Variant

Variant ID Consequence Effect Gene AC AN AF NS NHOM maxEAF
11-67250536-C-G c.-94C>G 5_prime_UTR_premature_start_codon_gain AIP 2 81626 2.4502E-5 40813 0 NA
11-67250536-C-T c.-94C>T 5_prime_UTR_premature_start_codon_gain AIP 1 81626 1.2251E-5 40813 0 3.18695E-5
11-67250555-A-T c.-75A>T 5_prime_UTR_premature_start_codon_gain AIP 6 82472 7.2752E-5 41236 0 NA
11-67250560-T-A c.-70T>A 5_prime_UTR_premature_start_codon_gain AIP 1 82574 1.21103E-5 41287 0 NA
11-67250575-C-T c.-55C>T 5_prime_UTR_premature_start_codon_gain AIP 3 82832 3.62179E-5 41416 0 NA
11-67250639-A-G p.Ile4Val missense AIP 1 83338 1.19993E-5 41669 0 NA
11-67250655-G-A p.Arg9Gln missense AIP 44 83342 5.27945E-4 41671 0 0.00302115
11-67250665-G-A p.Gly12Gly synonymous AIP 43 83360 5.15835E-4 41680 0 5.20978E-4
11-67250675-C-T p.Arg16Cys missense AIP 1 83352 1.19973E-5 41676 0 0.00151057
11-67250676-G-A p.Arg16His missense AIP 235 83350 0.00281944 41675 2 0.00296197
11-67250690-G-A p.Gly21Ser missense AIP 1 83352 1.19973E-5 41676 0 NA
11-67250693-C-A p.Arg22Arg synonymous AIP 1 83340 1.1999E-5 41670 0 NA
11-67250695-A-C p.Arg22Arg synonymous AIP 1 83340 1.1999E-5 41670 0 NA
11-67250697-G-A p.Gly23Glu missense AIP 13 83344 1.5598E-4 41672 0 0.00165573
11-67250699-G-C p.Glu24Gln missense AIP 11 83344 1.31983E-4 41672 0 3.97753E-6
11-67250701-G-A p.Glu24Glu synonymous AIP 1 83328 1.20008E-5 41664 0 NA
11-67250701-G-C p.Glu24Asp missense AIP 2 83328 2.40015E-5 41664 0 1.82977E-4
11-67250708-G-C p.Asp27His missense AIP 2 83298 2.40102E-5 41649 0 3.18492E-5
11-67250717-G-T p.Asp30Tyr missense AIP 2 83262 2.40206E-5 41631 0 6.3678E-5
11-67250722-G-T p.Gly31Gly synonymous AIP 2 83238 2.40275E-5 41619 0 8.26556E-6
11-67250725-C-A p.Thr32Thr synonymous AIP 1 83212 1.20175E-5 41606 0 NA
11-67254471-C-A c.100-6C>A splice_region AIP 4 82782 4.83197E-5 41391 0 0.00125
11-67254493-G-A p.Arg39Gln missense AIP 1 83022 1.2045E-5 41511 0 2.47905E-5
11-67254497-G-A p.Thr40Thr synonymous AIP 1 83046 1.20415E-5 41523 0 3.18512E-5
11-67254509-C-T p.Asp44Asp synonymous AIP 807 83078 0.00971376 41539 26 0.0235515
11-67254509-C-A p.Asp44Glu missense AIP 1 83114 1.20317E-5 41557 0 NA
11-67254510-G-A p.Asp45Asn missense AIP 4 83120 4.81232E-5 41560 0 6.37146E-5
11-67254512-C-T p.Asp45Asp synonymous AIP 10 83128 1.20296E-4 41564 0 6.60797E-5
11-67254521-C-T p.Thr48Thr synonymous AIP 4 83140 4.81116E-5 41570 0 6.25E-4
11-67254522-G-A p.Val49Met missense AIP 28 83154 3.36725E-4 41577 0 2.74544E-4
11-67254530-C-T p.Asp51Asp synonymous AIP 4 83154 4.81035E-5 41577 0 6.37674E-5
11-67254536-C-T p.Ser53Ser synonymous AIP 5 83172 6.01164E-5 41586 0 1.59138E-5
11-67254538-G-A p.Arg54Gln missense AIP 3 83188 3.60629E-5 41594 0 6.3743E-5
11-67254540-G-T p.Ala55Ser missense AIP 3 83192 3.60612E-5 41596 0 8.25573E-6
11-67254543-C-T p.Arg56Cys missense AIP 3 83194 3.60603E-5 41597 0 1.98918E-5
11-67254544-G-A p.Arg56His missense AIP 1 83196 1.20198E-5 41598 0 3.18715E-5
11-67254555-A-G p.Met60Val missense AIP 1 83234 1.20143E-5 41617 0 7.95469E-6
11-67254582-A-G p.Lys69Glu missense AIP 4 83296 4.80215E-5 41648 0 6.37836E-5
11-67254601-C-T p.Thr75Ile missense AIP 1 83316 1.20025E-5 41658 0 NA
11-67254603-A-G p.Ile76Val missense AIP 3 83320 3.60058E-5 41660 0 3.1904E-5
11-67254619-G-T p.Arg81Leu missense AIP 1 83342 1.19988E-5 41671 0 NA
11-67254619-G-A p.Arg81Gln missense AIP 1 83342 1.19988E-5 41671 0 NA
11-67256733-C-T c.280-5C>T splice_region AIP 1 79414 1.25922E-5 39707 0 8.29944E-6
11-67256741-G-A p.Val95Met missense AIP 1 79892 1.25169E-5 39946 0 1.10759E-5
11-67256743-G-A p.Val95Val synonymous AIP 4 79970 5.00188E-5 39985 0 3.18857E-5
11-67256759-G-A p.Val101Met missense AIP 19 80768 2.35242E-4 40384 0 9.56511E-4
11-67256774-C-T p.Arg106Cys missense AIP 2 81308 2.45978E-5 40654 0 4.03245E-5
11-67256775-G-A p.Arg106His missense AIP 1 81352 1.22923E-5 40676 0 2.62964E-5
11-67256777-A-G p.Asn107Asp missense AIP 2 81442 2.45574E-5 40721 0 1.74347E-5
11-67256784-C-T p.Ala109Val missense AIP 2 81616 2.4505E-5 40808 0 5.17589E-5
11-67256813-C-T p.Arg119Trp missense AIP 5 82172 6.0848E-5 41086 0 3.38708E-5
11-67256824-C-T p.Cys122Cys synonymous AIP 2 82294 2.43031E-5 41147 0 3.37547E-5
11-67256825-G-A p.Gly123Ser missense AIP 2 82302 2.43007E-5 41151 0 3.18898E-5
11-67256831-G-C p.Ala125Pro missense AIP 1 82458 1.21274E-5 41229 0 NA
11-67256834-C-T p.Gln126* stop_gained AIP 1 82500 1.21212E-5 41250 0 4.00166E-6
11-67256840-C-T p.Arg128Cys missense AIP 14 82516 1.69664E-4 41258 0 4.78347E-4
11-67256841-G-A p.Arg128His missense AIP 3 82534 3.63487E-5 41267 0 1.68308E-5
11-67256850-G-A p.Ser131Asn missense AIP 1 82530 1.21168E-5 41265 0 NA
11-67256851-C-T p.Ser131Ser synonymous AIP 2 82534 2.42324E-5 41267 0 3.18939E-5
11-67256864-G-T p.Ala136Ser missense AIP 1 82454 1.2128E-5 41227 0 8.42375E-6
11-67256873-G-T p.Asp139Tyr missense AIP 1 82394 1.21368E-5 41197 0 8.43313E-6
11-67256877-C-T p.Ala140Val missense AIP 2 82276 2.43084E-5 41138 0 2.53152E-5
11-67256884-GCA-G p.Gln143fs frameshift AIP 1 82202 1.21652E-5 41101 0 NA
11-67256885-C-G p.Gln143Glu missense AIP 1 82170 1.21699E-5 41085 0 3.18979E-5
11-67256889-A-T p.Asn144Ile missense AIP 1 81992 1.21963E-5 40996 0 NA
11-67256908-C-G p.Phe150Leu missense AIP 1 81316 1.22977E-5 40658 0 4.03502E-6
11-67256933-G-T c.468+7G>T splice_region AIP 1 79230 1.26215E-5 39615 0 NA
11-67257148-C-T n.800C>T splice_region AIP 5 31526 1.58599E-4 15763 0 1.2747E-4
11-67257503-C-G c.469-6C>G splice_region AIP 2 81886 2.44242E-5 40943 0 NA
11-67257526-G-A p.Thr162Thr synonymous AIP 3 82314 3.64458E-5 41157 0 2.02947E-4
11-67257556-C-T p.Asp172Asp synonymous AIP 1964 82604 0.0237761 41302 40 0.0420583
11-67257557-G-A p.Glu173Lys missense AIP 18 82692 2.17675E-4 41346 0 2.22916E-4
11-67257574-A-G p.Ala178Ala synonymous AIP 2 82804 2.41534E-5 41402 0 4.01942E-6
11-67257587-C-T p.His183Tyr missense AIP 1 82846 1.20706E-5 41423 0 3.1841E-5
11-67257601-C-T p.Asn187Asn synonymous AIP 3 82896 3.61899E-5 41448 0 3.1839E-5
11-67257602-C-T p.Arg188Trp missense AIP 4 82904 4.82486E-5 41452 0 3.43047E-5
11-67257611-C-T p.Arg191Cys missense AIP 4 82950 4.82218E-5 41475 0 4.24319E-5
11-67257612-G-A p.Arg191His missense AIP 3 82964 3.61603E-5 41482 0 5.92909E-5
11-67257613-C-T p.Arg191Arg synonymous AIP 7 82962 8.4376E-5 41481 0 5.19929E-5
11-67257614-G-A p.Glu192Lys missense AIP 2 82978 2.41028E-5 41489 0 7.19741E-5
11-67257615-A-G p.Glu192Gly missense AIP 1 82986 1.20502E-5 41493 0 0.00100705
11-67257615-A-T p.Glu192Val missense AIP 1 82986 1.20502E-5 41493 0 NA
11-67257617-G-T p.Gly193Trp missense AIP 1 83004 1.20476E-5 41502 0 NA
11-67257627-A-AG p.Glu197fs frameshift AIP 1 83034 1.20433E-5 41517 0 NA
11-67257628-G-A p.Lys196Lys synonymous AIP 2 83042 2.40842E-5 41521 0 3.9968E-6
11-67257631-G-A p.Glu197Glu synonymous AIP 9 83052 1.08366E-4 41526 0 1.09086E-4
11-67257649-C-T p.Tyr203Tyr synonymous AIP 11 83004 1.32524E-4 41502 1 6.25E-4
11-67257683-AAGGTACTGCCTGGAGGCTGAGGGGGAGGATGGATGGAGGGGGGTGTGGAGCCAGGGGGCCCAGGTCTACAGCTTCTCCCCGCTCCCTGCCCCCATACTCCC-A p.Lys215fs frameshift AIP 9 82768 1.08738E-4 41384 1 NA
11-67257692-C-T c.645+7C>T splice_region AIP 2 82572 2.42213E-5 41286 0 4.00542E-6
11-67257800-C-T p.Ser220Phe missense AIP 1 79160 1.26326E-5 39580 0 NA
11-67257803-C-T p.Pro221Leu missense AIP 1 79302 1.261E-5 39651 0 4.02075E-6
11-67257813-C-T p.Ile224Ile synonymous AIP 1 79162 1.26323E-5 39581 0 NA
11-67257823-C-A p.Gln228Lys missense AIP 71950 77064 0.93364 38532 34438 0.990625
11-67257833-C-T p.Thr231Met missense AIP 7 78804 8.8828E-5 39402 0 1.32866E-4
11-67257834-G-A p.Thr231Thr synonymous AIP 12 78634 1.52606E-4 39317 0 4.46343E-4
11-67257836-C-T p.Pro232Leu missense AIP 4 78702 5.08246E-5 39351 0 3.18715E-5
11-67257837-G-A p.Pro232Pro synonymous AIP 1 78680 1.27097E-5 39340 0 1.09363E-4
11-67257848-A-G p.Asn236Ser missense AIP 1 79012 1.26563E-5 39506 0 4.02402E-6
11-67257852-C-T p.Tyr237Tyr synonymous AIP 2 78998 2.53171E-5 39499 0 6.43744E-5
11-67257861-C-T p.Cys240Cys synonymous AIP 6 78800 7.61421E-5 39400 0 6.25E-4
11-67257865-C-G p.Leu242Val missense AIP 2 78830 2.53711E-5 39415 0 3.37041E-5
11-67257868-G-T p.Val243Leu missense AIP 2 78718 2.54071E-5 39359 0 3.18735E-5
11-67257869-T-C p.Val243Ala missense AIP 1 78652 1.27142E-5 39326 0 0.00100705
11-67257873-C-T p.Val244Val synonymous AIP 2 78406 2.55083E-5 39203 0 8.43199E-6
11-67257874-G-A p.Glu245Lys missense AIP 3 78430 3.82507E-5 39215 0 6.37592E-5
11-67257883-T-C p.Tyr248His missense AIP 1 78266 1.27769E-5 39133 0 NA
11-67257885-C-T p.Tyr248Tyr synonymous AIP 2 78100 2.56082E-5 39050 0 3.18695E-5
11-67257891-G-C p.Val250Val synonymous AIP 2 77668 2.57506E-5 38834 0 NA
11-67257894-G-A p.Leu251Leu synonymous AIP 12 77590 1.54659E-4 38795 0 1.94283E-4
11-67257918-C-T p.Asn259Asn synonymous AIP 1 76536 1.30657E-5 38268 0 NA
11-67257923-A-G p.Tyr261Cys missense AIP 1 76058 1.31479E-5 38029 0 1.21998E-5
11-67257924-C-T p.Tyr261Tyr synonymous AIP 1 75708 1.32086E-5 37854 0 4.07408E-6
11-67257924-C-G p.Tyr261* stop_gained AIP 2 75708 2.64173E-5 37854 0 NA
11-67257925-G-A p.Asp262Asn missense AIP 1 75632 1.32219E-5 37816 0 2.03661E-5
11-67257927-C-T p.Asp262Asp splice_region+synonymous AIP 1 75220 1.32943E-5 37610 0 6.3743E-5
11-67257937-C-T p.Arg150Trp missense AIP 8 73808 1.08389E-4 36904 0 6.37511E-5
11-67257937-C-A p.Arg150Arg synonymous AIP 1 73808 1.35487E-5 36904 0 NA
11-67257940-G-T p.Ala151Ser missense AIP 1 73300 1.36426E-5 36650 0 NA
11-67257942-C-A p.Ala151Ala synonymous AIP 1 73260 1.365E-5 36630 0 NA
11-67257944-TGGGCTGCCGG-T p.Arg155fs frameshift AIP 2 73452 2.72287E-5 36726 0 8.22321E-6
11-67257947-G-A p.Gly153Asp missense AIP 2 72922 2.74266E-5 36461 0 1.65682E-5
11-67257952-C-T p.Arg155Trp missense AIP 12 72598 1.65294E-4 36299 0 1.27502E-4
11-67257952-C-A p.Arg155Arg synonymous AIP 1 72598 1.37745E-5 36299 0 NA
11-67257953-G-A p.Arg155Gln missense AIP 3 72386 4.14445E-5 36193 0 1.59418E-4
11-67257954-G-C p.Arg155Arg synonymous AIP 1 72446 1.38034E-5 36223 0 8.76378E-6
11-67257957-G-A p.Gly156Gly synonymous AIP 2 71898 2.78172E-5 35949 0 NA
11-67257961-C-T p.Arg158* stop_gained AIP 1 71264 1.40323E-5 35632 0 1.77787E-5
11-67257966-G-A p.Val159Val synonymous AIP 1 71054 1.40738E-5 35527 0 NA
11-67257969-CAG-C p.Glu162fs frameshift AIP 6 70910 8.46143E-5 35455 0 4.14303E-4
11-67257986-CCTGT-C p.Cys167fs frameshift AIP 1 69400 1.44092E-5 34700 0 NA
11-67258005-A-G p.Gln172Gln synonymous AIP 8 68712 1.16428E-4 34356 0 9.56328E-5
11-67258013-C-G p.Ala175Gly missense AIP 1 68636 1.45696E-5 34318 0 4.60571E-6
11-67258042-C-T p.Arg185Trp missense AIP 1 69966 1.42927E-5 34983 0 2.48373E-5
11-67258042-C-G p.Arg185Gly missense AIP 1 69966 1.42927E-5 34983 0 NA
11-67258046-G-T p.Gly186Val missense AIP 1 70264 1.4232E-5 35132 0 NA
11-67258047-G-T p.Gly186Gly synonymous AIP 1 70306 1.42235E-5 35153 0 NA
11-67258122-T-G c.*66T>G splice_region AIP 1 76216 1.31206E-5 38108 0 NA
11-67258255-G-C c.788-4G>C splice_region AIP 2 81616 2.4505E-5 40808 0 NA
11-67258258-GACA-G p.Asn264del conservative_inframe_deletion AIP 2 81724 2.44726E-5 40862 0 1.59266E-4
11-67258261-A-G p.Asn264Asp missense+splice_region AIP 2 81812 2.44463E-5 40906 0 NA
11-67258263-C-T p.Asn264Asn synonymous AIP 1 81840 1.2219E-5 40920 0 6.28141E-4
11-67258278-C-T p.Phe269Phe synonymous AIP 88 82184 0.00107077 41092 0 5.92758E-4
11-67258285-G-A p.Gly272Ser missense AIP 1 82266 1.21557E-5 41133 0 8.02981E-6
11-67258287-C-T p.Gly272Gly synonymous AIP 1 82258 1.21569E-5 41129 0 NA
11-67258296-C-T p.His275His synonymous AIP 5 82298 6.07548E-5 41149 0 6.25782E-4
11-67258298-C-T p.Ala276Val missense AIP 7 82262 8.5094E-5 41131 0 1.91095E-4
11-67258299-G-A p.Ala276Ala synonymous AIP 1 82272 1.21548E-5 41136 0 4.01352E-6
11-67258301-C-T p.Ala277Val missense AIP 1 82270 1.21551E-5 41135 0 3.18471E-5
11-67258302-C-T p.Ala277Ala synonymous AIP 3 82286 3.64582E-5 41143 0 3.38432E-5
11-67258335-T-C p.Phe288Phe synonymous AIP 2 82310 2.42984E-5 41155 0 NA
11-67258336-G-A p.Ala289Thr missense AIP 1 82318 1.2148E-5 41159 0 NA
11-67258356-C-T p.Asp232Asp splice_region+synonymous AIP 1 82254 1.21575E-5 41127 0 3.18532E-5
11-67258360-G-A p.Ala297Thr missense AIP 1 82178 1.21687E-5 41089 0 1.70651E-5
11-67258362-C-A p.Ala297Ala synonymous AIP 176 82130 0.00214294 41065 1 0.00544794
11-67258367-C-T p.Ala299Val missense AIP 65 82082 7.91891E-4 41041 0 5.60543E-4
11-67258374-G-T p.Val301Val synonymous AIP 4 82084 4.87306E-5 41042 0 5.98649E-5
11-67258377-G-A p.Val302Val synonymous AIP 9 82062 1.09673E-4 41031 0 9.55779E-5
11-67258379-G-A p.Ser303Asn missense AIP 2 82034 2.43801E-5 41017 0 3.18532E-5
11-67258381-C-T p.Arg304* stop_gained AIP 3 81976 3.65961E-5 40988 0 3.18817E-5
11-67258382-G-A p.Arg304Gln missense AIP 220 82004 0.0026828 41002 1 0.00165388
11-67258384-G-A p.Glu305Lys missense AIP 1 81990 1.21966E-5 40995 0 NA
11-67258391-A-G p.Gln307Arg missense AIP 80638 80646 0.999901 40323 40317 1.0
11-67258400-A-G p.Glu310Gly missense AIP 1 81770 1.22294E-5 40885 0 NA
11-67258404-A-G p.Ala311Ala synonymous AIP 1 81652 1.22471E-5 40826 0 NA
11-67258406-G-A p.Arg312Gln missense AIP 2 81628 2.45014E-5 40814 0 0.00125
11-67258411-C-T p.Arg314Trp missense AIP 1 81508 1.22687E-5 40754 0 4.02852E-5
11-67258412-G-A p.Arg314Gln missense AIP 4 81518 4.90689E-5 40759 0 3.18634E-5
11-67258414-CAGA-C p.Lys316del conservative_inframe_deletion AIP 1 81456 1.22766E-5 40728 0 9.55901E-5
11-67258422-C-T p.Asp317Asp synonymous AIP 1 81272 1.23044E-5 40636 0 1.07754E-5
11-67258423-G-A p.Glu318Lys missense AIP 1 81218 1.23125E-5 40609 0 NA
11-67258436-C-T p.Ala322Val missense AIP 1 80670 1.23962E-5 40335 0 1.03455E-4
11-67258437-C-A p.Ala322Ala synonymous AIP 1 80636 1.24014E-5 40318 0 4.21241E-6
11-67258438-C-T p.Arg323Trp missense AIP 1 80540 1.24162E-5 40270 0 7.99233E-5
11-67258444-C-T p.Arg325Trp missense AIP 1 80072 1.24888E-5 40036 0 5.05051E-4
11-67258444-C-A p.Arg325Arg synonymous AIP 1 80072 1.24888E-5 40036 0 1.7229E-4
11-67258445-G-A p.Arg325Gln missense AIP 5 79992 6.25063E-5 39996 0 9.56023E-5
11-67258574-C-G c.*110C>G splice_region AIP 1 51224 1.95221E-5 25612 0 3.18492E-5