Variant

Variant ID Consequence Effect Gene AC AN AF NS NHOM maxEAF
21-45705804-C-T c.-86C>T 5_prime_UTR_premature_start_codon_gain AIRE 2 38906 5.1406E-5 19453 0 2.5641E-4
21-45705837-G-C c.-53G>C 5_prime_UTR_premature_start_codon_gain AIRE 1 42060 2.37756E-5 21030 0 NA
21-45705890-A-T p.Met1? initiator_codon AIRE 1 51394 1.94575E-5 25697 0 NA
21-45705899-G-A p.Asp4Asn missense AIRE 1 54044 1.85034E-5 27022 0 7.6929E-6
21-45705899-G-T p.Asp4Tyr missense AIRE 1 54044 1.85034E-5 27022 0 NA
21-45705901-C-T p.Asp4Asp synonymous AIRE 5 54430 9.18611E-5 27215 0 NA
21-45705901-C-A p.Asp4Glu missense AIRE 2 54432 3.67431E-5 27216 0 NA
21-45705908-C-G p.Leu7Val missense AIRE 1 57026 1.75359E-5 28513 0 NA
21-45705919-T-C p.Leu10Leu synonymous AIRE 1 60262 1.65942E-5 30131 0 NA
21-45705931-C-T p.His14His synonymous AIRE 1 62444 1.60143E-5 31222 0 NA
21-45705936-C-T p.Thr16Met missense AIRE 2 63280 3.16056E-5 31640 0 NA
21-45705937-G-C p.Thr16Thr synonymous AIRE 1 63476 1.5754E-5 31738 0 NA
21-45705951-C-T p.Ala21Val missense AIRE 1 65114 1.53577E-5 32557 0 NA
21-45705951-CCGTGGA-C p.Val22_Asp23del conservative_inframe_deletion AIRE 1 65114 1.53577E-5 32557 0 NA
21-45705952-C-T p.Ala21Ala synonymous AIRE 143 65306 0.00218969 32653 1 0.00629723
21-45705952-C-A p.Ala21Ala synonymous AIRE 1 65314 1.53107E-5 32657 0 NA
21-45705955-G-T p.Val22Val synonymous AIRE 1 65840 1.51883E-5 32920 0 1.4379E-5
21-45705956-G-A p.Asp23Asn missense AIRE 1 65940 1.51653E-5 32970 0 3.19326E-5
21-45705962-G-C p.Ala25Pro missense AIRE 3 66134 4.53624E-5 33067 0 6.38488E-5
21-45705972-T-C p.Leu28Pro missense AIRE 2 66798 2.9941E-5 33399 0 7.80884E-5
21-45705979-C-A p.His30Gln missense AIRE 1 66938 1.49392E-5 33469 0 7.07734E-6
21-45705986-G-A p.Ala33Thr missense AIRE 2 66366 3.01359E-5 33183 0 NA
21-45705988-T-C p.Ala33Ala synonymous AIRE 6229 65704 0.094804 32852 1035 0.171027
21-45705988-TG-CA p.AlaAsp33AlaAsn missense AIRE 2 66344 3.01459E-5 33172 0 NA
21-45706006-C-G p.Pro39Pro synonymous AIRE 2 64442 3.10357E-5 32221 0 3.19407E-5
21-45706009-G-T p.Glu40Asp missense AIRE 1 63984 1.56289E-5 31992 0 NA
21-45706011-A-G p.Asp41Gly missense AIRE 1 63620 1.57183E-5 31810 0 NA
21-45706022-G-C c.132+1G>C splice_donor AIRE 2 61934 3.22924E-5 30967 0 7.10268E-6
21-45706023-TG-T c.132+3delG splice_region AIRE 2 61612 3.24612E-5 30806 0 7.12362E-6
21-45706028-T-TCCC c.132+7_132+8insCCC splice_region AIRE 2 59656 3.35255E-5 29828 0 NA
21-45706432-C-T c.133-8C>T splice_region AIRE 1 80692 1.23928E-5 40346 0 8.61074E-6
21-45706444-C-T p.Thr46Met missense AIRE 5 81364 6.14522E-5 40682 0 0.00100908
21-45706445-G-A p.Thr46Thr synonymous AIRE 1 81482 1.22726E-5 40741 0 5.04541E-4
21-45706463-G-A p.Lys52Lys synonymous AIRE 3 82226 3.64848E-5 41113 0 6.39795E-5
21-45706466-G-A p.Glu53Glu synonymous AIRE 1 82244 1.21589E-5 41122 0 NA
21-45706469-C-T p.Gly54Gly synonymous AIRE 1 82224 1.21619E-5 41112 0 NA
21-45706473-C-T p.Pro56Ser missense AIRE 1 82372 1.214E-5 41186 0 2.09658E-4
21-45706476-C-G p.Gln57Glu missense AIRE 5 82454 6.06399E-5 41227 0 2.54891E-4
21-45706487-C-T p.His60His synonymous AIRE 1 82570 1.21109E-5 41285 0 2.23044E-4
21-45706491-C-T p.Leu62Phe missense AIRE 1 82622 1.21033E-5 41311 0 3.99192E-6
21-45706498-C-T p.Ser64Phe missense AIRE 1 82666 1.20969E-5 41333 0 NA
21-45706533-G-A p.Asp76Asn missense AIRE 5 82840 6.03573E-5 41420 0 2.86697E-4
21-45706539-T-C p.Trp78Arg missense AIRE 2 82844 2.41418E-5 41422 0 8.31961E-6
21-45706543-G-C p.Arg79Thr missense AIRE 1 82856 1.20691E-5 41428 0 NA
21-45706561-A-G p.Tyr85Cys missense AIRE 2 82828 2.41464E-5 41414 0 3.98492E-6
21-45706564-A-G p.Asn86Ser missense AIRE 1 82806 1.20764E-5 41403 0 1.66373E-5
21-45706572-C-T p.Arg89Cys missense AIRE 1 82752 1.20843E-5 41376 0 3.18674E-5
21-45706573-G-C p.Arg89Pro missense AIRE 1 82758 1.20834E-5 41379 0 8.32681E-6
21-45706573-G-A p.Arg89His missense AIRE 2 82758 2.41668E-5 41379 0 3.98702E-6
21-45706581-C-T p.Arg92Trp missense AIRE 1 82718 1.20893E-5 41359 0 NA
21-45706582-G-A p.Arg92Gln missense AIRE 1 82704 1.20913E-5 41352 0 NA
21-45706583-G-A p.Arg92Arg synonymous AIRE 2 82682 2.41891E-5 41341 0 5.03525E-4
21-45706585-T-G p.Leu93Arg missense AIRE 1 82680 1.20948E-5 41340 0 NA
21-45706610-C-A p.Pro101Pro synonymous AIRE 1 82142 1.2174E-5 41071 0 3.18532E-5
21-45706612-A-G p.Lys102Arg missense+splice_region AIRE 3 82082 3.65488E-5 41041 0 3.3498E-5
21-45706869-C-T p.Leu106Phe missense AIRE 1 81672 1.22441E-5 40836 0 NA
21-45706875-C-T p.Gln108* stop_gained AIRE 1 81690 1.22414E-5 40845 0 4.06921E-6
21-45706881-C-T p.Arg110Trp missense AIRE 7 81714 8.56646E-5 40857 0 3.18918E-5
21-45706882-G-A p.Arg110Gln missense AIRE 3 81766 3.66901E-5 40883 0 0.00151057
21-45706895-G-T p.Lys114Asn missense AIRE 29 81856 3.54281E-4 40928 0 2.23328E-4
21-45706900-C-T p.Pro116Leu missense AIRE 8 81910 9.76682E-5 40955 0 5.27979E-5
21-45706901-G-A p.Pro116Pro synonymous AIRE 64 81858 7.81842E-4 40929 0 0.00439147
21-45706904-C-T p.Ala117Ala synonymous AIRE 5 81924 6.10322E-5 40962 0 1.09552E-4
21-45706905-G-A p.Val118Ile missense AIRE 7 81956 8.54117E-5 40978 0 3.24444E-5
21-45706906-T-A p.Val118Asp missense AIRE 3 81984 3.65925E-5 40992 0 8.66341E-6
21-45706907-C-G p.Val118Val synonymous AIRE 15 82064 1.82784E-4 41032 0 0.00125471
21-45706907-C-A p.Val118Val synonymous AIRE 5 82064 6.09281E-5 41032 0 1.2158E-5
21-45706919-G-T p.Leu122Phe missense AIRE 1 82124 1.21767E-5 41062 0 4.0495E-6
21-45706924-C-T p.Pro124Leu missense AIRE 11 82044 1.34074E-4 41022 0 2.59263E-4
21-45706925-G-A p.Pro124Pro synonymous AIRE 7 82008 8.53575E-5 41004 0 8.10241E-5
21-45706934-A-C p.Arg127Ser missense AIRE 1 82034 1.21901E-5 41017 0 NA
21-45706942-C-T p.Thr130Ile missense AIRE 1 82112 1.21785E-5 41056 0 4.05255E-6
21-45706947-A-G p.Arg132Gly missense AIRE 2 82090 2.43635E-5 41045 0 NA
21-45706968-C-T p.Arg139* stop_gained AIRE 1 81512 1.22681E-5 40756 0 2.47922E-5
21-45706968-C-G p.Arg139Gly missense AIRE 5 81512 6.13407E-5 40756 0 1.59734E-4
21-45706968-C-A p.Arg139Arg synonymous AIRE 1 81512 1.22681E-5 40756 0 NA
21-45706976-C-A p.Ala141Ala synonymous AIRE 1 80982 1.23484E-5 40491 0 1.22968E-5
21-45706976-C-T p.Ala141Ala synonymous AIRE 1 80982 1.23484E-5 40491 0 0.0010101
21-45706978-C-T p.Ala142Val missense AIRE 3 80890 3.70874E-5 40445 0 1.1493E-4
21-45706979-G-A p.Ala142Ala synonymous AIRE 1 80830 1.23716E-5 40415 0 9.01846E-5
21-45706985-A-G p.Ala144Ala synonymous AIRE 1 80874 1.23649E-5 40437 0 NA
21-45707000-G-A p.Arg149Arg synonymous AIRE 14 80692 1.73499E-4 40346 0 7.03145E-4
21-45707006-C-T p.Thr151Thr synonymous AIRE 3 80378 3.73236E-5 40189 0 3.1955E-5
21-45707007-G-A p.Ala152Thr missense AIRE 5 80212 6.23348E-5 40106 0 2.46826E-5
21-45707008-C-T p.Ala152Val missense AIRE 1 80238 1.24629E-5 40119 0 8.87579E-6
21-45707010-A-G p.Ser153Gly missense AIRE 7 80142 8.7345E-5 40071 0 6.37755E-4
21-45707013-C-T p.Pro154Ser missense AIRE 1 80076 1.24881E-5 40038 0 3.19387E-5
21-45707021-C-A c.463+5C>A splice_region AIRE 2 79550 2.51414E-5 39775 0 4.12967E-5
21-45707393-C-G c.464-7C>G splice_region AIRE 1 78418 1.27522E-5 39209 0 5.4933E-5
21-45707394-A-G c.464-6A>G splice_region AIRE 3 78404 3.82634E-5 39202 0 6.39877E-5
21-45707414-GCCAAGC-G p.Lys161_Pro162del conservative_inframe_deletion AIRE 2 78758 2.53942E-5 39379 0 1.03691E-4
21-45707421-C-T p.Pro162Leu missense AIRE 15 78886 1.90148E-4 39443 0 2.04186E-4
21-45707424-C-T p.Pro163Leu missense AIRE 1 78920 1.26711E-5 39460 0 NA
21-45707431-G-A p.Lys165Lys synonymous AIRE 1 78914 1.2672E-5 39457 0 NA
21-45707433-C-T p.Pro166Leu missense AIRE 176 78924 0.00222999 39462 0 0.00535783
21-45707434-G-A p.Pro166Pro synonymous AIRE 3 78938 3.80045E-5 39469 0 0.00205973
21-45707443-C-T p.Ser169Ser synonymous AIRE 12 78882 1.52126E-4 39441 0 2.99043E-4
21-45707444-G-A p.Ala170Thr missense AIRE 1 78890 1.26759E-5 39445 0 9.57549E-5
21-45707446-A-G p.Ala170Ala synonymous AIRE 41 78890 5.19711E-4 39445 0 0.00134005
21-45707456-C-T p.Arg174Cys missense AIRE 3 78760 3.80904E-5 39380 0 1.5121E-4
21-45707456-C-G p.Arg174Gly missense AIRE 4 78760 5.07872E-5 39380 0 1.22954E-5
21-45707457-G-A p.Arg174His missense AIRE 23 78730 2.92138E-4 39365 0 0.00102987
21-45707463-C-T p.Pro176Leu missense AIRE 1 78720 1.27033E-5 39360 0 5.07563E-5
21-45707467-C-T p.Leu177Leu synonymous AIRE 12 78624 1.52625E-4 39312 0 0.00411523
21-45707467-C-A p.Leu177Leu synonymous AIRE 1 78626 1.27184E-5 39313 0 NA
21-45707473-C-T p.Asn179Asn splice_region+synonymous AIRE 9 78562 1.14559E-4 39281 0 0.00155119
21-45707474-G-A p.Gly180Arg missense+splice_region AIRE 17 78514 2.16522E-4 39257 0 1.71466E-4
21-45707479-G-A c.538+5G>A splice_region AIRE 1 78398 1.27554E-5 39199 0 6.40066E-6
21-45707480-C-T c.538+6C>T splice_region AIRE 10 78356 1.27623E-4 39178 0 1.91804E-4
21-45707481-G-A c.538+7G>A splice_region AIRE 7 78344 8.93495E-5 39172 0 9.59386E-5
21-45708222-T-G c.539-6T>G splice_region AIRE 1 82308 1.21495E-5 41154 0 NA
21-45708228-GG-AT p.Gly180Asp missense+splice_region AIRE 1 82410 1.21345E-5 41205 0 NA
21-45708233-C-CAG p.Thr183fs frameshift AIRE 1 82510 1.21197E-5 41255 0 NA
21-45708237-C-A p.Thr183Asn missense AIRE 148 82524 0.00179342 41262 2 0.0037254
21-45708246-C-T p.Ala186Val missense AIRE 1 82662 1.20975E-5 41331 0 NA
21-45708249-C-T p.Ser187Leu missense AIRE 15 82698 1.81383E-4 41349 0 5.589E-5
21-45708253-C-G p.Val188Val synonymous AIRE 12 82684 1.45131E-4 41342 1 6.25E-4
21-45708253-C-A p.Val188Val synonymous AIRE 1 82686 1.20939E-5 41343 0 NA
21-45708263-G-A p.Val192Met missense AIRE 1 82694 1.20928E-5 41347 0 3.18492E-5
21-45708269-A-G p.Met194Val missense AIRE 3 82688 3.6281E-5 41344 0 5.03525E-4
21-45708277-C-T p.Ser196Ser synonymous AIRE 17728 82088 0.215963 41044 2069 0.23565
21-45708277-CGG-TGC p.SerGly196SerAla missense AIRE 1 82604 1.2106E-5 41302 0 NA
21-45708278-G-A p.Gly197Arg missense AIRE 10 82588 1.21083E-4 41294 0 1.91144E-4
21-45708279-G-A p.Gly197Glu missense AIRE 1 82584 1.21089E-5 41292 0 NA
21-45708283-C-T p.Asp198Asp synonymous AIRE 6 82484 7.27414E-5 41242 0 1.27478E-4
21-45708283-C-A p.Asp198Glu missense AIRE 1 82484 1.21236E-5 41242 0 NA
21-45708284-G-A p.Val199Ile missense AIRE 164 82456 0.00198894 41228 2 0.00704935
21-45708287-C-T p.Pro200Ser missense AIRE 1 82424 1.21324E-5 41212 0 NA
21-45708288-C-T p.Pro200Leu missense AIRE 18 82356 2.18563E-4 41178 0 5.73723E-4
21-45708289-G-A p.Pro200Pro synonymous AIRE 2 82344 2.42884E-5 41172 0 5.03525E-4
21-45708296-C-T p.Arg203* stop_gained AIRE 3 82112 3.65355E-5 41056 0 6.37674E-5
21-45708297-G-A p.Arg203Gln missense AIRE 5 82098 6.09028E-5 41049 0 5.59597E-5
21-45708302-G-T p.Ala205Ser missense AIRE 1 81912 1.22082E-5 40956 0 NA
21-45708304-C-T p.Ala205Ala synonymous AIRE 12 81752 1.46785E-4 40876 0 9.56084E-5
21-45708308-G-A p.Glu207Lys missense AIRE 2 81576 2.4517E-5 40788 0 2.49796E-5
21-45708310-G-A p.Glu207Glu synonymous AIRE 1 81458 1.22763E-5 40729 0 NA
21-45708316-C-T p.Ile209Ile synonymous AIRE 1 81080 1.23335E-5 40540 0 1.66678E-5
21-45708330-T-C p.Val214Ala missense AIRE 1 79794 1.25323E-5 39897 0 NA
21-45708333-T-C p.Phe215Ser missense AIRE 1 79504 1.2578E-5 39752 0 NA
21-45708335-G-A p.Glu216Lys missense AIRE 2 79292 2.52232E-5 39646 0 8.371E-6
21-45708342-G-T c.652+1G>T splice_donor AIRE 6 78500 7.64331E-5 39250 0 9.64343E-5
21-45708347-C-T c.652+6C>T splice_region AIRE 10 77496 1.29039E-4 38748 0 1.97232E-4
21-45708348-G-A c.652+7G>A splice_region AIRE 3 77244 3.8838E-5 38622 0 3.62599E-5
21-45709303-A-T n.1385+4A>T splice_region AIRE 1 60900 1.64204E-5 30450 0 NA
21-45709304-G-A n.1385+5G>A splice_region AIRE 1 61248 1.63271E-5 30624 0 3.18532E-5
21-45709535-C-T c.653-5C>T splice_region AIRE 1 82676 1.20954E-5 41338 0 8.43811E-6
21-45709541-C-T p.Gly218Gly splice_region+synonymous AIRE 6 82674 7.25742E-5 41337 0 7.58687E-5
21-45709541-C-A p.Gly218Gly splice_region+synonymous AIRE 4 82674 4.83828E-5 41337 0 3.18918E-5
21-45709542-G-A p.Gly219Ser missense+splice_region AIRE 3 82678 3.62853E-5 41339 0 5.05612E-5
21-45709546-C-T p.Ser220Phe missense AIRE 11 82700 1.33011E-4 41350 0 4.20932E-5
21-45709560-C-A p.Gln225Lys missense AIRE 1 82746 1.20852E-5 41373 0 2.52008E-5
21-45709567-GC-AT p.Gly227Asp missense AIRE 1 82724 1.20884E-5 41362 0 NA
21-45709568-C-T p.Gly227Gly synonymous AIRE 17818 82488 0.216007 41244 2137 0.22559
21-45709568-C-G p.Gly227Gly synonymous AIRE 1 82718 1.20893E-5 41359 0 2.00062E-5
21-45709569-G-A p.Gly228Arg missense AIRE 1 82732 1.20872E-5 41366 0 5.03035E-5
21-45709592-G-A p.Lys235Lys synonymous AIRE 20 82678 2.41902E-4 41339 0 0.003125
21-45709595-C-T p.Phe236Phe synonymous AIRE 2 82648 2.4199E-5 41324 0 3.18939E-5
21-45709595-C-G p.Phe236Leu missense AIRE 1 82648 1.20995E-5 41324 0 3.18939E-5
21-45709602-T-G p.Ser239Ala missense AIRE 1 82642 1.21004E-5 41321 0 NA
21-45709604-C-T p.Ser239Ser synonymous AIRE 99 82618 0.00119829 41309 0 0.00226475
21-45709605-G-A p.Gly240Ser missense AIRE 3 82618 3.63117E-5 41309 0 1.59469E-4
21-45709607-C-T p.Gly240Gly synonymous AIRE 1 82582 1.21092E-5 41291 0 NA
21-45709610-T-C p.Ser241Ser synonymous AIRE 2 82578 2.42195E-5 41289 0 8.40181E-6
21-45709626-C-T p.Arg247Cys missense AIRE 7 82478 8.48711E-5 41239 0 5.04032E-4
21-45709627-G-A p.Arg247His missense AIRE 1 82464 1.21265E-5 41232 0 6.25E-4
21-45709628-C-A p.Arg247Arg synonymous AIRE 2 82454 2.42559E-5 41227 0 4.0132E-6
21-45709629-A-G p.Ser248Gly missense AIRE 1 82460 1.21271E-5 41230 0 8.02742E-6
21-45709635-A-T p.Ser250Cys missense AIRE 2 82398 2.42724E-5 41199 0 5.04032E-4
21-45709640-C-G p.Gly251Gly synonymous AIRE 4 82354 4.85708E-5 41177 0 3.18878E-5
21-45709642-C-T p.Pro252Leu missense AIRE 365 82292 0.00443543 41146 5 0.00956877
21-45709643-G-A p.Pro252Pro synonymous AIRE 8 82282 9.72266E-5 41141 0 5.65451E-5
21-45709648-C-T p.Pro254Leu missense AIRE 3 82368 3.64219E-5 41184 0 NA
21-45709656-C-T p.Arg257* stop_gained AIRE 19 82258 2.30981E-4 41129 0 0.00105189
21-45709670-C-A p.Ala261Ala synonymous AIRE 1 82014 1.2193E-5 41007 0 8.55857E-6
21-45709670-C-T p.Ala261Ala synonymous AIRE 2 82014 2.43861E-5 41007 0 8.55857E-6
21-45709675-GC-G p.Ala264fs frameshift AIRE 1 81774 1.22288E-5 40887 0 NA
21-45709676-C-T p.Gly263Gly synonymous AIRE 229 81682 0.00280356 40841 2 0.00149172
21-45709677-G-A p.Ala264Thr missense AIRE 1 81600 1.22549E-5 40800 0 6.37714E-5
21-45709680-G-A p.Ala265Thr missense AIRE 8 81534 9.81186E-5 40767 0 1.27502E-4
21-45709681-C-T p.Ala265Val missense AIRE 2 81562 2.45212E-5 40781 0 1.71765E-5
21-45709685-C-T p.Pro266Pro splice_region+synonymous AIRE 36 81538 4.41512E-4 40769 0 9.88394E-4
21-45709685-C-G p.Pro266Pro splice_region+synonymous AIRE 47 81542 5.7639E-4 40771 1 0.0011797
21-45709686-G-A c.798+1G>A splice_donor AIRE 2 81454 2.45537E-5 40727 0 6.37674E-5
21-45709867-G-A c.799-4G>A splice_region AIRE 2 81892 2.44224E-5 40946 0 3.18898E-5
21-45709891-G-C p.Leu273Leu synonymous AIRE 1 81736 1.22345E-5 40868 0 6.01347E-5
21-45709893-G-A p.Gly274Asp missense AIRE 1 81588 1.22567E-5 40794 0 NA
21-45709897-G-C p.Gln275His missense AIRE 9 81468 1.10473E-4 40734 0 2.55412E-4
21-45709899-A-G p.Gln276Arg missense AIRE 3 81498 3.68107E-5 40749 0 3.97496E-5
21-45709904-A-G p.Ser278Gly missense AIRE 2 81440 2.4558E-5 40720 0 9.86466E-6
21-45709906-C-G p.Ser278Arg missense AIRE 10630 81110 0.131057 40555 909 0.16251
21-45709915-C-T p.Ala281Ala synonymous AIRE 1 81736 1.22345E-5 40868 0 1.22566E-5
21-45709932-G-A p.Ser287Asn missense AIRE 1 81464 1.22754E-5 40732 0 9.53689E-6
21-45709936-C-A p.Asp288Glu missense AIRE 1 81406 1.22841E-5 40703 0 NA
21-45709937-C-A p.Pro289Thr missense AIRE 3 81444 3.68351E-5 40722 0 NA
21-45709940-C-T p.Gln290* stop_gained AIRE 1 81418 1.22823E-5 40709 0 NA
21-45710692-G-A p.Met1? start_lost AIRE 2 82792 2.41569E-5 41396 0 8.43071E-6
21-45710699-G-C p.Val4Leu missense AIRE 1 82814 1.20753E-5 41407 0 1.59976E-5
21-45710706-G-A p.Ser6Asn missense AIRE 2 82832 2.41453E-5 41416 0 2.51691E-5
21-45710710-C-T p.Ser7Ser synonymous AIRE 8 82816 9.65997E-5 41408 0 6.25E-4
21-45710711-G-A p.Gly8Arg missense AIRE 1 82852 1.20697E-5 41426 0 2.79884E-5
21-45710715-C-T p.Ala9Val missense AIRE 4 82846 4.82824E-5 41423 0 3.19142E-5
21-45710715-C-G p.Ala9Gly missense AIRE 1 82846 1.20706E-5 41423 0 2.79841E-5
21-45710724-C-T p.Thr12Met missense AIRE 3 82872 3.62004E-5 41436 0 2.39802E-5
21-45710735-G-T p.Ala16Ser missense AIRE 1 82932 1.20581E-5 41466 0 NA
21-45710744-C-T p.Arg19Trp missense AIRE 5 82908 6.03078E-5 41454 0 3.08308E-4
21-45710745-G-A p.Arg19Gln missense AIRE 1 82900 1.20627E-5 41450 0 3.33306E-5
21-45710760-T-C p.Ile24Thr missense AIRE 1 82848 1.20703E-5 41424 0 NA
21-45710761-A-G p.Ile24Met missense AIRE 2 82846 2.41412E-5 41423 0 1.665E-5
21-45710770-C-T p.Ala27Ala synonymous AIRE 1 82744 1.20855E-5 41372 0 1.19714E-5
21-45710772-CG-C p.Gly30fs frameshift AIRE 3 82714 3.62696E-5 41357 0 1.59713E-5
21-45710772-C-T p.Pro28Leu missense AIRE 3 82714 3.62696E-5 41357 0 5.58994E-5
21-45710773-G-A p.Pro28Pro synonymous AIRE 2 82724 2.41768E-5 41362 0 7.98378E-5
21-45710775-G-C p.Gly29Ala missense AIRE 1 82746 1.20852E-5 41373 0 3.98893E-6
21-45710779-TG-T p.Val31fs frameshift AIRE 366 82662 0.00442767 41331 5 0.00965905
21-45710782-C-T p.Val31Val synonymous AIRE 1 82660 1.20978E-5 41330 0 NA
21-45710783-T-C p.Cys32Arg missense AIRE 3 82666 3.62906E-5 41333 0 4.38603E-5
21-45710794-AGATGGATGGG-A p.Asp36fs frameshift AIRE 3 82588 3.63249E-5 41294 0 1.24428E-4
21-45710802-G-A p.Trp38* stop_gained AIRE 2 82500 2.42424E-5 41250 0 3.98568E-6
21-45710803-G-C p.Trp38Cys missense AIRE 1 82498 1.21215E-5 41249 0 NA
21-45710804-G-A p.Gly39Arg missense AIRE 1 82480 1.21242E-5 41240 0 3.31741E-5
21-45710814-G-C p.Gly42Ala missense AIRE 1 82406 1.2135E-5 41203 0 NA
21-45710821-C-A p.Gly44Gly synonymous AIRE 1 82346 1.21439E-5 41173 0 3.31549E-5
21-45710839-C-T p.Gly50Gly synonymous AIRE 1 82256 1.21572E-5 41128 0 8.28679E-6
21-45710854-G-T p.Gly55Gly synonymous AIRE 2 82128 2.43522E-5 41064 0 NA
21-45710862-T-C p.Leu58Pro missense AIRE 4 82024 4.87662E-5 41012 0 6.77577E-5
21-45710868-G-A p.Ser60Asn missense AIRE 5 81982 6.0989E-5 40991 0 6.25E-4
21-45710889-G-T p.Cys67Phe missense AIRE 1 81930 1.22055E-5 40965 0 7.97308E-6
21-45710893-G-T p.Trp68Cys missense AIRE 5 81912 6.10411E-5 40956 0 5.03525E-4
21-45710914-G-C p.Glu75Asp missense AIRE 1 81794 1.22258E-5 40897 0 NA
21-45710924-A-T p.Arg79Trp missense AIRE 1 81796 1.22255E-5 40898 0 NA
21-45710930-GT-G p.Val81fs frameshift AIRE 1 81774 1.22288E-5 40887 0 NA
21-45710932-GCTGCACCCCAGCCCA-G p.Leu82_Pro86del conservative_inframe_deletion AIRE 1 81764 1.22303E-5 40882 0 NA
21-45710936-C-T p.His83Tyr missense AIRE 1 81716 1.22375E-5 40858 0 1.19667E-5
21-45710939-C-A p.Pro84Thr missense AIRE 1 81718 1.22372E-5 40859 0 8.2927E-6
21-45710971-G-A c.880-7G>A splice_region AIRE 5 81572 6.12955E-5 40786 0 1.59551E-4
21-45710989-C-T p.Asp297Asp synonymous AIRE 4 81260 4.92247E-5 40630 0 1.19914E-5
21-45710998-C-T p.Ala300Ala synonymous AIRE 4 80998 4.93839E-5 40499 0 1.07976E-4
21-45710999-G-A p.Val301Met missense AIRE 47 81054 5.7986E-4 40527 0 0.00134091
21-45711005-C-T p.Arg303Trp missense AIRE 5 80838 6.18521E-5 40419 0 6.38978E-5
21-45711006-G-A p.Arg303Gln missense AIRE 33 80792 4.08456E-4 40396 0 5.05561E-4
21-45711010-C-T p.Asp304Asp synonymous AIRE 8 80564 9.92999E-5 40282 0 7.66479E-4
21-45711013-C-T p.Gly305Gly synonymous AIRE 1 80336 1.24477E-5 40168 0 0.0015213
21-45711025-C-G p.Ile309Met missense AIRE 16 79920 2.002E-4 39960 0 0.00125
21-45711028-CT-C p.Cys311fs frameshift AIRE 2 79760 2.50752E-5 39880 0 NA
21-45711034-C-T p.Asp312Asp synonymous AIRE 4 79258 5.04681E-5 39629 0 0.00153061
21-45711044-C-T p.Arg316Trp missense AIRE 4 78196 5.11535E-5 39098 0 3.66999E-5
21-45711045-G-A p.Arg316Gln missense AIRE 6 77872 7.70495E-5 38936 0 4.49005E-5
21-45711045-G-C p.Arg316Pro missense AIRE 1 77872 1.28416E-5 38936 0 NA
21-45711046-G-A p.Arg316Arg synonymous AIRE 3 77914 3.8504E-5 38957 0 8.48248E-6
21-45711054-AC-A p.Leu320fs frameshift AIRE 1 76864 1.301E-5 38432 0 NA
21-45711062-TGCCTGTCCCCTCC-T p.Leu323fs frameshift AIRE 47 76860 6.11501E-4 38430 0 5.06335E-4
21-45711075-C-T p.Pro326Leu missense AIRE 3 75256 3.98639E-5 37628 0 8.35541E-6
21-45711076-G-A p.Pro326Pro synonymous AIRE 4 74604 5.36164E-5 37302 0 4.19094E-6
21-45711077-C-A p.Leu327Ile missense AIRE 2 74746 2.67573E-5 37373 0 3.19326E-5
21-45711080-C-T p.Arg328Trp missense AIRE 16 74308 2.1532E-4 37154 0 5.15464E-4
21-45711081-G-A p.Arg328Gln missense AIRE 1 73848 1.35413E-5 36924 0 5.46356E-5
21-45711096-GAG-TAT c.995+3_995+5delGAGinsTAT splice_region AIRE 1 71348 1.40158E-5 35674 0 NA
21-45712201-T-C p.Ser338Pro missense AIRE 1 59062 1.69314E-5 29531 0 NA
21-45712209-C-T p.Cys340Cys synonymous AIRE 2 60596 3.30055E-5 30298 0 3.96888E-5
21-45712214-A-G p.Gln342Arg missense AIRE 1 61444 1.6275E-5 30722 0 NA
21-45712227-G-A p.Gln346Gln synonymous AIRE 1 62180 1.60823E-5 31090 0 NA
21-45712237-C-T p.Pro350Ser missense AIRE 8 62378 1.2825E-4 31189 0 5.09165E-4
21-45712240-C-T p.Arg351Trp missense AIRE 3 62212 4.82222E-5 31106 0 2.0475E-4
21-45712241-G-A p.Arg351Gln missense AIRE 5 62228 8.03497E-5 31114 0 4.14491E-5
21-45712242-G-A p.Arg351Arg synonymous AIRE 2 62310 3.20976E-5 31155 0 4.11794E-5
21-45712253-C-T p.Pro355Leu missense AIRE 1 61624 1.62274E-5 30812 0 1.36289E-4
21-45712254-C-T p.Pro355Pro synonymous AIRE 138 61710 0.00223627 30855 0 0.00332417
21-45712255-C-T p.Arg356Trp missense AIRE 15 61490 2.43942E-4 30745 0 1.59939E-4
21-45712256-G-A p.Arg356Gln missense AIRE 4 61264 6.52912E-5 30632 0 5.68289E-4
21-45712270-C-T p.Pro361Ser missense AIRE 2 60052 3.33045E-5 30026 0 7.22392E-5
21-45712272-C-T p.Pro361Pro synonymous AIRE 42 59724 7.03235E-4 29862 0 0.00115016
21-45712272-C-A p.Pro361Pro synonymous AIRE 1 59732 1.67414E-5 29866 0 0.00464876
21-45712273-G-A p.Val362Met missense AIRE 1 59550 1.67926E-5 29775 0 NA
21-45712283-C-T p.Pro365Leu missense+splice_region AIRE 1 58430 1.71145E-5 29215 0 2.37756E-4
21-45712283-C-G p.Pro365Arg missense+splice_region AIRE 1 58430 1.71145E-5 29215 0 NA
21-45712286-T-C c.1095+2T>C splice_donor AIRE 4 57914 6.90679E-5 28957 0 1.60205E-4
21-45712286-TATGGCCACGCCCCCTCCTAGCCGGGCCACCCCTCCTGTCCAC-T c.1095+3_1095+44delATGGCCACGCCCCCTCCTAGCCGGGCCACCCCTCCTGTCCAC splice_region AIRE 2 57916 3.45328E-5 28958 0 3.2041E-5
21-45712288-T-G c.1095+4T>G splice_region AIRE 1 57796 1.73022E-5 28898 0 NA
21-45712289-G-T c.1095+5G>T splice_region AIRE 3 57584 5.20978E-5 28792 0 2.7325E-5
21-45712290-G-A c.1095+6G>A splice_region AIRE 5843 56456 0.103497 28228 409 0.143583
21-45712873-C-T c.1096-3C>T splice_region AIRE 1 81616 1.22525E-5 40808 0 3.19142E-5
21-45712879-C-T p.Pro367Ser missense AIRE 2 81690 2.44828E-5 40845 0 NA
21-45712883-C-T p.Pro368Leu missense AIRE 3 81684 3.67269E-5 40842 0 5.08647E-4
21-45712884-G-A p.Pro368Pro synonymous AIRE 9 81694 1.10167E-4 40847 0 2.23599E-4
21-45712887-G-T p.Gly369Gly synonymous AIRE 1 81786 1.2227E-5 40893 0 2.01415E-5
21-45712895-C-T p.Ser372Leu missense AIRE 13 81788 1.58948E-4 40894 0 6.28931E-4
21-45712896-G-A p.Ser372Ser synonymous AIRE 99 81880 0.00120909 40940 2 0.00278044
21-45712898-C-T p.Ala373Val missense AIRE 33 81836 4.03246E-4 40918 0 9.91366E-4
21-45712899-G-A p.Ala373Ala synonymous AIRE 3 81972 3.65979E-5 40986 0 6.27353E-4
21-45712906-G-A p.Glu169Lys missense+splice_region AIRE 2 82004 2.43891E-5 41002 0 4.01581E-6
21-45712922-C-T p.Pro381Leu missense AIRE 1 82116 1.21779E-5 41058 0 1.69926E-5
21-45712928-A-G p.Glu383Gly missense AIRE 1 82090 1.21818E-5 41045 0 4.01332E-6
21-45712929-A-C p.Glu383Asp missense AIRE 1 81972 1.21993E-5 40986 0 0.00711382
21-45712937-C-T p.Ala386Val missense AIRE 1 82128 1.21761E-5 41064 0 NA
21-45712938-C-T p.Ala386Ala synonymous AIRE 10 82136 1.21749E-4 41068 0 0.00101317
21-45712948-A-G p.Thr390Ala missense AIRE 1 82000 1.21951E-5 41000 0 1.70608E-5
21-45712949-C-T p.Thr390Met missense AIRE 8 81944 9.76276E-5 40972 0 2.13088E-4
21-45712958-T-C p.Val393Ala missense AIRE 1 81856 1.22166E-5 40928 0 NA
21-45712959-C-G p.Val393Val synonymous AIRE 3 81854 3.66506E-5 40927 0 8.72052E-6
21-45712965-G-T p.Lys395Asn missense AIRE 2 81678 2.44864E-5 40839 0 NA
21-45712973-C-G p.Pro398Arg missense AIRE 1 81594 1.22558E-5 40797 0 NA
21-45712974-G-A p.Pro398Pro synonymous AIRE 2 81568 2.45194E-5 40784 0 4.6827E-5
21-45712977-T-C p.Ala399Ala synonymous AIRE 28143 79368 0.354589 39684 4783 0.394094
21-45712977-TCC-CCT p.AlaPro399AlaLeu missense AIRE 52 81484 6.38162E-4 40742 0 NA
21-45712979-C-T p.Pro400Leu missense AIRE 35 81500 4.29448E-4 40750 0 0.00114884
21-45712980-G-A p.Pro400Pro synonymous AIRE 2 81442 2.45574E-5 40721 0 1.59612E-4
21-45712983-T-C c.508-8T>C splice_region AIRE 1704 81330 0.0209517 40665 92 0.0448591
21-45712987-G-A p.Ala403Thr missense AIRE 4 81350 4.91703E-5 40675 0 0.00125156
21-45712990-G-A c.508-1G>A splice_acceptor AIRE 1 81268 1.2305E-5 40634 0 3.1902E-5
21-45712994-C-T p.Pro405Leu missense AIRE 5 81202 6.15748E-5 40601 0 0.00204708
21-45712995-G-A p.Arg171His missense AIRE 42 81124 5.17726E-4 40562 0 0.00255624
21-45712997-T-G p.Leu406Arg missense AIRE 1 81098 1.23308E-5 40549 0 NA
21-45713003-G-C p.Gly408Ala missense AIRE 4 80974 4.93986E-5 40487 0 2.20961E-5
21-45713003-G-A p.Gly408Glu missense AIRE 3 80974 3.70489E-5 40487 0 NA
21-45713012-C-T p.Ser411Phe missense AIRE 3 80834 3.71131E-5 40417 0 9.60356E-5
21-45713013-C-T p.Pro177Leu missense AIRE 3 80842 3.71094E-5 40421 0 9.53044E-6
21-45713015-C-T p.Ser412Leu missense AIRE 5 80744 6.19241E-5 40372 0 1.67063E-4
21-45713016-G-A p.Arg178Gln missense AIRE 2 80682 2.47887E-5 40341 0 1.59561E-4
21-45713017-G-A p.Ala413Thr missense AIRE 2 80610 2.48108E-5 40305 0 4.25405E-5
21-45713018-C-A p.Ala413Asp missense AIRE 2 80604 2.48127E-5 40302 0 NA
21-45713024-A-G p.His415Arg missense AIRE 42 80440 5.22128E-4 40220 2 0.00360825
21-45713028-C-G p.Pro182Arg missense AIRE 1 80472 1.24267E-5 40236 0 3.19061E-5
21-45713064-C-T c.1278+6C>T splice_region AIRE 4 79434 5.03563E-5 39717 0 3.36183E-4
21-45713065-G-A c.1278+7G>A splice_region AIRE 10 79420 1.25913E-4 39710 0 5.03626E-4
21-45713664-T-G c.1279-8T>G splice_region AIRE 6 80602 7.44398E-5 40301 0 6.25E-4
21-45713678-G-T p.Ala429Ser missense AIRE 2 80738 2.47715E-5 40369 0 1.71453E-5
21-45713682-C-T p.Pro430Leu missense AIRE 1 80808 1.2375E-5 40404 0 3.19632E-5
21-45713688-C-CA p.Arg433fs frameshift AIRE 1 80788 1.23781E-5 40394 0 1.26E-5
21-45713689-G-A p.Arg198His missense AIRE 74 80760 9.16295E-4 40380 0 0.00262199
21-45713690-C-T p.Arg433Cys missense AIRE 1 80724 1.23879E-5 40362 0 2.09962E-5
21-45713691-G-A p.Arg433His missense AIRE 2 80804 2.47513E-5 40402 0 5.12899E-5
21-45713695-C-T p.Ala200Val missense AIRE 1 80782 1.2379E-5 40391 0 2.56371E-5
21-45713696-G-A p.Gly435Arg missense AIRE 8 80876 9.89169E-5 40438 0 1.27967E-4
21-45713704-C-T p.Ala203Val missense AIRE 1 80836 1.23707E-5 40418 0 1.70853E-5
21-45713715-C-T p.Thr441Met missense AIRE 170 80772 0.00210469 40386 1 0.0040282
21-45713716-G-A p.Arg207Gln missense AIRE 10 80788 1.23781E-4 40394 0 1.79632E-4
21-45713719-C-T p.Thr208Met missense AIRE 3 80692 3.71784E-5 40346 0 6.40246E-5
21-45713720-G-A p.Val443Met missense AIRE 14 80656 1.73577E-4 40328 0 1.59668E-4
21-45713724-T-C p.Leu444Pro missense AIRE 1 80548 1.2415E-5 40274 0 4.20366E-6
21-45713731-T-C p.Val212Ala missense AIRE 5 80342 6.2234E-5 40171 0 NA
21-45713737-C-T p.Thr214Ile missense AIRE 10 80202 1.24685E-4 40101 0 2.88203E-4
21-45713740-C-T p.Ala215Val missense AIRE 5 80036 6.24719E-5 40018 0 1.29814E-4
21-45713740-C-A p.Cys449* stop_gained AIRE 1 80036 1.24944E-5 40018 0 NA
21-45713741-G-T p.Ala450Ser missense AIRE 1 79894 1.25166E-5 39947 0 8.66491E-6
21-45713741-G-A p.Ala450Thr missense AIRE 1 79894 1.25166E-5 39947 0 2.96103E-5
21-45713743-C-T p.Pro216Leu missense AIRE 1 79990 1.25016E-5 39995 0 1.2704E-5
21-45713744-G-A p.Ala451Thr missense AIRE 1 79902 1.25153E-5 39951 0 4.23463E-5
21-45713746-T-C p.Leu217Pro missense AIRE 2 79936 2.502E-5 39968 0 3.20266E-5
21-45713760-G-A p.Arg456His missense AIRE 2 79812 2.50589E-5 39906 0 6.4082E-5
21-45713763-G-A p.Cys457Tyr missense AIRE 8 80106 9.98677E-5 40053 0 5.52613E-5
21-45713767-C-T p.Thr224Ile missense AIRE 2 80184 2.49426E-5 40092 0 NA
21-45713776-C-T p.Pro227Leu missense AIRE 13 80154 1.62188E-4 40077 0 9.9308E-4
21-45713777-G-C p.Gly462Arg missense AIRE 2 80100 2.49688E-5 40050 0 2.12314E-5
21-45713777-G-A p.Gly462Ser missense AIRE 2 80100 2.49688E-5 40050 0 3.54572E-5
21-45713782-C-T p.Pro229Leu missense AIRE 1 80126 1.24803E-5 40063 0 4.24567E-6
21-45713787-G-A p.Arg465Gln missense AIRE 2 80046 2.49856E-5 40023 0 2.24503E-4
21-45713791-C-T p.Pro232Leu missense+splice_region AIRE 2 79920 2.5025E-5 39960 0 4.25619E-6
21-45713792-G-A p.Gly467Arg missense+splice_region AIRE 4 79852 5.00927E-5 39926 0 6.41643E-5
21-45713792-G-C p.Gly467Arg missense+splice_region AIRE 2 79852 2.50463E-5 39926 0 9.62464E-5
21-45713800-G-C c.1400+7G>C splice_region AIRE 2 79726 2.50859E-5 39863 0 4.27318E-5
21-45714248-C-T n.2131-7C>T splice_region AIRE 124 43432 0.00285504 21716 1 0.00668201
21-45714250-C-G n.2131-5C>G splice_region AIRE 7 43912 1.5941E-4 21956 0 0.00125786
21-45714250-C-A n.2131-5C>A splice_region AIRE 1 43914 2.27718E-5 21957 0 1.68492E-4
21-45714252-C-A n.2131-3C>A splice_region AIRE 5 44326 1.12801E-4 22163 0 8.23995E-5
21-45714256-G-C n.2132G>C splice_region AIRE 6927 43694 0.158534 21847 565 0.279822
21-45714257-C-G n.2133C>G splice_region AIRE 2 44644 4.47989E-5 22322 0 NA
21-45714257-C-T n.2133C>T splice_region AIRE 1 44644 2.23994E-5 22322 0 6.98851E-6
21-45714286-C-T p.Thr468Met missense+splice_region AIRE 1 48666 2.05482E-5 24333 0 8.01089E-5
21-45714287-G-A p.Arg234Gln missense AIRE 161 48704 0.00330568 24352 0 0.0086558
21-45714287-G-C p.Arg234Pro missense AIRE 2 48732 4.10408E-5 24366 0 6.58762E-4
21-45714294-C-T p.Arg471Cys missense AIRE 424 49376 0.00858717 24688 2 0.0213778
21-45714295-G-A p.Arg471His missense AIRE 2 49600 4.03226E-5 24800 0 3.3071E-5
21-45714310-C-T p.Gln242* stop_gained AIRE 2 50306 3.97567E-5 25153 0 2.86221E-5
21-45714317-C-T p.Thr244Met missense AIRE 1 49776 2.009E-5 24888 0 1.70707E-4
21-45714318-G-A p.Val479Met missense AIRE 3 49700 6.03622E-5 24850 0 0.00203459
21-45714319-T-A p.Ter245Argext*? stop_lost AIRE 1 49666 2.01345E-5 24833 0 6.39182E-5
21-45714320-G-A p.Ter245Ter stop_retained AIRE 9 49616 1.81393E-4 24808 0 4.47342E-4
21-45714325-C-T p.Pro481Leu missense AIRE 1 49426 2.02323E-5 24713 0 6.38896E-5
21-45714330-C-G p.Pro483Ala missense AIRE 1 48898 2.04507E-5 24449 0 3.00842E-5
21-45714333-G-A p.Val484Met missense AIRE 9 48512 1.85521E-4 24256 0 0.00101937
21-45714337-A-T p.Glu485Val missense AIRE 1 48000 2.08333E-5 24000 0 4.96251E-5
21-45714339-G-C p.Gly486Arg missense AIRE 1 47878 2.08864E-5 23939 0 3.2871E-5
21-45714341-G-A p.Gly486Gly synonymous AIRE 2 47594 4.20221E-5 23797 0 3.33957E-5
21-45714351-C-T p.Pro490Ser missense AIRE 1 46578 2.14694E-5 23289 0 5.09684E-4
21-45714359-C-T p.Pro492Pro synonymous AIRE 33 45272 7.28927E-4 22636 0 0.00176949
21-45714360-G-A p.Ala493Thr missense AIRE 11 44986 2.44521E-4 22493 0 1.28131E-4
21-45714363-C-T p.Arg494Cys missense AIRE 3 44730 6.70691E-5 22365 0 7.14776E-6
21-45714364-G-A p.Arg494His missense AIRE 4 44380 9.01307E-5 22190 0 5.78035E-5
21-45714366-C-T p.Leu495Leu synonymous AIRE 10 44248 2.25999E-4 22124 0 0.00168089
21-45716262-C-T c.1504-4C>T splice_region AIRE 1 82702 1.20916E-5 41351 0 7.99738E-6
21-45716269-G-A p.Asp503Asn missense AIRE 56 82730 6.76901E-4 41365 0 0.00425573
21-45716274-T-C p.Thr504Thr synonymous AIRE 2 82738 2.41727E-5 41369 0 NA
21-45716278-A-G p.Ser506Gly missense AIRE 2 82742 2.41715E-5 41371 0 8.33486E-6
21-45716279-G-T p.Ser506Ile missense AIRE 1 82752 1.20843E-5 41376 0 NA
21-45716283-C-T p.His507His synonymous AIRE 2 82756 2.41674E-5 41378 0 8.33528E-6
21-45716289-C-T p.Pro509Pro synonymous AIRE 8 82722 9.67095E-5 41361 0 6.39672E-5
21-45716289-C-A p.Pro509Pro synonymous AIRE 2 82722 2.41774E-5 41361 0 NA
21-45716290-G-A p.Ala510Thr missense AIRE 1 82674 1.20957E-5 41337 0 2.39858E-5
21-45716290-G-C p.Ala510Pro missense AIRE 2 82674 2.41914E-5 41337 0 8.33556E-6
21-45716315-C-T p.Ser518Phe missense AIRE 1 82486 1.21233E-5 41243 0 8.33806E-6
21-45716325-C-T p.Ser521Ser synonymous AIRE 4 82270 4.86204E-5 41135 0 3.3365E-5
21-45716325-C-A p.Ser521Arg missense AIRE 2 82272 2.43096E-5 41136 0 8.34126E-6
21-45716329-G-GT c.1566+1_1566+2insT splice_donor AIRE 1 82218 1.21628E-5 41109 0 NA
21-45716332-A-C c.1566+4A>C splice_region AIRE 1 82066 1.21853E-5 41033 0 NA
21-45716336-C-T c.1566+8C>T splice_region AIRE 262 81954 0.00319692 40977 0 0.0075
21-45717534-C-T c.1567-5C>T splice_region AIRE 226 82012 0.00275569 41006 0 0.004375
21-45717535-G-A c.1567-4G>A splice_region AIRE 1 81884 1.22124E-5 40942 0 3.18715E-5
21-45717544-C-T p.Thr524Thr synonymous AIRE 1 82248 1.21584E-5 41124 0 NA
21-45717547-C-T p.Phe525Phe synonymous AIRE 1 82236 1.21601E-5 41118 0 NA
21-45717548-G-A p.Asp526Asn missense AIRE 5 82250 6.07903E-5 41125 0 1.68322E-5
21-45717550-T-C p.Asp526Asp synonymous AIRE 36443 81358 0.447934 40679 8261 0.501007
21-45717551-G-A p.Gly527Ser missense AIRE 1 82362 1.21415E-5 41181 0 1.67746E-5
21-45717559-G-A p.Leu529Leu synonymous AIRE 2 82488 2.4246E-5 41244 0 8.38842E-6
21-45717585-G-A p.Arg538His missense AIRE 1 82644 1.21001E-5 41322 0 3.18634E-5
21-45717588-C-T p.Pro539Leu missense AIRE 1 82638 1.2101E-5 41319 0 2.00521E-5
21-45717589-G-A p.Pro539Pro synonymous AIRE 1 82620 1.21036E-5 41310 0 0.00125
21-45717591-C-T p.Ala540Val missense AIRE 2 82626 2.42055E-5 41313 0 2.53032E-5
21-45717595-C-G p.Ala541Ala synonymous AIRE 1 82642 1.21004E-5 41321 0 3.18471E-5
21-45717620-G-T n.2407G>T splice_region AIRE 1 82338 1.21451E-5 41169 0 NA
21-45717622-C-T n.2409C>T splice_region AIRE 1 82286 1.21527E-5 41143 0 2.55093E-5