-551C>G 5_prime_UTR_premature_start_codon_gain AK5 1 27220 3.67377E-5 13610 0 NA
1-77748772-A-T c.-541A>T 5_prime_UTR_premature_start_codon_gain AK5 10 27218 3.67404E-4 13609 0 6.05751E-4
1-77748783-C-T c.-530C>T 5_prime_UTR_premature_start_codon_gain AK5 3 27208 1.10262E-4 13604 0 6.37755E-5
1-77748799-C-T c.-514C>T 5_prime_UTR_premature_start_codon_gain AK5 1 27208 3.67539E-5 13604 0 NA
1-77748866-T-G c.-21T>G splice_region AK5 1 27198 3.67674E-5 13599 0 NA
1-77749118-T-G c.-195T>G 5_prime_UTR_premature_start_codon_gain AK5 1 27196 3.67701E-5 13598 0 NA
1-77749125-C-T c.-188C>T 5_prime_UTR_premature_start_codon_gain AK5 1 27196 3.67701E-5 13598 0 NA
1-77749131-G-T c.-182G>T 5_prime_UTR_premature_start_codon_gain AK5 2 27198 7.35348E-5 13599 0 1.27437E-4
1-77749242-T-G c.-71T>G 5_prime_UTR_premature_start_codon_gain AK5 1 27156 3.68243E-5 13578 0 NA
1-77752622-T-C n.317-4T>C splice_region AK5 1892 77764 0.02433 38882 36 0.0417193
1-77752658-C-T p.Pro5Pro synonymous AK5 5 82848 6.03515E-5 41424 0 4.15324E-6
1-77752659-G-A p.Glu6Lys missense AK5 3 82842 3.62135E-5 41421 0 3.32168E-5
1-77752673-A-G p.Glu10Glu synonymous AK5 3 83106 3.60985E-5 41553 0 8.25914E-6
1-77752680-G-A p.Glu13Lys missense AK5 2 83188 2.40419E-5 41594 0 NA
1-77752689-T-C p.Leu16Leu synonymous AK5 2 83232 2.40292E-5 41616 0 NA
1-77752731-T-C p.Trp30Arg missense AK5 1 83250 1.2012E-5 41625 0 8.23968E-6
1-77752749-C-G p.Gln36Glu missense AK5 1 83214 1.20172E-5 41607 0 NA
1-77752751-G-A p.Gln36Gln synonymous AK5 2 83218 2.40333E-5 41609 0 NA
1-77752754-A-G p.Glu37Glu synonymous AK5 1 83210 1.20178E-5 41605 0 4.03232E-6
1-77752758-A-G p.Lys39Glu missense AK5 1 83210 1.20178E-5 41605 0 NA
1-77752797-T-G p.Ser52Ala missense AK5 9 82594 1.08967E-4 41297 1 8.44053E-6
1-77752799-C-G p.Ser52Ser synonymous AK5 2 81972 2.43986E-5 40986 0 2.31894E-5
1-77752811-TG-T p.Leu54fs frameshift AK5 8 81700 9.79192E-5 40850 4 NA
1-77752816-A-G n.503+4A>G splice_region AK5 1 81564 1.22603E-5 40782 0 NA
1-77759473-T-C c.170-5T>C splice_region AK5 3 83214 3.60516E-5 41607 0 NA
1-77759507-C-T p.Arg67Trp missense AK5 2 83260 2.40211E-5 41630 0 8.26091E-6
1-77759509-G-A p.Arg67Arg synonymous AK5 3 83264 3.603E-5 41632 0 1.27437E-4
1-77759519-C-T p.Arg71Trp missense AK5 7 83280 8.40538E-5 41640 0 1.20764E-5
1-77759535-A-G p.His76Arg missense AK5 1 83276 1.20083E-5 41638 0 NA
1-77759539-A-G p.Gln77Gln synonymous AK5 15 83284 1.80107E-4 41642 0 0.00100705
1-77759547-T-C p.Ile80Thr missense AK5 1 83272 1.20088E-5 41636 0 NA
1-77759551-A-G n.505A>G splice_region AK5 1 83276 1.20083E-5 41638 0 8.25396E-6
1-77759559-C-T p.Thr84Met missense AK5 1 83270 1.20091E-5 41635 0 NA
1-77759560-G-A p.Thr84Thr synonymous AK5 1 83274 1.20085E-5 41637 0 9.07995E-5
1-77759575-T-C p.Thr89Thr synonymous AK5 12 83246 1.44151E-4 41623 0 2.86606E-4
1-77759578-A-G p.Ala90Ala synonymous AK5 13409 83042 0.161473 41521 1189 0.175284
1-77759578-A-C p.Ala90Ala synonymous AK5 4 83264 4.804E-5 41632 0 3.18756E-5
1-77759586-T-C p.Ile93Thr missense AK5 1 83246 1.20126E-5 41623 0 3.18552E-5
1-77759590-G-A p.Glu94Glu synonymous AK5 3 83232 3.60438E-5 41616 0 5.03525E-4
1-77759596-T-G p.Tyr96* stop_gained AK5 1 83208 1.20181E-5 41604 0 NA
1-77759599-G-A p.Glu97Glu synonymous AK5 2 83206 2.40367E-5 41603 0 9.5584E-5
1-77759607-A-T p.Asp100Val missense AK5 1 83198 1.20195E-5 41599 0 8.26583E-6
1-77759613-C-A p.Thr102Asn missense AK5 2 83184 2.40431E-5 41592 0 1.65437E-5
1-77759618-C-T p.Pro104Ser missense AK5 1 83160 1.2025E-5 41580 0 NA
1-77759622-G-A p.Arg105Gln missense AK5 2 83110 2.40645E-5 41555 0 3.19142E-5
1-77763240-C-T n.600-4C>T splice_region AK5 12 83110 1.44387E-4 41555 0 4.45945E-4
1-77763276-T-A p.Leu124Met missense AK5 1 83238 1.20137E-5 41619 0 8.40548E-6
1-77763292-G-A p.Arg129Gln missense AK5 2 83230 2.40298E-5 41615 0 9.55779E-5
1-77763293-A-G p.Arg129Arg synonymous AK5 110 83234 0.00132158 41617 2 0.00208029
1-77763309-A-G p.Ile135Val missense AK5 1 83230 1.20149E-5 41615 0 3.30273E-5
1-77763311-T-A p.Ile135Ile synonymous AK5 3 83224 3.60473E-5 41612 0 6.77113E-5
1-77763340-T-C p.Ile145Thr missense AK5 1 83190 1.20207E-5 41595 0 3.98441E-6
1-77763380-C-G p.Ala158Ala synonymous AK5 1 83160 1.2025E-5 41580 0 NA
1-77763397-G-A p.Gly164Glu missense AK5 2 83160 2.405E-5 41580 0 NA
1-77763411-CAGGTACTGCTGTATAATTATCTTTTATTCTGCAAAATGTTTTCATACCGATTGAGTATACTAAGTTTAACTGTGGGGTTTTTTTGTCATCCTTTCTGTTTATAAA-C p.Gln169fs frameshift AK5 9 83144 1.08246E-4 41572 4 NA
1-77763522-A-T p.Thr171Ser missense AK5 1 83014 1.20462E-5 41507 0 4.05032E-6
1-77763527-A-G p.Thr172Thr synonymous AK5 865 82966 0.010426 41483 10 0.0110887
1-77763542-G-A p.Lys177Lys synonymous AK5 81720 82220 0.993919 41110 40623 1.0
1-77763544-A-AGGC p.Gln178_Lys179insAla disruptive_inframe_insertion AK5 1 82950 1.20555E-5 41475 0 NA
1-77763560-A-C p.Ile183Ile synonymous AK5 1 82934 1.20578E-5 41467 0 6.38508E-5
1-77763560-A-G p.Ile183Met missense AK5 1 82934 1.20578E-5 41467 0 3.99068E-6
1-77763562-C-T p.Pro184Leu missense AK5 1 82916 1.20604E-5 41458 0 NA
1-77763590-A-T p.Gly193Gly synonymous AK5 2 82776 2.41616E-5 41388 0 NA
1-77763596-A-G p.Pro195Pro synonymous AK5 1 82724 1.20884E-5 41362 0 6.37105E-5
1-77763615-C-G p.Leu202Val missense AK5 2 82466 2.42524E-5 41233 0 NA
1-77763632-A-G p.Gln207Gln splice_region+synonymous AK5 2 82040 2.43784E-5 41020 0 3.1841E-5
1-77763708-T-G n.528T>G splice_region AK5 3 68354 4.38892E-5 34177 0 1.27462E-4
1-77806066-G-C p.Cys209Ser missense AK5 1 82816 1.2075E-5 41408 0 NA
1-77806070-C-A p.Thr210Thr synonymous AK5 4 82848 4.82812E-5 41424 0 NA
1-77806110-C-G p.Leu224Val missense AK5 1 83066 1.20386E-5 41533 0 NA
1-77806116-G-C p.Glu226Gln missense AK5 1 83102 1.20334E-5 41551 0 NA
1-77806132-G-C p.Arg231Pro missense AK5 1 83114 1.20317E-5 41557 0 NA
1-77806140-C-G p.Gln234Glu missense AK5 2 83138 2.40564E-5 41569 0 NA
1-77806150-G-A p.Arg237Gln missense AK5 1 83142 1.20276E-5 41571 0 1.64834E-5
1-77806169-A-G p.Lys243Lys synonymous AK5 1 83146 1.2027E-5 41573 0 NA
1-77806176-C-G p.Gln246Glu missense AK5 1 83146 1.2027E-5 41573 0 NA
1-77806187-A-G p.Leu249Leu synonymous AK5 1 83132 1.20291E-5 41566 0 8.24402E-6
1-77806219-T-C p.Val260Ala missense AK5 1 83078 1.20369E-5 41539 0 NA
1-77806226-C-T p.Tyr262Tyr synonymous AK5 1 83040 1.20424E-5 41520 0 8.25232E-6
1-77806239-G-A p.Gly267Arg missense AK5 1 82930 1.20584E-5 41465 0 NA
1-77806244-C-T p.Leu268Leu synonymous AK5 5 82868 6.03369E-5 41434 0 3.98956E-6
1-77806245-A-G p.Ile269Val missense AK5 1 82862 1.20683E-5 41431 0 4.96862E-5
1-77806248-A-G p.Met270Val missense AK5 1 82856 1.20691E-5 41428 0 9.11562E-5
1-77806253-A-ATTT c.813_813+1insTTT splice_donor AK5 2 82802 2.4154E-5 41401 1 NA
1-77806253-A-ATTTGATGCCGACCGCGATGAGGATGAG c.813_813+1insTTTGATGCCGACCGCGATGAGGATGAG splice_donor AK5 1 82800 1.20773E-5 41400 0 NA
1-77806253-A-ATTTGATGCCGACCGCGATGAG c.813_813+1insTTTGATGCCGACCGCGATGAG splice_donor AK5 1 82802 1.2077E-5 41401 0 NA
1-77876674-C-T p.Ala274Ala synonymous AK5 7 82902 8.4437E-5 41451 0 1.27429E-4
1-77876679-G-A p.Arg276His missense AK5 1 82932 1.20581E-5 41466 0 NA
1-77876680-C-T p.Arg276Arg synonymous AK5 1 82942 1.20566E-5 41471 0 3.1839E-5
1-77876681-G-A p.Asp277Asn missense AK5 1 82954 1.20549E-5 41477 0 6.36862E-5
1-77876686-G-A p.Glu278Glu synonymous AK5 2 82994 2.40981E-5 41497 0 6.25E-4
1-77876692-G-A p.Glu280Glu synonymous AK5 2 83000 2.40964E-5 41500 0 NA
1-77876695-G-A p.Val281Val synonymous AK5 6 82988 7.22996E-5 41494 0 3.10836E-4
1-77876700-A-G p.Tyr283Cys missense AK5 1 82970 1.20525E-5 41485 0 7.96946E-6
1-77876717-G-C p.Val289Leu missense AK5 1 82890 1.20642E-5 41445 0 NA
1-77876731-A-T p.Leu293Phe missense AK5 2 82782 2.41598E-5 41391 0 NA
1-77876739-A-G p.Asn296Ser missense AK5 2 82706 2.4182E-5 41353 0 1.9974E-5
1-77876752-A-G p.Ala300Ala synonymous AK5 3 82506 3.6361E-5 41253 0 2.38646E-4
1-77883345-C-T p.Ser309Leu missense AK5 6 81706 7.3434E-5 40853 0 2.23044E-4
1-77883346-G-A p.Ser309Ser synonymous AK5 1 81722 1.22366E-5 40861 0 6.36983E-5
1-77883346-G-C p.Ser309Ser synonymous AK5 1 81722 1.22366E-5 40861 0 NA
1-77883353-T-C p.Leu312Leu synonymous AK5 2 81724 2.44726E-5 40862 0 1.27356E-4
1-77883372-T-C p.Ile318Thr missense AK5 1 81678 1.22432E-5 40839 0 1.6665E-5
1-77883386-G-C p.Asp323His missense AK5 2 81414 2.45658E-5 40707 0 8.38181E-6
1-77948997-A-G c.982-5A>G splice_region AK5 1 55370 1.80603E-5 27685 0 9.89169E-5
1-77949003-G-T p.Gly328Val missense+splice_region AK5 4 82054 4.87484E-5 41027 0 6.37146E-5
1-77949012-A-G p.Gln331Arg missense AK5 2 82204 2.43297E-5 41102 0 1.64799E-5
1-77949021-T-C p.Val334Ala missense AK5 3 82242 3.64777E-5 41121 0 1.2332E-4
1-77949024-T-C p.Phe335Ser missense AK5 3 82256 3.64715E-5 41128 0 1.64777E-5
1-77949030-AGGACACTATGGGAG-A p.Asp338fs frameshift AK5 1 82258 1.21569E-5 41129 0 NA
1-77951998-A-G p.Met344Val missense AK5 1 82398 1.21362E-5 41199 0 4.03561E-6
1-77952025-A-G p.Ile353Val missense AK5 1 82392 1.21371E-5 41196 0 4.05344E-6
1-77952028-T-A p.Phe354Ile missense AK5 1 82330 1.21462E-5 41165 0 9.60061E-6
1-77984245-C-A c.1070-4C>A splice_region AK5 1 82770 1.20817E-5 41385 0 NA
1-77984259-C-T p.Gly360Gly synonymous AK5 1 82986 1.20502E-5 41493 0 8.29284E-6
1-77984310-A-G p.Thr377Thr synonymous AK5 1 83184 1.20215E-5 41592 0 7.95672E-6
1-77984325-C-T p.Gly382Gly synonymous AK5 1 83206 1.20184E-5 41603 0 3.18492E-5
1-77984326-G-A p.Glu383Lys missense AK5 2 83214 2.40344E-5 41607 0 5.03525E-4
1-77984335-C-T p.Arg386Cys missense AK5 2 83214 2.40344E-5 41607 0 8.24035E-6
1-77984336-G-A p.Arg386His missense AK5 2 83226 2.4031E-5 41613 0 7.4162E-5
1-77984340-G-A p.Glu387Glu synonymous AK5 4 83238 4.8055E-5 41619 0 9.94558E-5
1-77984346-GG-AT p.LeuAla389LeuSer missense AK5 25 83240 3.00336E-4 41620 0 NA
1-77984349-A-G p.Ala390Ala synonymous AK5 1 83254 1.20114E-5 41627 0 NA
1-77984360-A-G p.Glu394Gly missense AK5 3 83246 3.60378E-5 41623 0 2.47211E-5
1-77984379-A-G p.Arg400Arg synonymous AK5 3 83280 3.60231E-5 41640 0 6.36699E-5
1-77984387-T-C p.Met403Thr missense AK5 3 83284 3.60213E-5 41642 0 1.59119E-5
1-77984392-C-T p.Arg405Cys missense AK5 1 83276 1.20083E-5 41638 0 8.25382E-6
1-77984393-G-A p.Arg405His missense AK5 3 83278 3.60239E-5 41639 0 8.25627E-6
1-77984400-C-A p.Asp407Glu missense AK5 1 83272 1.20088E-5 41636 0 NA
1-77984413-G-GGCATCGTTTTGGAGCTCCTGAAGGAGGCCA c.1233+1_1233+2insGCATCGTTTTGGAGCTCCTGAAGGAGGCCA splice_donor AK5 2 83242 2.40263E-5 41621 1 NA
1-77984419-A-G c.1233+7A>G splice_region AK5 8 83198 9.61562E-5 41599 0 0.00192423
1-77987508-C-T c.1234-4C>T splice_region AK5 36 83158 4.32911E-4 41579 0 2.86825E-4
1-77987509-C-T c.1234-3C>T splice_region AK5 1 83162 1.20247E-5 41581 0 NA
1-77987512-G-A p.Gly412Ser missense+splice_region AK5 1 83188 1.2021E-5 41594 0 NA
1-77987514-C-T p.Gly412Gly splice_region+synonymous AK5 2 83168 2.40477E-5 41584 0 5.78627E-5
1-77987515-A-G p.Ile413Val missense AK5 1 83178 1.20224E-5 41589 0 NA
1-77987556-C-T p.Leu426Leu synonymous AK5 4 83322 4.80065E-5 41661 0 5.04032E-4
1-77987557-G-A p.Gly427Arg missense AK5 13 83316 1.56032E-4 41658 0 1.59317E-4
1-77987560-G-T p.Asp428Tyr missense AK5 2 83322 2.40033E-5 41661 0 NA
1-77987566-A-G p.Arg430Gly missense AK5 1 83338 1.19993E-5 41669 0 NA
1-77987568-G-A p.Arg430Arg synonymous AK5 1 83338 1.19993E-5 41669 0 1.19607E-5
1-77987583-C-T p.Asp435Asp synonymous AK5 2 83336 2.39992E-5 41668 0 3.59459E-5
1-77987584-G-A p.Gly436Ser missense AK5 7 83336 8.39973E-5 41668 0 1.19757E-5
1-77987593-C-T p.Arg439Trp missense AK5 1 83350 1.19976E-5 41675 0 2.79913E-5
1-77987594-G-A p.Arg439Gln missense AK5 364 83340 0.00436765 41670 3 0.00787176
1-77987603-A-T p.Lys442Met missense AK5 1 83340 1.1999E-5 41670 0 NA
1-77987614-G-C p.Glu446Gln missense AK5 1 83328 1.20008E-5 41664 0 3.18451E-5
1-77987619-C-T p.Phe447Phe synonymous AK5 1 83324 1.20013E-5 41662 0 2.43392E-5
1-77987620-G-A p.Gly448Arg missense AK5 7 83316 8.40175E-5 41658 0 1.22627E-4
1-77987622-A-T p.Gly448Gly synonymous AK5 1 83308 1.20036E-5 41654 0 8.49849E-6
1-77987623-C-T p.Arg449Cys missense AK5 1 83292 1.2006E-5 41646 0 5.74058E-5
1-77987627-G-A p.Arg450Lys missense+splice_region AK5 2 83278 2.40159E-5 41639 0 4.20943E-6
1-77987627-G-GGATTGGAGACCCACAGTT p.Phe432delinsLeuLeuGluThrHisSerCys disruptive_inframe_insertion AK5 2 83278 2.40159E-5 41639 1 NA
1-77987628-G-GATT c.1350_1350+1insATT splice_donor AK5 2 83278 2.40159E-5 41639 1 NA
1-77987635-G-T c.1350+7G>T splice_region AK5 1 83210 1.20178E-5 41605 0 1.79211E-5
1-77987636-G-A c.1350+8G>A splice_region AK5 3 83188 3.60629E-5 41594 0 1.34664E-5
1-78001538-G-T p.Asp453Tyr missense AK5 1 82904 1.20621E-5 41452 0 NA
1-78001570-G-A n.666G>A splice_region AK5 34 83116 4.09067E-4 41558 0 2.19155E-4
1-78001570-G-T n.666G>T splice_region AK5 23 83118 2.76715E-4 41559 0 1.25945E-4
1-78001579-C-A p.Thr466Thr synonymous AK5 3 83192 3.60612E-5 41596 0 1.99095E-5
1-78001585-C-G p.Thr468Thr synonymous AK5 50 83198 6.00976E-4 41599 0 0.004375
1-78001589-C-T p.Arg470Cys missense AK5 1 83232 1.20146E-5 41616 0 4.99883E-5
1-78001590-G-A p.Arg470His missense AK5 1 83242 1.20132E-5 41621 0 8.33167E-6
1-78001606-C-G p.Ser475Arg missense AK5 1 83282 1.20074E-5 41641 0 3.97947E-6
1-78001607-C-A p.Arg476Arg synonymous AK5 1 83282 1.20074E-5 41641 0 NA
1-78001607-C-T p.Arg476Trp missense AK5 3 83282 3.60222E-5 41641 0 3.19509E-5
1-78001613-A-C p.Ser478Arg missense AK5 6 83308 7.20219E-5 41654 0 NA
1-78001621-T-A p.Leu50Gln missense AK5 3 83326 3.60032E-5 41663 0 2.48135E-5
1-78001627-C-T p.Thr52Met missense AK5 7 83332 8.40013E-5 41666 0 1.91351E-4
1-78001627-C-A p.Asp482Glu missense AK5 1 83332 1.20002E-5 41666 0 NA
1-78001628-G-A p.Asp483Asn missense AK5 2 83318 2.40044E-5 41659 0 8.26583E-6
1-78001634-A-G p.Thr485Ala missense AK5 14 83314 1.68039E-4 41657 0 6.25E-4
1-78001642-C-G p.Pro57Arg missense AK5 18 83332 2.16003E-4 41666 0 4.77316E-5
1-78001646-G-A p.Ala489Thr missense AK5 2 83326 2.40021E-5 41663 0 1.07438E-4
1-78001648-C-T p.Pro59Leu missense AK5 2 83336 2.39992E-5 41668 0 1.19322E-5
1-78001652-C-T p.Arg491Cys missense AK5 3 83320 3.60058E-5 41660 0 4.77342E-5
1-78001653-G-A p.Arg491His missense AK5 1 83318 1.20022E-5 41659 0 6.25E-4
1-78001657-A-G p.Ter62Trpext*? stop_lost AK5 5 83332 6.0001E-5 41666 0 3.18203E-5
1-78001670-C-A p.Arg497Arg synonymous AK5 1 83312 1.20031E-5 41656 0 2.48233E-5
1-78001671-G-A p.Arg497Gln missense AK5 1 83306 1.20039E-5 41653 0 8.27499E-6
1-78001675-G-A p.Ala498Ala synonymous AK5 32 83298 3.84163E-4 41649 0 7.0373E-4
1-78001683-C-T p.Pro501Leu missense AK5 1 83276 1.20083E-5 41638 0 NA
1-78001684-C-T p.Pro501Pro synonymous AK5 2 83274 2.40171E-5 41637 0 3.19122E-5
1-78001693-C-T p.Ala504Ala synonymous AK5 1 83218 1.20166E-5 41609 0 3.19203E-5
1-78001698-A-T p.Tyr506Phe missense AK5 1 83188 1.2021E-5 41594 0 NA
1-78001699-C-T p.Tyr506Tyr synonymous AK5 1 83170 1.20236E-5 41585 0 6.40369E-5
1-78001723-G-GATAAATGCAGAGGGAACACCAGAGGACGTTTTTCTTCAACTCT c.1542_1542+1insATAAATGCAGAGGGAACACCAGAGGACGTTTTTCTTCAACTCT splice_donor AK5 3 82650 3.62976E-5 41325 1 NA
1-78001723-G-GATAAATGCAGAGGGAACACCAGAGGACGTTTTTCTTCAACTCTGCACA c.1542_1542+1insATAAATGCAGAGGGAACACCAGAGGACGTTTTTCTTCAACTCTGCACA splice_donor AK5 1 82652 1.20989E-5 41326 0 NA
1-78001726-G-A c.1542+3G>A splice_region AK5 4 82480 4.84966E-5 41240 0 3.20486E-4
1-78001728-G-A c.1542+5G>A splice_region AK5 1 82378 1.21392E-5 41189 0 3.24992E-5
1-78024284-T-C c.1543-3T>C splice_region AK5 54708 76894 0.711473 38447 19749 0.750975
1-78024298-G-T p.Glu518Asp missense AK5 1 81450 1.22775E-5 40725 0 NA
1-78024313-C-T p.Asp523Asp synonymous AK5 18 81716 2.20275E-4 40858 0 5.18303E-4
1-78024333-C-G p.Thr530Arg missense AK5 1 81864 1.22154E-5 40932 0 NA
1-78024338-A-G p.Ile532Val missense AK5 1 81812 1.22231E-5 40906 0 NA
1-78024344-T-G p.Ser534Ala missense AK5 1 81798 1.22252E-5 40899 0 1.7646E-5
1-78024345-C-CTAT p.Ile535dup conservative_inframe_insertion AK5 55609 81302 0.683981 40651 19649 0.722575
1-78024345-C-CCAT p.Ser534_Ile535insIle disruptive_inframe_insertion AK5 4 81794 4.89033E-5 40897 0 1.60521E-5
1-78024345-C-CTATTAAT p.Phe536fs frameshift AK5 1 81794 1.22258E-5 40897 0 NA
1-78024347-A-ATTT p.Phe536dup disruptive_inframe_insertion AK5 1 81862 1.22157E-5 40931 0 NA
1-78024414-TAAC-T n.324_*2delACA splice_region AK5 1 78342 1.27645E-5 39171 0 NA
1-78024421-A-G n.221A>G splice_region AK5 3 77486 3.87167E-5 38743 0 3.18471E-5
1-78025651-A-G c.*1296A>G splice_region AK5 88 44152 0.00199311 22076 0 0.00162576