Variant

Variant ID Consequence Effect Gene AC AN AF NS NHOM maxEAF
6-106959765-C-T c.-452C>T 5_prime_UTR_premature_start_codon_gain AIM1 3 77390 3.87647E-5 38695 0 1.56468E-5
6-106959780-C-G c.-437C>G 5_prime_UTR_premature_start_codon_gain AIM1 2 77484 2.58118E-5 38742 0 NA
6-106959801-C-T c.-416C>T 5_prime_UTR_premature_start_codon_gain AIM1 9 77296 1.16436E-4 38648 0 3.18512E-5
6-106959816-C-T c.-401C>T 5_prime_UTR_premature_start_codon_gain AIM1 8 77142 1.03705E-4 38571 0 6.37349E-5
6-106960032-C-T c.-185C>T 5_prime_UTR_premature_start_codon_gain AIM1 3 77454 3.87327E-5 38727 0 3.18451E-5
6-106960033-G-T c.-184G>T 5_prime_UTR_premature_start_codon_gain AIM1 1 77488 1.29052E-5 38744 0 NA
6-106960053-C-T c.-164C>T 5_prime_UTR_premature_start_codon_gain AIM1 10 78282 1.27743E-4 39141 0 1.71438E-4
6-106960054-G-T c.-163G>T 5_prime_UTR_premature_start_codon_gain AIM1 1 78296 1.2772E-5 39148 0 NA
6-106960125-T-G c.-92T>G 5_prime_UTR_premature_start_codon_gain AIM1 21 79994 2.6252E-4 39997 0 1.57023E-4
6-106960192-G-T c.-25G>T 5_prime_UTR_premature_start_codon_gain AIM1 5 81414 6.14145E-5 40707 0 6.85448E-5
6-106960217-A-G p.Met1? start_lost AIM1 1 81188 1.23171E-5 40594 0 1.24475E-5
6-106960217-A-T p.Met1? initiator_codon AIM1 1 81188 1.23171E-5 40594 0 4.14917E-6
6-106960235-G-A p.Gly7Ser missense AIM1 1 80756 1.2383E-5 40378 0 4.14391E-6
6-106960236-G-C p.Gly7Ala missense AIM1 1 80752 1.23836E-5 40376 0 1.917E-4
6-106960239-G-A p.Arg8His missense AIM1 2 80854 2.47359E-5 40427 0 1.12198E-5
6-106960242-G-C p.Arg9Thr missense AIM1 1 80902 1.23606E-5 40451 0 3.18613E-5
6-106960245-C-T p.Ser10Leu missense AIM1 130 80780 0.00160931 40390 2 0.00315588
6-106960255-G-A p.Arg13Arg synonymous AIM1 3 81028 3.70242E-5 40514 1 2.22366E-5
6-106960259-G-T p.Gly15Trp missense AIM1 1 81042 1.23393E-5 40521 0 NA
6-106960268-A-G p.Lys18Glu missense AIM1 1 81024 1.2342E-5 40512 0 1.11752E-5
6-106960274-A-G p.Thr20Ala missense AIM1 3 80910 3.70782E-5 40455 0 NA
6-106960277-G-C p.Asp21His missense AIM1 2 80982 2.46968E-5 40491 0 9.56084E-5
6-106960279-C-T p.Asp21Asp synonymous AIM1 1 80942 1.23545E-5 40471 0 NA
6-106960282-C-T p.Ser22Ser synonymous AIM1 58 81106 7.15114E-4 40553 0 0.0013832
6-106960285-C-T p.Pro23Pro synonymous AIM1 1 80992 1.23469E-5 40496 0 3.44931E-5
6-106960289-G-A p.Ala25Thr missense AIM1 4 80950 4.94132E-5 40475 0 3.00489E-5
6-106960293-A-ACG p.Glu28fs frameshift AIM1 1 80916 1.23585E-5 40458 0 NA
6-106960302-T-A p.Leu29His missense AIM1 1 81204 1.23147E-5 40602 0 NA
6-106960311-G-A p.Ser32Asn missense AIM1 1 81246 1.23083E-5 40623 0 5.06586E-4
6-106960312-C-A p.Ser32Arg missense AIM1 2 81196 2.46318E-5 40598 0 NA
6-106960317-C-T p.Ala34Val missense AIM1 5 81192 6.15824E-5 40596 0 1.10813E-5
6-106960322-G-A p.Asp36Asn missense AIM1 1 81194 1.23162E-5 40597 0 6.25E-4
6-106960325-G-A p.Asp37Asn missense AIM1 1 81216 1.23128E-5 40608 0 2.18574E-5
6-106960325-G-T p.Asp37Tyr missense AIM1 2 81216 2.46257E-5 40608 0 0.00101112
6-106960329-C-T p.Ala38Val missense AIM1 1 81196 1.23159E-5 40598 0 4.15165E-6
6-106960333-G-T p.Val39Val synonymous AIM1 2 81256 2.46136E-5 40628 0 5.39363E-5
6-106960336-C-T p.Phe40Phe synonymous AIM1 2 81212 2.46269E-5 40606 0 NA
6-106960337-G-A p.Asp41Asn missense AIM1 1 81196 1.23159E-5 40598 0 6.37389E-5
6-106960337-G-C p.Asp41His missense AIM1 1 81196 1.23159E-5 40598 0 NA
6-106960363-C-T p.Ala49Ala synonymous AIM1 1 81058 1.23368E-5 40529 0 1.65136E-5
6-106960368-A-G p.Asp51Gly missense AIM1 1 81038 1.23399E-5 40519 0 3.21688E-5
6-106960373-GC-AA p.Ala53Asn missense AIM1 1 80856 1.23677E-5 40428 0 NA
6-106960381-G-A p.Ala55Ala synonymous AIM1 1 80656 1.23983E-5 40328 0 NA
6-106960382-G-C p.Glu56Gln missense AIM1 36 80654 4.46351E-4 40327 0 5.61695E-4
6-106960401-C-T p.Pro62Leu missense AIM1 1 80032 1.2495E-5 40016 0 NA
6-106960404-G-C p.Arg63Pro missense AIM1 2 79794 2.50645E-5 39897 0 1.15356E-5
6-106960404-G-A p.Arg63Gln missense AIM1 1 79794 1.25323E-5 39897 0 6.37633E-5
6-106960418-G-A p.Gly68Arg missense AIM1 5 79172 6.31536E-5 39586 0 3.58509E-5
6-106960423-C-T p.Gly69Gly synonymous AIM1 1 79042 1.26515E-5 39521 0 6.3743E-5
6-106960424-G-A p.Val70Ile missense AIM1 1 79024 1.26544E-5 39512 0 NA
6-106960431-C-T p.Ser72Phe missense AIM1 2 78900 2.53485E-5 39450 0 4.34786E-6
6-106960432-C-A p.Ser72Ser synonymous AIM1 104 78874 0.00131856 39437 1 0.00337946
6-106960432-C-T p.Ser72Ser synonymous AIM1 1 78880 1.26775E-5 39440 0 1.23056E-5
6-106960433-G-A p.Ala73Thr missense AIM1 87 78700 0.00110546 39350 0 0.00229137
6-106960433-G-C p.Ala73Pro missense AIM1 1 78702 1.27062E-5 39351 0 NA
6-106960436-G-T p.Ala74Ser missense AIM1 1 78672 1.2711E-5 39336 0 1.23781E-5
6-106960438-G-A p.Ala74Ala synonymous AIM1 1 78632 1.27175E-5 39316 0 NA
6-106960438-G-C p.Ala74Ala synonymous AIM1 1 78632 1.27175E-5 39316 0 3.18735E-5
6-106960438-G-T p.Ala74Ala synonymous AIM1 1 78632 1.27175E-5 39316 0 0.00101215
6-106960447-G-A p.Glu77Glu synonymous AIM1 12718 78116 0.162809 39058 1260 0.264069
6-106960465-T-C p.Gly83Gly synonymous AIM1 2 78000 2.5641E-5 39000 0 NA
6-106960473-G-A p.Gly86Glu missense AIM1 1 77952 1.28284E-5 38976 0 NA
6-106960481-C-T p.Arg89* stop_gained AIM1 1 77528 1.28986E-5 38764 0 1.73545E-5
6-106960497-G-A p.Arg94Gln missense AIM1 1 76794 1.30219E-5 38397 0 NA
6-106960499-A-G p.Ser95Gly missense AIM1 1 76740 1.3031E-5 38370 0 NA
6-106960511-C-T p.Pro99Ser missense AIM1 1 76282 1.31093E-5 38141 0 5.04353E-6
6-106960515-C-A p.Pro100Gln missense AIM1 1 75894 1.31763E-5 37947 0 5.1378E-6
6-106960522-G-A p.Ser102Ser synonymous AIM1 1 75210 1.32961E-5 37605 0 2.6077E-5
6-106960524-C-G p.Ser103Cys missense AIM1 2 75418 2.65189E-5 37709 0 1.06085E-5
6-106960524-C-T p.Ser103Phe missense AIM1 2 75418 2.65189E-5 37709 0 NA
6-106960525-C-T p.Ser103Ser synonymous AIM1 1 75364 1.32689E-5 37682 0 9.57121E-5
6-106960526-C-T p.Pro104Ser missense AIM1 4 75348 5.3087E-5 37674 0 3.19101E-5
6-106960528-C-G p.Pro104Pro synonymous AIM1 3 75214 3.98862E-5 37607 0 1.5953E-4
6-106960531-G-T p.Thr105Thr synonymous AIM1 35 74852 4.67589E-4 37426 0 0.00408998
6-106960534-G-T p.Lys106Asn missense AIM1 1 74828 1.3364E-5 37414 0 NA
6-106960536-G-A p.Arg107Lys missense AIM1 1 74748 1.33783E-5 37374 0 3.17561E-5
6-106960543-C-A p.Gly109Gly synonymous AIM1 3 73976 4.05537E-5 36988 0 0.00205761
6-106960545-GGAGCCGTGCCCTC-G p.Ser111fs frameshift AIM1 1 73978 1.35175E-5 36989 0 NA
6-106960555-C-T p.Ala113Ala synonymous AIM1 1 73280 1.36463E-5 36640 0 NA
6-106960559-G-A p.Glu115Lys missense AIM1 1 72684 1.37582E-5 36342 0 NA
6-106960566-T-C p.Val117Ala missense AIM1 3 71998 4.16678E-5 35999 0 7.49288E-6
6-106960570-CG-TT p.ProAla118ProSer missense AIM1 1 73240 1.36537E-5 36620 0 NA
6-106960576-G-T p.Pro120Pro synonymous AIM1 2 73152 2.73403E-5 36576 0 7.259E-5
6-106960576-G-A p.Pro120Pro synonymous AIM1 1 73152 1.36702E-5 36576 0 NA
6-106960580-G-A p.Ala122Thr missense AIM1 1 73798 1.35505E-5 36899 0 4.07166E-4
6-106960586-G-A p.Gly124Ser missense AIM1 3 73868 4.0613E-5 36934 0 2.63574E-5
6-106960587-G-GC p.Arg126fs frameshift AIM1 1 73886 1.35344E-5 36943 0 1.3174E-5
6-106960595-G-T p.Ala127Ser missense AIM1 1 74168 1.34829E-5 37084 0 6.31154E-6
6-106960613-C-A p.Pro133Thr missense AIM1 3 75916 3.95174E-5 37958 0 0.00409836
6-106960630-C-G p.Pro138Pro synonymous AIM1 1 77354 1.29276E-5 38677 0 NA
6-106960650-A-G p.Lys145Arg missense AIM1 65 78956 8.23243E-4 39478 0 0.00208799
6-106960652-G-A p.Gly146Ser missense AIM1 1 78996 1.26589E-5 39498 0 NA
6-106960653-G-C p.Gly146Ala missense AIM1 3 79018 3.7966E-5 39509 0 NA
6-106960659-C-T p.Ala148Val missense AIM1 1 79224 1.26224E-5 39612 0 3.82907E-5
6-106960661-G-A p.Ala149Thr missense AIM1 3 79338 3.78129E-5 39669 0 0.00152749
6-106960664-G-A p.Glu150Lys missense AIM1 20 79542 2.51439E-4 39771 1 3.18857E-5
6-106960669-C-T p.Ser151Ser synonymous AIM1 1 79630 1.25581E-5 39815 0 2.5507E-4
6-106960672-G-C p.Gly152Gly synonymous AIM1 1 79926 1.25116E-5 39963 0 NA
6-106960683-C-T p.Ala156Val missense AIM1 2 79864 2.50426E-5 39932 0 6.29723E-4
6-106960684-G-T p.Ala156Ala synonymous AIM1 1 79892 1.25169E-5 39946 0 NA
6-106960689-C-T p.Ala158Val missense AIM1 2 80104 2.49675E-5 40052 0 1.46531E-4
6-106960692-T-TC p.Arg161fs frameshift AIM1 1 80336 1.24477E-5 40168 0 NA
6-106960693-C-G p.Ile159Met missense AIM1 1 80370 1.24425E-5 40185 0 3.18796E-5
6-106960694-C-T p.Pro160Ser missense AIM1 2 80412 2.48719E-5 40206 0 4.24448E-4
6-106960698-G-A p.Arg161His missense AIM1 1 80352 1.24452E-5 40176 0 NA
6-106960699-C-T p.Arg161Arg synonymous AIM1 1 80400 1.24378E-5 40200 0 NA
6-106960700-G-A p.Glu162Lys missense AIM1 2 80418 2.48701E-5 40209 0 0.00152905
6-106960702-G-A p.Glu162Glu synonymous AIM1 1 80544 1.24156E-5 40272 0 3.40414E-5
6-106960707-C-T p.Pro164Leu missense AIM1 1 80718 1.23888E-5 40359 0 3.18593E-5
6-106960710-T-C p.Val165Ala missense AIM1 1 80688 1.23934E-5 40344 0 5.27387E-6
6-106960731-C-T p.Pro172Leu missense AIM1 1 81124 1.23268E-5 40562 0 9.55901E-5
6-106960732-G-A p.Pro172Pro synonymous AIM1 1 81118 1.23277E-5 40559 0 NA
6-106960733-G-T p.Glu173* stop_gained AIM1 1 81138 1.23247E-5 40569 0 NA
6-106960734-A-C p.Glu173Ala missense AIM1 1 81146 1.23235E-5 40573 0 4.95368E-6
6-106960742-C-T p.Pro176Ser missense AIM1 1 81238 1.23095E-5 40619 0 NA
6-106960745-G-A p.Glu177Lys missense AIM1 1 81294 1.2301E-5 40647 0 3.18634E-5
6-106960756-G-A p.Arg180Arg synonymous AIM1 7 81462 8.59296E-5 40731 0 6.37024E-5
6-106960759-C-T p.Gly181Gly synonymous AIM1 1 81418 1.22823E-5 40709 0 NA
6-106960760-C-G p.Pro182Ala missense AIM1 2 81452 2.45543E-5 40726 0 9.26698E-6
6-106960761-C-T p.Pro182Leu missense AIM1 1 81448 1.22778E-5 40724 0 NA
6-106960771-C-T p.Asn185Asn synonymous AIM1 1 81562 1.22606E-5 40781 0 4.21517E-4
6-106960780-C-T p.Asn188Asn synonymous AIM1 1 81614 1.22528E-5 40807 0 NA
6-106960781-G-T p.Gly189Cys missense AIM1 1 81612 1.22531E-5 40806 0 NA
6-106960781-G-C p.Gly189Arg missense AIM1 2 81612 2.45062E-5 40806 0 NA
6-106960784-C-G p.Arg190Gly missense AIM1 2 81620 2.45038E-5 40810 0 3.18532E-5
6-106960784-C-T p.Arg190Trp missense AIM1 1 81620 1.22519E-5 40810 0 7.12175E-5
6-106960785-G-A p.Arg190Gln missense AIM1 1 81644 1.22483E-5 40822 0 8.70049E-6
6-106960786-G-A p.Arg190Arg synonymous AIM1 2 81620 2.45038E-5 40810 0 6.88065E-5
6-106960791-A-G p.Glu192Gly missense AIM1 1 81620 1.22519E-5 40810 0 8.60141E-6
6-106960811-C-A p.Leu199Met missense AIM1 2 81718 2.44744E-5 40859 0 4.18936E-5
6-106960820-G-A p.Ala202Thr missense AIM1 1 81760 1.22309E-5 40880 0 6.37064E-5
6-106960821-C-G p.Ala202Gly missense AIM1 2 81746 2.4466E-5 40873 0 4.182E-6
6-106960822-G-A p.Ala202Ala synonymous AIM1 3 81746 3.6699E-5 40873 0 NA
6-106960825-C-T p.Ala203Ala synonymous AIM1 5 81772 6.11456E-5 40886 0 1.59286E-4
6-106960829-G-A p.Ala205Thr missense AIM1 112 81700 0.00137087 40850 0 0.00328907
6-106960830-C-G p.Ala205Gly missense AIM1 1 81660 1.22459E-5 40830 0 1.22258E-5
6-106960830-C-A p.Ala205Glu missense AIM1 4 81660 4.89836E-5 40830 0 6.25782E-4
6-106960847-G-A p.Ala211Thr missense AIM1 2 81512 2.45363E-5 40756 0 7.83962E-5
6-106960847-G-T p.Ala211Ser missense AIM1 1 81512 1.22681E-5 40756 0 NA
6-106960852-C-T p.Asp212Asp synonymous AIM1 2 81490 2.45429E-5 40745 0 8.26856E-6
6-106960853-G-A p.Gly213Ser missense AIM1 4 81494 4.90834E-5 40747 0 3.18593E-5
6-106960859-A-G p.Lys215Glu missense AIM1 1 81416 1.22826E-5 40708 0 1.06908E-5
6-106960865-A-C p.Arg217Arg synonymous AIM1 2 81328 2.45918E-5 40664 0 3.18471E-5
6-106960865-A-G p.Arg217Gly missense AIM1 1 81328 1.22959E-5 40664 0 5.3719E-5
6-106960871-C-A p.His219Asn missense AIM1 1 81196 1.23159E-5 40598 0 0.00151668
6-106960878-G-A p.Gly221Asp missense AIM1 2 80942 2.47091E-5 40471 0 NA
6-106960882-G-A p.Val222Val synonymous AIM1 1 80930 1.23564E-5 40465 0 1.05802E-5
6-106960884-G-A p.Gly223Asp missense AIM1 2 80866 2.47323E-5 40433 0 NA
6-106960888-G-C p.Arg224Ser missense AIM1 1 80762 1.23821E-5 40381 0 NA
6-106960895-G-C p.Val227Leu missense AIM1 8 80666 9.91744E-5 40333 0 1.52492E-4
6-106960910-A-ACCCT p.Lys230fs frameshift AIM1 1 80432 1.24329E-5 40216 0 NA
6-106960913-C-T p.Leu233Phe missense+splice_region AIM1 2 80422 2.48688E-5 40211 0 1.19982E-5
6-106960919-G-A c.698+5G>A splice_region AIM1 2 80342 2.48936E-5 40171 0 4.39599E-6
6-106966999-C-T c.699-7C>T splice_region AIM1 1 47572 2.10208E-5 23786 0 6.39397E-5
6-106967024-T-C p.His239His synonymous AIM1 11 83222 1.32177E-4 41611 0 9.55171E-5
6-106967034-A-G p.Asn243Asp missense AIM1 1 83246 1.20126E-5 41623 0 NA
6-106967036-T-G p.Asn243Lys missense AIM1 21 83254 2.5224E-4 41627 0 0.00100705
6-106967044-C-T p.Thr246Ile missense AIM1 1 83262 1.20103E-5 41631 0 3.31082E-5
6-106967053-A-C p.Asn249Thr missense AIM1 3 83280 3.60231E-5 41640 0 8.25996E-6
6-106967061-A-G p.Ser252Gly missense AIM1 1 83298 1.20051E-5 41649 0 8.25273E-6
6-106967062-G-C p.Ser252Thr missense AIM1 1 83300 1.20048E-5 41650 0 NA
6-106967076-C-T p.His257Tyr missense AIM1 2 83326 2.40021E-5 41663 0 3.18593E-5
6-106967084-A-T p.Pro259Pro synonymous AIM1 2 83338 2.39987E-5 41669 0 NA
6-106967093-G-T p.Gln262His missense AIM1 2 83342 2.39975E-5 41671 0 NA
6-106967107-G-A p.Gly267Asp missense AIM1 158 83340 0.00189585 41670 2 0.00352467
6-106967120-C-G p.Thr271Thr synonymous AIM1 1 83354 1.1997E-5 41677 0 8.24498E-6
6-106967134-T-G p.Phe276Cys missense AIM1 1 83360 1.19962E-5 41680 0 NA
6-106967134-T-C p.Phe276Ser missense AIM1 1 83360 1.19962E-5 41680 0 8.24579E-6
6-106967145-C-T p.Arg280Trp missense AIM1 2 83358 2.39929E-5 41679 0 3.18228E-5
6-106967146-G-A p.Arg280Gln missense AIM1 10 83360 1.19962E-4 41680 0 2.54939E-4
6-106967151-AAC-A p.Asn282fs frameshift AIM1 1 83354 1.1997E-5 41677 0 2.06169E-4
6-106967155-G-A p.Ser283Asn missense AIM1 1 83348 1.19979E-5 41674 0 NA
6-106967167-A-G p.His287Arg missense AIM1 5 83342 5.99938E-5 41671 0 6.25E-4
6-106967175-A-G p.Ile290Val missense AIM1 1 83336 1.19996E-5 41668 0 3.1839E-5
6-106967178-C-G p.Arg291Gly missense AIM1 11 83334 1.31999E-4 41667 0 3.71207E-4
6-106967179-G-A p.Arg291Gln missense AIM1 3 83332 3.60006E-5 41666 0 7.95912E-6
6-106967185-A-C p.Gln293Pro missense AIM1 20321 83084 0.244584 41542 2601 0.311875
6-106967185-AA-CG p.Gln293Pro missense AIM1 2 83328 2.40015E-5 41664 0 NA
6-106967188-G-A p.Arg294Lys missense AIM1 4 83322 4.80065E-5 41661 0 2.86569E-4
6-106967190-A-G p.Asn295Asp missense AIM1 13 83318 1.56029E-4 41659 0 3.1837E-4
6-106967199-G-T p.Ala298Ser missense AIM1 1 83318 1.20022E-5 41659 0 NA
6-106967202-T-C p.Ser299Pro missense AIM1 1 83312 1.20031E-5 41656 0 NA
6-106967206-G-A p.Ser300Asn missense AIM1 1 83306 1.20039E-5 41653 0 8.25491E-6
6-106967212-C-T p.Thr302Met missense AIM1 2 83286 2.40136E-5 41643 0 9.55962E-5
6-106967226-G-A p.Ala307Thr missense AIM1 8 83212 9.614E-5 41606 0 1.27405E-4
6-106967238-T-G p.Leu311Val missense AIM1 1 83128 1.20296E-5 41564 0 3.98175E-6
6-106967251-C-A p.Ala315Asp missense AIM1 10 82984 1.20505E-4 41492 0 3.39011E-4
6-106967260-T-C p.Met318Thr missense AIM1 12 82870 1.44805E-4 41435 0 9.64858E-4
6-106967288-A-T p.Pro327Pro synonymous AIM1 1 82452 1.21283E-5 41226 0 NA
6-106967293-G-A p.Ser329Asn missense AIM1 2 82386 2.4276E-5 41193 0 3.99374E-6
6-106967296-C-T p.Pro330Leu missense AIM1 1 82340 1.21448E-5 41170 0 3.99396E-6
6-106967305-G-C p.Gly333Ala missense AIM1 1 82318 1.2148E-5 41159 0 6.61518E-5
6-106967308-T-G p.Val334Gly missense AIM1 2 82316 2.42966E-5 41158 0 NA
6-106967312-G-C p.Leu335Leu synonymous AIM1 1 82350 1.21433E-5 41175 0 1.59698E-5
6-106967320-A-G p.Glu338Gly missense AIM1 2 82342 2.42889E-5 41171 0 3.99198E-6
6-106967328-A-G p.Ile341Val missense AIM1 5 82410 6.06722E-5 41205 0 3.1841E-5
6-106967329-T-C p.Ile341Thr missense AIM1 1 82436 1.21306E-5 41218 0 5.03525E-4
6-106967336-C-T p.Thr343Thr synonymous AIM1 1 82438 1.21303E-5 41219 0 8.26706E-6
6-106967343-A-G p.Thr346Ala missense AIM1 1 82496 1.21218E-5 41248 0 7.97824E-6
6-106967345-C-T p.Thr346Thr synonymous AIM1 1 82516 1.21189E-5 41258 0 6.25E-4
6-106967346-G-A p.Val347Ile missense AIM1 5 82550 6.05694E-5 41275 0 6.25E-4
6-106967358-G-A p.Glu351Lys missense AIM1 110 82652 0.00133088 41326 1 0.00289772
6-106967374-C-T p.Thr356Ile missense AIM1 1 82790 1.20788E-5 41395 0 NA
6-106967375-C-T p.Thr356Thr synonymous AIM1 1 82806 1.20764E-5 41403 0 4.78324E-5
6-106967388-G-GGA p.Asp362fs frameshift AIM1 1 82902 1.20624E-5 41451 0 NA
6-106967391-G-A p.Asp362Asn missense AIM1 1 82938 1.20572E-5 41469 0 1.19499E-5
6-106967398-C-T p.Ser364Phe missense AIM1 11 82982 1.32559E-4 41491 0 4.78817E-4
6-106967410-C-T p.Ala368Val missense AIM1 1 83034 1.20433E-5 41517 0 NA
6-106967461-C-A p.Ala385Asp missense AIM1 1 83208 1.20181E-5 41604 0 NA
6-106967466-T-C p.Cys387Arg missense AIM1 1 83224 1.20158E-5 41612 0 NA
6-106967480-A-G p.Pro391Pro synonymous AIM1 1 83232 1.20146E-5 41616 0 1.03434E-4
6-106967482-T-C p.Val392Ala missense AIM1 17 83216 2.04288E-4 41608 0 5.41436E-4
6-106967501-T-G p.Pro398Pro synonymous AIM1 2 83210 2.40356E-5 41605 0 3.97845E-6
6-106967515-A-G p.Lys403Arg missense AIM1 1 83238 1.20137E-5 41619 0 9.8894E-5
6-106967526-AAGG-A p.Glu408del disruptive_inframe_deletion AIM1 1 83256 1.20111E-5 41628 0 3.97861E-6
6-106967535-TCA-T p.Ser410fs frameshift AIM1 1 83274 1.20085E-5 41637 0 NA
6-106967542-C-T p.Ala412Val missense AIM1 1 83276 1.20083E-5 41638 0 NA
6-106967554-A-G p.Lys416Arg missense AIM1 48 83292 5.76286E-4 41646 0 0.00149691
6-106967563-T-A p.Val419Glu missense AIM1 1 83304 1.20042E-5 41652 0 NA
6-106967564-A-T p.Val419Val synonymous AIM1 54 83302 6.48244E-4 41651 0 0.004375
6-106967564-A-G p.Val419Val synonymous AIM1 3 83304 3.60127E-5 41652 0 1.98904E-5
6-106967565-C-T p.Leu420Phe missense AIM1 3 83308 3.60109E-5 41654 0 1.40111E-4
6-106967580-G-T p.Asp425Tyr missense AIM1 2 83348 2.39958E-5 41674 0 NA
6-106967584-C-G p.Thr426Arg missense AIM1 13 83350 1.55969E-4 41675 0 0.00100705
6-106967586-G-A p.Ala427Thr missense AIM1 2 83346 2.39964E-5 41673 0 8.24022E-6
6-106967605-C-G p.Thr433Ser missense AIM1 1 83352 1.19973E-5 41676 0 NA
6-106967607-G-T p.Val434Leu missense AIM1 2 83354 2.3994E-5 41677 0 3.18492E-5
6-106967608-T-C p.Val434Ala missense AIM1 1 83352 1.19973E-5 41676 0 NA
6-106967610-G-C p.Asp435His missense AIM1 1 83352 1.19973E-5 41676 0 3.97719E-6
6-106967614-C-T p.Thr436Ile missense AIM1 112 83338 0.00134392 41669 0 0.00293012
6-106967632-C-T p.Thr442Met missense AIM1 1 83318 1.20022E-5 41659 0 3.29582E-5
6-106967632-C-A p.Thr442Lys missense AIM1 1 83318 1.20022E-5 41659 0 6.37064E-5
6-106967633-G-A p.Thr442Thr synonymous AIM1 46 83308 5.52168E-4 41654 1 9.8789E-4
6-106967635-C-T p.Ala443Val missense AIM1 1 83300 1.20048E-5 41650 0 3.18695E-5
6-106967667-T-G p.Ser454Ala missense AIM1 2 83188 2.40419E-5 41594 0 1.59091E-5
6-106967667-TCA-T p.Gln455fs frameshift AIM1 2 83188 2.40419E-5 41594 0 NA
6-106967672-G-C p.Gln455His missense AIM1 2 83140 2.40558E-5 41570 0 7.95494E-6
6-106967677-C-T p.Pro457Leu missense AIM1 1 83112 1.2032E-5 41556 0 NA
6-106967682-G-A p.Glu459Lys missense AIM1 1 83034 1.20433E-5 41517 0 2.38652E-5
6-106967684-G-A p.Glu459Glu synonymous AIM1 1 83010 1.20467E-5 41505 0 8.24239E-6
6-106967688-T-C p.Ser461Pro missense AIM1 3 82946 3.61681E-5 41473 0 8.24334E-6
6-106967716-C-T p.Ala470Val missense AIM1 1 82418 1.21333E-5 41209 0 8.25123E-6
6-106967718-C-T p.Pro471Ser missense AIM1 1 82408 1.21347E-5 41204 0 NA
6-106967720-C-T p.Pro471Pro synonymous AIM1 7 82396 8.49556E-5 41198 0 8.35741E-5
6-106967721-G-C p.Ala472Pro missense AIM1 4 82378 4.85567E-5 41189 1 6.37186E-5
6-106967721-G-A p.Ala472Thr missense AIM1 1 82380 1.21389E-5 41190 0 1.99E-5
6-106967722-C-T p.Ala472Val missense AIM1 2 82384 2.42766E-5 41192 0 NA
6-106967723-T-C p.Ala472Ala synonymous AIM1 4 82388 4.85508E-5 41194 0 1.19389E-5
6-106967726-T-A p.Pro473Pro synonymous AIM1 1 82400 1.21359E-5 41200 0 3.97978E-6
6-106967729-G-A p.Gly474Gly synonymous AIM1 1 82340 1.21448E-5 41170 0 8.25491E-6
6-106967734-T-C p.Val476Ala missense AIM1 2 82300 2.43013E-5 41150 0 8.25369E-5
6-106967743-A-T p.Asp479Val missense AIM1 1 82328 1.21465E-5 41164 0 NA
6-106967748-T-C p.Cys481Arg missense AIM1 1 82404 1.21353E-5 41202 0 NA
6-106967750-T-C p.Cys481Cys synonymous AIM1 1 82388 1.21377E-5 41194 0 6.37227E-5
6-106967770-G-A p.Ser488Asn missense AIM1 5 82508 6.06002E-5 41254 0 1.59215E-4
6-106967773-TC-T p.Pro490fs frameshift AIM1 1 82488 1.2123E-5 41244 0 3.98099E-6
6-106967778-T-C p.Cys491Arg missense AIM1 18065 82338 0.219401 41169 2071 0.21853
6-106967790-A-G p.Lys495Glu missense AIM1 1 82790 1.20788E-5 41395 0 8.25764E-6
6-106967799-G-A p.Glu498Lys missense AIM1 1 82912 1.2061E-5 41456 0 NA
6-106967808-A-G p.Lys501Glu missense AIM1 2 83040 2.40848E-5 41520 0 3.97855E-6
6-106967813-ATG-A p.Val504fs frameshift AIM1 1 83110 1.20322E-5 41555 0 NA
6-106967813-A-C p.Gly502Gly synonymous AIM1 1 83110 1.20322E-5 41555 0 3.97779E-6
6-106967813-A-T p.Gly502Gly synonymous AIM1 1 83110 1.20322E-5 41555 0 NA
6-106967817-G-C p.Val504Leu missense AIM1 2 83146 2.40541E-5 41573 0 7.95602E-6
6-106967820-T-C p.Leu505Leu synonymous AIM1 2 83162 2.40494E-5 41581 0 3.18492E-5
6-106967831-T-C p.Ser508Ser synonymous AIM1 494 83234 0.00593507 41617 6 0.005625
6-106967832-C-T p.Arg509Cys missense AIM1 9 83224 1.08142E-4 41612 0 1.91131E-4
6-106967833-G-A p.Arg509His missense AIM1 676 83222 0.00812285 41611 12 0.0174908
6-106967835-C-T p.Gln510* stop_gained AIM1 2 83232 2.40292E-5 41616 0 1.19335E-5
6-106967837-G-A p.Gln510Gln synonymous AIM1 1 83240 1.20135E-5 41620 0 NA
6-106967838-A-C p.Asn511His missense AIM1 1 83246 1.20126E-5 41623 0 NA
6-106967839-A-G p.Asn511Ser missense AIM1 1 83240 1.20135E-5 41620 0 NA
6-106967843-T-C p.Asn512Asn synonymous AIM1 4 83258 4.80434E-5 41629 0 8.24769E-6
6-106967846-G-GA p.Met515fs frameshift AIM1 2 83254 2.40229E-5 41627 0 8.24756E-6
6-106967869-G-A p.Gly521Glu missense AIM1 1 83286 1.20068E-5 41643 0 NA
6-106967874-G-T p.Glu523* stop_gained AIM1 2 83276 2.40165E-5 41638 0 NA
6-106967900-G-GCGT p.Arg532dup conservative_inframe_insertion AIM1 1 83310 1.20034E-5 41655 0 NA
6-106967901-C-T p.Arg532Cys missense AIM1 1 83308 1.20036E-5 41654 0 7.41974E-5
6-106967902-G-A p.Arg532His missense AIM1 39 83316 4.68097E-4 41658 0 6.25E-4
6-106967904-A-C p.Ser533Arg missense AIM1 1 83324 1.20013E-5 41662 0 NA
6-106967918-G-A p.Val537Val synonymous AIM1 1 83330 1.20005E-5 41665 0 4.94658E-5
6-106967921-AAGTGAGTGTCCATCC-A p.Ser539_Ser543del disruptive_inframe_deletion AIM1 1 83332 1.20002E-5 41666 0 4.12188E-5
6-106967924-T-G p.Ser539Arg missense AIM1 1 83326 1.20011E-5 41663 0 3.97772E-6
6-106967928-T-C p.Cys541Arg missense AIM1 14 83332 1.68003E-4 41666 0 1.59337E-4
6-106967930-T-G p.Cys541Trp missense AIM1 3 83330 3.60014E-5 41665 0 4.12242E-5
6-106967936-C-A p.Ser543Ser synonymous AIM1 69 83342 8.27914E-4 41671 0 0.0020141
6-106967937-A-G p.Arg544Gly missense AIM1 1 83344 1.19985E-5 41672 0 3.9782E-6
6-106967945-C-T p.Leu546Leu synonymous AIM1 8 83340 9.59923E-5 41670 0 6.37105E-5
6-106967946-G-A p.Val547Ile missense AIM1 14 83340 1.67987E-4 41670 0 1.9787E-4
6-106967946-G-C p.Val547Leu missense AIM1 1 83340 1.1999E-5 41670 0 3.29783E-5
6-106967947-T-A p.Val547Asp missense AIM1 4 83338 4.79973E-5 41669 0 9.55962E-5
6-106967962-T-G p.Phe552Cys missense AIM1 1 83330 1.20005E-5 41665 0 3.18715E-5
6-106967963-C-T p.Phe552Phe synonymous AIM1 7 83314 8.40195E-5 41657 0 1.27478E-4
6-106967964-G-A p.Val553Met missense AIM1 1 83316 1.20025E-5 41658 0 3.18654E-5
6-106967969-C-T p.Leu554Leu synonymous AIM1 24 83322 2.88039E-4 41661 0 0.00125
6-106967972-C-A p.Pro555Pro synonymous AIM1 1 83320 1.20019E-5 41660 0 3.18654E-5
6-106967972-C-T p.Pro555Pro synonymous AIM1 2 83320 2.40038E-5 41660 0 4.12256E-5
6-106967973-G-A p.Val556Met missense AIM1 1 83314 1.20028E-5 41657 0 1.27445E-4
6-106967980-G-T p.Ser558Ile missense AIM1 1 83304 1.20042E-5 41652 0 3.97912E-6
6-106967996-C-T p.Ser563Ser synonymous AIM1 2 83288 2.40131E-5 41644 0 NA
6-106968007-T-A p.Ile567Asn missense AIM1 9 83280 1.08069E-4 41640 0 1.27486E-4
6-106968009-C-T p.Pro568Ser missense AIM1 1 83266 1.20097E-5 41633 0 3.18817E-5
6-106968010-C-T p.Pro568Leu missense AIM1 5 83270 6.00456E-5 41635 0 5.03525E-4
6-106968016-G-C p.Ser570Thr missense AIM1 1 83270 1.20091E-5 41635 0 3.97867E-6
6-106968029-A-G p.Arg574Arg synonymous AIM1 3 83286 3.60205E-5 41643 0 7.95608E-5
6-106968030-G-A p.Glu575Lys missense AIM1 4 83282 4.80296E-5 41641 0 1.64861E-5
6-106968034-T-A p.Val576Glu missense AIM1 6 83284 7.20426E-5 41642 0 8.24294E-6
6-106968042-C-A p.Pro579Thr missense AIM1 1 83272 1.20088E-5 41636 0 1.98913E-5
6-106968045-A-G p.Thr580Ala missense AIM1 1 83280 1.20077E-5 41640 0 NA
6-106968054-A-C p.Ser583Arg missense AIM1 1 83294 1.20057E-5 41647 0 3.97769E-6
6-106968067-A-G p.Glu587Gly missense AIM1 1 83288 1.20065E-5 41644 0 3.18674E-5
6-106968070-T-A p.Val588Glu missense AIM1 3 83282 3.60222E-5 41641 0 NA
6-106968077-C-T p.Ser590Ser synonymous AIM1 3 83276 3.60248E-5 41638 0 6.25E-4
6-106968077-CG-C p.Val591fs frameshift AIM1 2 83276 2.40165E-5 41638 0 NA
6-106968078-G-A p.Val591Ile missense AIM1 7 83274 8.40599E-5 41637 0 9.14971E-5
6-106968085-G-A p.Ser593Asn missense AIM1 1 83264 1.201E-5 41632 0 8.24171E-6
6-106968091-C-T p.Ala595Val missense AIM1 552 83242 0.00663127 41621 7 0.0150666
6-106968092-TC-T p.Pro597fs frameshift AIM1 5 83258 6.00543E-5 41629 0 4.41629E-4
6-106968093-C-G p.Pro596Ala missense AIM1 2 83262 2.40206E-5 41631 0 3.29935E-5
6-106968097-C-G p.Pro597Arg missense AIM1 355 83262 0.00426365 41631 5 0.00949407
6-106968100-A-G p.Gln598Arg missense AIM1 1 83256 1.20111E-5 41628 0 8.24321E-6
6-106968103-A-T p.Glu599Val missense AIM1 3 83260 3.60317E-5 41630 0 8.75239E-5
6-106968105-G-C p.Glu600Gln missense AIM1 1 83266 1.20097E-5 41633 0 NA
6-106968123-C-A p.His606Asn missense AIM1 1 83184 1.20215E-5 41592 0 NA
6-106968124-A-G p.His606Arg missense AIM1 1 83170 1.20236E-5 41585 0 7.9583E-6
6-106968129-CA-C p.His608fs frameshift AIM1 1 83164 1.20244E-5 41582 0 NA
6-106968131-T-C p.His608His synonymous AIM1 1 83132 1.20291E-5 41566 0 6.25E-4
6-106968133-G-A p.Cys609Tyr missense AIM1 1 83114 1.20317E-5 41557 0 NA
6-106968147-G-A p.Ala614Thr missense AIM1 1 82978 1.20514E-5 41489 0 6.59816E-5
6-106968148-C-T p.Ala614Val missense AIM1 3 82974 3.61559E-5 41487 0 3.29908E-5
6-106968149-G-A p.Ala614Ala synonymous AIM1 5 82974 6.02598E-5 41487 0 1.59257E-5
6-106968160-G-T p.Gly618Val missense AIM1 8 82904 9.64972E-5 41452 0 1.64978E-5
6-106968172-TAC-T p.Pro623fs frameshift AIM1 2 82848 2.41406E-5 41424 0 1.99146E-5
6-106968175-C-CTG p.Pro624fs frameshift AIM1 2 82828 2.41464E-5 41414 0 1.99159E-5
6-106968175-C-T p.Pro623Leu missense AIM1 1 82828 1.20732E-5 41414 0 1.65003E-5
6-106968176-G-A p.Pro623Pro synonymous AIM1 28 82804 3.38148E-4 41402 0 2.86752E-4
6-106968187-A-T p.Glu627Val missense AIM1 1 82798 1.20776E-5 41399 0 NA
6-106968192-ACT-A p.Leu630fs frameshift AIM1 1 82810 1.20758E-5 41405 0 8.25273E-6
6-106968202-T-C p.Ile632Thr missense AIM1 9 82748 1.08764E-4 41374 1 3.98302E-6
6-106968205-A-G p.Gln633Arg missense AIM1 110 82764 0.00132908 41382 1 0.00289975
6-106968234-C-G p.Leu643Val missense AIM1 6 82688 7.25619E-5 41344 0 9.56084E-5
6-106968234-CT-C p.Leu643fs frameshift AIM1 1 82688 1.20937E-5 41344 0 NA
6-106968237-A-G p.Met644Val missense AIM1 1 82672 1.2096E-5 41336 0 NA
6-106968237-A-C p.Met644Leu missense AIM1 4 82672 4.8384E-5 41336 0 NA
6-106968250-G-T p.Ser648Ile missense AIM1 146 82624 0.00176704 41312 0 0.00141829
6-106968256-C-A p.Thr650Asn missense AIM1 19 82558 2.30141E-4 41279 0 1.95241E-4
6-106968256-C-T p.Thr650Ile missense AIM1 1 82558 1.21127E-5 41279 0 8.26078E-6
6-106968261-T-A p.Ser652Thr missense AIM1 7 82510 8.48382E-5 41255 0 0.00125
6-106968262-C-G p.Ser652Cys missense AIM1 1 82532 1.21165E-5 41266 0 NA
6-106968266-C-T p.Pro653Pro synonymous AIM1 2 82538 2.42313E-5 41269 0 5.17998E-5
6-106968268-G-A p.Ser654Asn missense AIM1 1 82514 1.21192E-5 41257 0 NA
6-106968272-C-T p.Ser655Ser synonymous AIM1 2 82496 2.42436E-5 41248 0 1.9835E-4
6-106968273-G-A p.Gly656Arg missense AIM1 2 82508 2.42401E-5 41254 0 6.25E-4
6-106968286-C-T p.Ala660Val missense AIM1 2 82528 2.42342E-5 41264 0 6.25E-4
6-106968288-A-G p.Thr661Ala missense AIM1 3 82552 3.63407E-5 41276 0 6.61037E-5
6-106968294-C-T p.Gln663* stop_gained AIM1 1 82600 1.21065E-5 41300 0 3.98318E-6
6-106968298-G-C p.Arg664Thr missense AIM1 1 82642 1.21004E-5 41321 0 NA
6-106968310-C-A p.Thr668Asn missense AIM1 1 82762 1.20828E-5 41381 0 1.991E-5
6-106968314-T-TA p.Thr670fs frameshift AIM1 9 82800 1.08696E-4 41400 0 9.55657E-5
6-106968316-C-T p.Thr670Ile missense AIM1 1 82806 1.20764E-5 41403 0 3.98197E-6
6-106968327-G-T p.Asp674Tyr missense AIM1 1 82906 1.20619E-5 41453 0 NA
6-106968333-C-G p.Pro676Ala missense AIM1 1 82956 1.20546E-5 41478 0 5.78101E-5
6-106968335-T-C p.Pro676Pro synonymous AIM1 1 82988 1.20499E-5 41494 0 3.9807E-6
6-106968360-G-C p.Gly685Arg missense AIM1 6 83194 7.21206E-5 41597 0 5.96868E-5
6-106968369-G-A p.Asp688Asn missense AIM1 555 83216 0.00666939 41608 7 0.0150975
6-106968375-G-A p.Val690Ile missense AIM1 1 83234 1.20143E-5 41617 0 2.47799E-5
6-106968391-C-A p.Ser695Tyr missense AIM1 5 83242 6.00658E-5 41621 0 6.37227E-5
6-106968433-G-A p.Ser709Asn missense AIM1 3 83240 3.60404E-5 41620 0 5.79029E-5
6-106968434-C-T p.Ser709Ser synonymous AIM1 2 83236 2.40281E-5 41618 0 6.37064E-5
6-106968435-G-A p.Ala710Thr missense AIM1 37 83238 4.44509E-4 41619 0 9.5584E-4
6-106968444-A-G p.Met713Val missense AIM1 5 83242 6.00658E-5 41621 0 3.30857E-5
6-106968448-C-T p.Pro714Leu missense AIM1 6 83250 7.20721E-5 41625 0 3.30868E-5
6-106968460-A-T p.Lys718Met missense AIM1 1 83292 1.2006E-5 41646 0 3.98603E-6
6-106968460-A-G p.Lys718Arg missense AIM1 3 83292 3.60179E-5 41646 0 6.61649E-5
6-106968465-G-T p.Ala720Ser missense AIM1 1 83300 1.20048E-5 41650 0 7.96927E-6
6-106968476-A-C p.Pro723Pro synonymous AIM1 1 83298 1.20051E-5 41649 0 NA
6-106968477-A-G p.Asn724Asp missense AIM1 1 83304 1.20042E-5 41652 0 3.18431E-5
6-106968489-C-T p.Pro728Ser missense AIM1 1 83294 1.20057E-5 41647 0 NA
6-106968494-C-T p.His729His synonymous AIM1 12 83306 1.44047E-4 41653 0 9.95215E-5
6-106968498-G-C p.Ala731Pro missense AIM1 1 83300 1.20048E-5 41650 0 NA
6-106968511-T-G p.Ile735Ser missense AIM1 4 83298 4.80204E-5 41649 0 1.98948E-5
6-106968536-G-T p.Val743Val synonymous AIM1 2 83322 2.40033E-5 41661 0 5.03525E-4
6-106968547-A-G p.Lys747Arg missense AIM1 3 83324 3.6004E-5 41662 0 3.18674E-5
6-106968567-G-A p.Gly754Arg missense AIM1 1 83368 1.1995E-5 41684 0 NA
6-106968577-A-G p.Lys757Arg missense AIM1 2 83374 2.39883E-5 41687 0 6.36274E-5
6-106968589-C-T p.Pro761Leu missense AIM1 1 83370 1.19947E-5 41685 0 NA
6-106968596-G-A p.Met763Ile missense AIM1 2 83382 2.3986E-5 41691 0 9.55779E-5
6-106968600-C-T p.Pro765Ser missense AIM1 5 83382 5.9965E-5 41691 0 2.86752E-4
6-106968601-C-T p.Pro765Leu missense AIM1 2 83384 2.39854E-5 41692 0 3.18796E-5
6-106968602-G-A p.Pro765Pro synonymous AIM1 6 83384 7.19563E-5 41692 0 9.06439E-5
6-106968612-T-G p.Leu769Val missense AIM1 1 83378 1.19936E-5 41689 0 NA
6-106968652-A-C p.Lys782Thr missense AIM1 8 83366 9.59624E-5 41683 0 1.27405E-4
6-106968654-C-T p.Arg783Cys missense AIM1 1 83366 1.19953E-5 41683 0 5.17203E-5
6-106968655-G-A p.Arg783His missense AIM1 1 83358 1.19964E-5 41679 0 8.24429E-6
6-106968658-C-T p.Ala784Val missense AIM1 3 83362 3.59876E-5 41681 1 8.24484E-6
6-106968671-G-A p.Gln788Gln synonymous AIM1 210 83350 0.0025195 41675 0 0.00312181
6-106968674-C-T p.Ser789Ser synonymous AIM1 1225 83348 0.0146974 41674 7 0.00948637
6-106968675-G-A p.Val790Ile missense AIM1 5 83358 5.99822E-5 41679 0 4.12548E-5
6-106968690-C-T p.Leu795Leu synonymous AIM1 1 83374 1.19941E-5 41687 0 8.25464E-6
6-106968701-C-T p.Asn798Asn synonymous AIM1 1 83366 1.19953E-5 41683 0 NA
6-106968710-G-T p.Gly801Gly synonymous AIM1 1 83366 1.19953E-5 41683 0 NA
6-106968733-C-T p.Pro809Leu missense AIM1 1 83354 1.1997E-5 41677 0 3.18654E-5
6-106968734-G-A p.Pro809Pro synonymous AIM1 3 83360 3.59885E-5 41680 0 8.26378E-6
6-106968751-AGAACAGG-A p.Asn816fs frameshift AIM1 1 83358 1.19964E-5 41679 0 NA
6-106968753-A-G p.Asn816Asp missense AIM1 1 83354 1.1997E-5 41677 0 NA
6-106968759-G-A p.Asp818Asn missense AIM1 1 83362 1.19959E-5 41681 0 3.18532E-5
6-106968762-G-A p.Val819Ile missense AIM1 13 83352 1.55965E-4 41676 0 0.00125
6-106968765-A-T p.Thr820Ser missense AIM1 5 83356 5.99837E-5 41678 0 3.18258E-5
6-106968782-G-A p.Lys825Lys synonymous AIM1 1 83348 1.19979E-5 41674 0 3.18512E-5
6-106968787-C-T p.Ser827Leu missense AIM1 1 83342 1.19988E-5 41671 0 3.18837E-5
6-106968788-G-A p.Ser827Ser synonymous AIM1 1 83344 1.19985E-5 41672 0 2.47337E-5
6-106968805-C-T p.Ala833Val missense AIM1 1 83298 1.20051E-5 41649 0 8.24348E-6
6-106968820-T-G p.Leu838Trp missense AIM1 12 83262 1.44123E-4 41631 0 6.36902E-5
6-106968824-A-G p.Leu839Leu synonymous AIM1 1 83248 1.20123E-5 41624 0 3.18512E-5
6-106968824-A-C p.Leu839Phe missense AIM1 2 83248 2.40246E-5 41624 0 8.24307E-6
6-106968827-T-G p.Ser840Ser synonymous AIM1 1 83230 1.20149E-5 41615 0 NA
6-106968842-C-G p.Asp845Glu missense AIM1 1 83184 1.20215E-5 41592 0 8.24321E-6
6-106968850-T-C p.Phe848Ser missense AIM1 15 83174 1.80345E-4 41587 0 1.31327E-4
6-106968854-T-TAAATGG p.Ser849_Pro850insLysTrp conservative_inframe_insertion AIM1 1 83150 1.20265E-5 41575 0 NA
6-106968855-C-T p.Pro850Ser missense AIM1 1 83144 1.20273E-5 41572 0 NA
6-106968859-C-T p.Ser851Phe missense AIM1 1 83134 1.20288E-5 41567 0 NA
6-106968873-A-G p.Asn856Asp missense AIM1 1 83126 1.20299E-5 41563 0 NA
6-106968881-G-A p.Met858Ile missense AIM1 7 83138 8.41974E-5 41569 0 6.59402E-5
6-106968885-A-G p.Thr860Ala missense AIM1 3 83142 3.60828E-5 41571 0 8.24239E-6
6-106968886-C-T p.Thr860Met missense AIM1 2 83134 2.40575E-5 41567 0 2.78583E-5
6-106968887-G-A p.Thr860Thr synonymous AIM1 7 83134 8.42014E-5 41567 0 6.36983E-5
6-106968898-C-T p.Thr864Ile missense AIM1 1 83178 1.20224E-5 41589 0 3.97921E-6
6-106968908-C-CA p.Gly868fs frameshift AIM1 1 83224 1.20158E-5 41612 0 NA
6-106968909-G-GAA p.Gly868fs frameshift AIM1 1 83236 1.2014E-5 41618 0 NA
6-106968909-G-A p.Gly868Ser missense AIM1 1 83236 1.2014E-5 41618 0 2.4728E-5
6-106968912-T-A p.Ser869Thr missense AIM1 1 83226 1.20155E-5 41613 0 NA
6-106968913-CCCTA-C p.Gln872fs frameshift AIM1 1 83234 1.20143E-5 41617 0 NA
6-106968913-C-T p.Ser869Phe missense AIM1 2 83234 2.40286E-5 41617 0 5.03525E-4
6-106968914-C-T p.Ser869Ser synonymous AIM1 3 83252 3.60352E-5 41626 0 NA
6-106968919-C-T p.Ser871Phe missense AIM1 1 83252 1.20117E-5 41626 0 NA
6-106968924-T-TA p.Ser873fs frameshift AIM1 1 83252 1.20117E-5 41626 0 NA
6-106968943-C-G p.Thr879Arg missense AIM1 2 83276 2.40165E-5 41638 0 NA
6-106968943-C-T p.Thr879Met missense AIM1 12 83276 1.44099E-4 41638 0 0.00171996
6-106968946-C-A p.Thr880Asn missense AIM1 1 83284 1.20071E-5 41642 0 NA
6-106968955-C-T p.Ala883Val missense AIM1 1 83256 1.20111E-5 41628 0 8.24307E-6
6-106968959-G-T p.Pro884Pro synonymous AIM1 10 83262 1.20103E-4 41631 0 1.59266E-4
6-106968959-G-C p.Pro884Pro synonymous AIM1 2 83262 2.40206E-5 41631 0 NA
6-106968960-C-T p.Pro885Ser missense AIM1 1 83260 1.20106E-5 41630 0 2.4728E-5
6-106968961-C-G p.Pro885Arg missense AIM1 1 83270 1.20091E-5 41635 0 NA
6-106968961-C-A p.Pro885His missense AIM1 1 83270 1.20091E-5 41635 0 1.19337E-5
6-106968974-C-T p.Asn889Asn synonymous AIM1 2 83264 2.402E-5 41632 0 4.37494E-5
6-106968980-A-G p.Glu891Glu synonymous AIM1 1 83258 1.20109E-5 41629 0 NA
6-106968997-C-A p.Pro897His missense AIM1 6 83270 7.20548E-5 41635 0 6.36862E-5
6-106968998-C-T p.Pro897Pro synonymous AIM1 12 83268 1.44113E-4 41634 0 5.2498E-4
6-106968999-G-A p.Asp898Asn missense AIM1 2 83278 2.40159E-5 41639 0 8.2409E-6
6-106969007-C-CT p.Leu901fs frameshift AIM1 1 83290 1.20062E-5 41645 0 1.64802E-5
6-106969013-G-A p.Lys902Lys synonymous AIM1 9 83304 1.08038E-4 41652 0 1.27364E-4
6-106969025-C-T p.Phe906Phe synonymous AIM1 1 83326 1.20011E-5 41663 0 NA
6-106969027-A-G p.Asn907Ser missense AIM1 4 83328 4.80031E-5 41664 0 4.12004E-5
6-106969029-T-G p.Ser908Ala missense AIM1 5 83324 6.00067E-5 41662 0 5.03525E-4
6-106969031-G-A p.Ser908Ser synonymous AIM1 68 83324 8.16091E-4 41662 0 7.08612E-4
6-106969040-A-C p.Thr911Thr synonymous AIM1 2 83330 2.4001E-5 41665 0 1.64796E-5
6-106969045-A-G p.His913Arg missense AIM1 2 83324 2.40027E-5 41662 0 3.9782E-6
6-106969059-A-G p.Ser918Gly missense AIM1 1 83326 1.20011E-5 41663 0 NA
6-106969063-C-G p.Pro919Arg missense AIM1 1 83318 1.20022E-5 41659 0 NA
6-106969070-C-A p.His921Gln missense AIM1 1 83334 1.19999E-5 41667 0 6.36902E-5
6-106969084-C-T p.Pro926Leu missense AIM1 2 83344 2.39969E-5 41672 0 6.25E-4
6-106969085-G-A p.Pro926Pro synonymous AIM1 190 83340 0.00227982 41670 1 0.00318898
6-106969101-AAAG-A p.Glu933del disruptive_inframe_deletion AIM1 1 83348 1.19979E-5 41674 0 8.24294E-6
6-106969119-C-T p.Arg938* stop_gained AIM1 1 83358 1.19964E-5 41679 0 1.1945E-5
6-106969120-G-A p.Arg938Gln missense AIM1 8 83362 9.5967E-5 41681 0 0.00151057
6-106969126-A-AC p.Leu941fs frameshift AIM1 1 83360 1.19962E-5 41680 0 NA
6-106969132-A-G p.His942Arg missense AIM1 1 83356 1.19967E-5 41678 0 8.24552E-6
6-106969135-T-G p.Leu943Trp missense AIM1 1 83354 1.1997E-5 41677 0 1.19564E-5
6-106969137-C-T p.Pro944Ser missense AIM1 1 83356 1.19967E-5 41678 0 1.64951E-5
6-106969143-A-G p.Thr946Ala missense AIM1 1 83354 1.1997E-5 41677 0 NA
6-106969144-C-T p.Thr946Ile missense AIM1 2 83354 2.3994E-5 41677 0 8.24729E-6
6-106969145-T-C p.Thr946Thr synonymous AIM1 1 83354 1.1997E-5 41677 0 NA
6-106969155-G-A p.Glu950Lys missense AIM1 2 83354 2.3994E-5 41677 0 8.2481E-6
6-106969159-T-C p.Leu951Ser missense AIM1 1 83352 1.19973E-5 41676 0 3.98362E-6
6-106969182-A-G p.Met959Val missense AIM1 20 83342 2.39975E-4 41671 0 0.00100705
6-106969192-C-A p.Ala962Asp missense AIM1 3 83332 3.60006E-5 41666 0 NA
6-106969193-T-C p.Ala962Ala synonymous AIM1 1 83332 1.20002E-5 41666 0 2.47484E-5
6-106969202-T-A p.Ile965Ile synonymous AIM1 139 83322 0.00166823 41661 0 0.00168768
6-106969204-A-G p.Glu966Gly missense AIM1 59 83314 7.08164E-4 41657 1 0.005625
6-106969227-C-T p.Pro974Ser missense AIM1 1 83266 1.20097E-5 41633 0 8.25042E-6
6-106969236-GCAAA-G p.Asn978fs frameshift AIM1 1 83272 1.20088E-5 41636 0 NA
6-106969238-A-G p.Ala977Ala synonymous AIM1 1 83272 1.20088E-5 41636 0 5.03525E-4
6-106969241-C-T p.Asn978Asn synonymous AIM1 2 83268 2.40188E-5 41634 0 NA
6-106969250-C-T p.Thr981Thr synonymous AIM1 9 83260 1.08095E-4 41630 0 1.59246E-4
6-106969251-G-A p.Asp982Asn missense AIM1 3 83262 3.60308E-5 41631 0 3.18573E-5
6-106969266-T-C p.Phe987Leu missense AIM1 128 83266 0.00153724 41633 1 0.00138663
6-106969271-A-ACTGGAGTGTGATGTACT p.Ser989fs frameshift AIM1 1 83268 1.20094E-5 41634 0 NA
6-106969278-C-T p.Arg991Trp missense AIM1 2 83270 2.40183E-5 41635 0 3.18613E-5
6-106969279-G-A p.Arg991Gln missense AIM1 9 83270 1.08082E-4 41635 0 9.55536E-5
6-106969280-G-T p.Arg991Arg synonymous AIM1 2 83272 2.40177E-5 41636 0 NA
6-106969283-T-G p.Tyr992* stop_gained AIM1 1 83272 1.20088E-5 41636 0 NA
6-106969293-A-G p.Ile996Val missense AIM1 2 83260 2.40211E-5 41630 0 4.40665E-6
6-106969306-G-T p.Gly1000Val missense AIM1 2 83220 2.40327E-5 41610 0 2.2168E-5
6-106969312-C-A p.Ser1002* stop_gained AIM1 1 83210 1.20178E-5 41605 0 4.54149E-6
6-106969318-C-T p.Ser1004Leu missense AIM1 8 83188 9.61677E-5 41594 0 2.75439E-5
6-106969321-A-G p.Asp1005Gly missense AIM1 1 83184 1.20215E-5 41592 0 9.55718E-5
6-106969327-T-C p.Met1007Thr missense+splice_region AIM1 2 83152 2.40523E-5 41576 0 3.18634E-5
6-106973024-T-C p.Val1013Ala missense AIM1 1 82160 1.21714E-5 41080 0 8.262E-6
6-106973024-T-A p.Val1013Asp missense AIM1 1 82160 1.21714E-5 41080 0 8.262E-6
6-106973031-T-C p.Asn1015Asn synonymous AIM1 14 82340 1.70027E-4 41170 1 0.0040282
6-106973041-C-T p.Pro1019Ser missense AIM1 9 82532 1.09049E-4 41266 0 7.00592E-4
6-106973041-C-A p.Pro1019Thr missense AIM1 1 82534 1.21162E-5 41267 0 4.78313E-5
6-106973041-CC-AT p.Pro1019Ile missense AIM1 1 82534 1.21162E-5 41267 0 NA
6-106973044-C-G p.Arg1020Gly missense AIM1 1 82556 1.2113E-5 41278 0 3.98597E-6
6-106973045-G-A p.Arg1020Gln missense AIM1 7 82590 8.4756E-5 41295 0 6.36821E-5
6-106973047-C-G p.Pro1021Ala missense AIM1 10 82606 1.21057E-4 41303 0 3.58657E-5
6-106973053-AAGGTAAGATTATTTTCTGTTTCTAGTCTTGATTCTATTTTGGTCTGACAGAGTACAACAAAGTGTGCTACCACTTTCGTTTTCTTGC-A p.Lys1023fs frameshift AIM1 8 82736 9.66931E-5 41368 1 NA
6-106973138-T-A c.3070-5T>A splice_region AIM1 1 83288 1.20065E-5 41644 0 NA
6-106973143-G-A p.Val1024Ile missense+splice_region AIM1 1 83316 1.20025E-5 41658 0 6.58946E-5
6-106973152-T-C p.Tyr1027His missense AIM1 1 83312 1.20031E-5 41656 0 3.29473E-5
6-106973154-T-C p.Tyr1027Tyr synonymous AIM1 1 83306 1.20039E-5 41653 0 NA
6-106973158-G-A p.Glu1029Lys missense AIM1 2 83310 2.40067E-5 41655 0 NA
6-106973161-C-G p.Pro1030Ala missense AIM1 1 83314 1.20028E-5 41657 0 NA
6-106973163-C-T p.Pro1030Pro synonymous AIM1 1 83312 1.20031E-5 41656 0 1.19329E-5
6-106973164-G-A p.Asp1031Asn missense AIM1 2 83314 2.40056E-5 41657 0 3.18613E-5
6-106973167-G-A p.Val1032Ile missense AIM1 7 83320 8.40134E-5 41660 0 1.56497E-4
6-106973180-GC-G p.Cys1036fs frameshift AIM1 1 83308 1.20036E-5 41654 0 NA
6-106973182-A-C p.Ile1037Leu missense AIM1 2 83310 2.40067E-5 41655 0 3.18451E-5
6-106973193-C-A p.Phe1040Leu missense AIM1 1 83292 1.2006E-5 41646 0 NA
6-106973211-C-T p.Cys1046Cys synonymous AIM1 1 83292 1.2006E-5 41646 0 NA
6-106973212-A-G p.Ser1047Gly missense AIM1 9 83286 1.08061E-4 41643 0 2.22916E-4
6-106973220-G-T p.Trp1049Cys missense AIM1 2 83276 2.40165E-5 41638 0 NA
6-106973224-C-T p.Leu1051Phe missense AIM1 1 83286 1.20068E-5 41643 0 3.18552E-5
6-106973225-T-C p.Leu1051Pro missense AIM1 4 83284 4.80284E-5 41642 0 1.59236E-4
6-106973230-C-T p.Pro1053Ser missense AIM1 3 83282 3.60222E-5 41641 0 4.11841E-5
6-106973234-T-A p.Val1054Glu missense AIM1 36 83272 4.32318E-4 41636 0 0.00125
6-106973236-A-T p.Ile1055Leu missense AIM1 1 83264 1.201E-5 41632 0 1.81213E-4
6-106973247-A-G p.Lys1058Lys synonymous AIM1 3 83254 3.60343E-5 41627 0 4.11868E-5
6-106973262-G-T c.3188+1G>T splice_donor AIM1 1 83218 1.20166E-5 41609 0 NA
6-106973266-G-GA c.3188+5_3188+6insA splice_region AIM1 1 83204 1.20187E-5 41602 0 NA
6-106975175-G-A c.3189-5G>A splice_region AIM1 1 83142 1.20276E-5 41571 0 NA
6-106975189-G-A p.Leu1066Leu synonymous AIM1 3 83198 3.60586E-5 41599 0 6.37308E-5
6-106975190-T-C p.Tyr1067His missense AIM1 1 83198 1.20195E-5 41599 0 6.25E-4
6-106975193-G-A p.Glu1068Lys missense AIM1 1 83202 1.20189E-5 41601 0 NA
6-106975218-C-G p.Ser1076Cys missense AIM1 1 83256 1.20111E-5 41628 0 3.98944E-6
6-106975225-C-A p.Pro1078Pro synonymous AIM1 4 83270 4.80365E-5 41635 0 5.76882E-5
6-106975258-C-A p.Leu1089Leu synonymous AIM1 1 83322 1.20016E-5 41661 0 NA
6-106975260-G-A p.Trp1090* stop_gained AIM1 1 83320 1.20019E-5 41660 0 3.18532E-5
6-106975262-G-A p.Gly1091Ser missense AIM1 1 83318 1.20022E-5 41659 0 5.57112E-5
6-106975263-G-C p.Gly1091Ala missense AIM1 2 83312 2.40061E-5 41656 0 NA
6-106975266-T-C p.Ile1092Thr missense AIM1 5 83308 6.00182E-5 41654 0 5.03525E-4
6-106975277-T-G p.Leu1096Val missense AIM1 624 83322 0.00748902 41661 10 0.0123327
6-106975288-C-T p.His1099His synonymous AIM1 1 83336 1.19996E-5 41668 0 1.6475E-5
6-106975289-G-A p.Glu1100Lys missense AIM1 3 83334 3.59997E-5 41667 0 3.29506E-5
6-106975290-A-G p.Glu1100Gly missense AIM1 18 83334 2.15998E-4 41667 0 5.41574E-4
6-106975304-G-A p.Asp1105Asn missense AIM1 3 83338 3.5998E-5 41669 0 2.47129E-5
6-106975307-A-C p.Lys1106Gln missense AIM1 1 83328 1.20008E-5 41664 0 NA
6-106975317-T-C p.Val1109Ala missense AIM1 2 83274 2.40171E-5 41637 0 NA
6-106975320-T-C p.Ile1110Thr missense AIM1 7 83266 8.40679E-5 41633 0 9.55353E-5
6-106975324-T-C p.Gly1111Gly synonymous AIM1 4 83258 4.80434E-5 41629 0 9.55536E-5
6-106975343-C-G p.Gln1118Glu missense+splice_region AIM1 1 83160 1.2025E-5 41580 0 8.24824E-6
6-106975344-A-G p.Gln1118Arg missense+splice_region AIM1 1 83170 1.20236E-5 41585 0 NA
6-106975348-A-G c.3354+3A>G splice_region AIM1 1 83122 1.20305E-5 41561 0 NA
6-106978051-G-A p.Asp1119Asn missense+splice_region AIM1 1 83126 1.20299E-5 41563 0 NA
6-106978059-A-G p.Arg1121Arg synonymous AIM1 7 83158 8.41771E-5 41579 0 0.00125
6-106978074-C-G p.Asp1126Glu missense AIM1 2 83200 2.40385E-5 41600 0 NA
6-106978078-T-G p.Phe1128Val missense AIM1 1 83218 1.20166E-5 41609 0 1.59698E-5
6-106978109-G-A p.Ser1138Asn missense AIM1 4 83306 4.80158E-5 41653 0 8.2428E-6
6-106978122-T-C p.Asp1142Asp synonymous AIM1 1 83326 1.20011E-5 41663 0 NA
6-106978147-G-A p.Gly1151Ser missense AIM1 1 83330 1.20005E-5 41665 0 NA
6-106978148-G-A p.Gly1151Asp missense AIM1 2 83326 2.40021E-5 41663 0 7.96318E-6
6-106978148-G-T p.Gly1151Val missense AIM1 1 83326 1.20011E-5 41663 0 NA
6-106978150-G-GT p.Met1153fs frameshift AIM1 12 83330 1.44006E-4 41665 0 2.23044E-4
6-106978150-G-A p.Val1152Ile missense AIM1 1 83332 1.20002E-5 41666 0 NA
6-106978156-C-A p.Gln1154Lys missense AIM1 1 83326 1.20011E-5 41663 0 3.99281E-6
6-106978158-G-T p.Gln1154His missense AIM1 1 83316 1.20025E-5 41658 0 NA
6-106978160-A-C p.Lys1155Thr missense AIM1 1 83318 1.20022E-5 41659 0 3.18573E-5
6-106978162-A-G p.Thr1156Ala missense AIM1 1 83310 1.20034E-5 41655 0 8.24294E-6
6-106978165-T-TGCTTTA p.Cys1157_Ser1158insPheSer disruptive_inframe_insertion AIM1 1 83300 1.20048E-5 41650 0 NA
6-106978166-G-T p.Cys1157Phe missense AIM1 8 83300 9.60384E-5 41650 0 6.37714E-5
6-106978166-G-GC p.Ser1158fs frameshift AIM1 1 83300 1.20048E-5 41650 0 NA
6-106978168-T-TTAGTTATATAA p.Ser1158fs frameshift AIM1 1 83300 1.20048E-5 41650 0 NA
6-106978169-C-A p.Ser1158Tyr missense AIM1 1 83302 1.20045E-5 41651 0 NA
6-106978170-C-T p.Ser1158Ser synonymous AIM1 1 83274 1.20085E-5 41637 0 NA
6-106978174-A-G p.Lys1160Glu missense AIM1 1 83284 1.20071E-5 41642 0 NA
6-106978190-C-T p.Thr1165Met missense+splice_region AIM1 377 83026 0.00454075 41513 3 0.00810207
6-106978193-A-G c.3494+3A>G splice_region AIM1 3772 83030 0.0454294 41515 87 0.0341091
6-106978197-A-AT c.3494+7_3494+8insT splice_region AIM1 11 83056 1.32441E-4 41528 0 3.76776E-4
6-106978197-AT-A c.3494+8delT splice_region AIM1 3 83056 3.61202E-5 41528 0 4.79927E-4
6-106978197-A-ATT c.3494+7_3494+8insTT splice_region AIM1 1 83062 1.20392E-5 41531 0 1.60648E-4
6-106987281-G-A p.Trp1166* stop_gained AIM1 8 83320 9.60154E-5 41660 0 6.25E-4
6-106987296-A-G p.Glu1171Glu synonymous AIM1 14 83344 1.67979E-4 41672 0 1.2335E-4
6-106987300-GGA-G p.Gly1173fs frameshift AIM1 4 83356 4.79869E-5 41678 0 9.55962E-5
6-106987308-G-C p.Gln1175His missense AIM1 1 83354 1.1997E-5 41677 0 NA
6-106987309-G-T p.Gly1176Cys missense AIM1 1 83356 1.19967E-5 41678 0 NA
6-106987323-C-T p.Ile1180Ile synonymous AIM1 1 83362 1.19959E-5 41681 0 3.97874E-6
6-106987330-C-G p.Pro1183Ala missense AIM1 1 83358 1.19964E-5 41679 0 NA
6-106987334-G-C p.Gly1184Ala missense AIM1 1 83358 1.19964E-5 41679 0 NA
6-106987344-T-C p.Pro1187Pro synonymous AIM1 3 83356 3.59902E-5 41678 0 8.23737E-6
6-106987345-G-T p.Asp1188Tyr missense AIM1 74 83348 8.87844E-4 41674 2 0.00187934
6-106987347-C-T p.Asp1188Asp synonymous AIM1 1 83344 1.19985E-5 41672 0 NA
6-106987352-C-G p.Ser1190Cys missense AIM1 2 83344 2.39969E-5 41672 0 9.94859E-5
6-106987370-A-C p.Glu1196Ala missense AIM1 76723 83040 0.923928 41520 35465 0.934942
6-106987372-G-A p.Ala1197Thr missense AIM1 1 83326 1.20011E-5 41663 0 5.76749E-5
6-106987373-C-T p.Ala1197Val missense AIM1 1 83326 1.20011E-5 41663 0 NA
6-106987374-G-A p.Ala1197Ala synonymous AIM1 2 83330 2.4001E-5 41665 0 1.23593E-4
6-106987390-C-A p.Arg1203Arg synonymous AIM1 1 83300 1.20048E-5 41650 0 3.18654E-5
6-106987390-C-T p.Arg1203Trp missense AIM1 3 83300 3.60144E-5 41650 0 3.18654E-5
6-106987403-T-C p.Met1207Thr missense+splice_region AIM1 1 83270 1.20091E-5 41635 0 3.19203E-5
6-106987406-T-C c.3621+2T>C splice_donor AIM1 1 83256 1.20111E-5 41628 0 4.06663E-6
6-106989020-C-T c.-73C>T 5_prime_UTR_premature_start_codon_gain AIM1 1 52310 1.91168E-5 26155 0 3.18634E-5
6-106989087-C-T c.-6C>T 5_prime_UTR_premature_start_codon_gain AIM1 100 53532 0.00186804 26766 0 0.00105596
6-106989097-A-G p.Gln2Arg missense AIM1 1 53628 1.8647E-5 26814 0 NA
6-106989102-C-A p.Pro4Thr missense AIM1 1 53676 1.86303E-5 26838 0 1.29503E-5
6-106989102-C-T p.Pro4Ser missense AIM1 2 53676 3.72606E-5 26838 0 3.8851E-5
6-106989103-C-T p.Pro4Leu missense AIM1 1 53684 1.86275E-5 26842 0 6.36821E-5
6-106989116-C-T p.Ala8Ala synonymous AIM1 2 53870 3.71264E-5 26935 0 NA
6-106989162-T-C p.Ser24Pro missense AIM1 35 55214 6.33897E-4 27607 0 5.09522E-4
6-106989467-C-T p.Arg1210Cys missense AIM1 1 83000 1.20482E-5 41500 0 5.03525E-4
6-106989468-G-A p.Arg1210His missense AIM1 4 83012 4.81858E-5 41506 0 9.95849E-5
6-106989483-C-T p.Pro1215Leu missense AIM1 9 82960 1.08486E-4 41480 0 3.82531E-4
6-106989490-T-C p.Asp1217Asp synonymous AIM1 1 82866 1.20677E-5 41433 0 NA
6-106989495-A-T p.Lys1219Met missense+splice_region AIM1 1 82764 1.20825E-5 41382 0 NA
6-106989495-A-G p.Lys1219Arg missense+splice_region AIM1 1 82764 1.20825E-5 41382 0 NA
6-106989497-G-C c.3657+1G>C splice_donor AIM1 1 82672 1.2096E-5 41336 0 NA
6-106989501-A-G c.3657+5A>G splice_region AIM1 1 82544 1.21148E-5 41272 0 9.09935E-6
6-106991308-A-G c.3658-7A>G splice_region AIM1 1 83284 1.20071E-5 41642 0 8.2702E-6
6-106991321-GT-G p.Tyr1223fs frameshift AIM1 1 83320 1.20019E-5 41660 0 NA
6-106991323-T-C p.Val1222Val synonymous AIM1 2 83326 2.40021E-5 41663 0 6.59924E-5
6-106991326-T-C p.Tyr1223Tyr synonymous AIM1 1 83324 1.20013E-5 41662 0 NA
6-106991329-A-C p.Glu1224Asp missense AIM1 1 83324 1.20013E-5 41662 0 NA
6-106991341-T-C p.Phe1228Phe synonymous AIM1 1 83332 1.20002E-5 41666 0 7.95868E-6
6-106991361-T-C p.Leu1235Pro missense AIM1 4351 83296 0.0522354 41648 116 0.0387648
6-106991366-A-T p.Thr1237Ser missense AIM1 2 83354 2.3994E-5 41677 0 3.97807E-6
6-106991367-C-T p.Thr1237Ile missense AIM1 43 83356 5.1586E-4 41678 0 0.0020141
6-106991368-A-G p.Thr1237Thr synonymous AIM1 5 83356 5.99837E-5 41678 0 0.00125
6-106991372-A-G p.Met1239Val missense AIM1 10 83358 1.19964E-4 41679 0 9.55353E-5
6-106991379-G-C p.Ser1241Thr missense AIM1 1 83364 1.19956E-5 41682 0 NA
6-106991388-T-C p.Met1244Thr missense AIM1 6 83374 7.19649E-5 41687 1 1.07079E-4
6-106991403-C-T p.Thr1249Ile missense AIM1 1 83376 1.19939E-5 41688 0 NA
6-106991409-A-G p.Glu1251Gly missense AIM1 2 83376 2.39877E-5 41688 0 4.11834E-5
6-106991410-G-C p.Glu1251Asp missense AIM1 85 83378 0.00101945 41689 1 0.00283403
6-106991412-C-T p.Ala1252Val missense AIM1 6 83374 7.19649E-5 41687 0 1.40024E-4
6-106991413-G-A p.Ala1252Ala synonymous AIM1 6 83374 7.19649E-5 41687 0 5.96497E-5
6-106991416-T-G p.Thr1253Thr synonymous AIM1 114 83376 0.0013673 41688 1 0.00299287
6-106991417-G-A p.Gly1254Arg missense AIM1 1 83378 1.19936E-5 41689 0 8.2371E-6
6-106991423-G-A p.Asp1256Asn missense AIM1 2 83378 2.39871E-5 41689 0 3.18471E-5
6-106991433-C-T p.Pro1259Leu missense AIM1 1 83376 1.19939E-5 41688 0 4.11902E-5
6-106991434-G-A p.Pro1259Pro synonymous AIM1 4 83376 4.79754E-5 41688 0 6.36983E-5
6-106991439-C-T p.Thr1261Met missense AIM1 2 83384 2.39854E-5 41692 0 3.57907E-5
6-106991458-A-G p.Lys1267Lys synonymous AIM1 1 83378 1.19936E-5 41689 0 1.1953E-5
6-106991468-G-A p.Gly1271Ser missense AIM1 2 83372 2.39889E-5 41686 0 1.31889E-4
6-106991469-G-A p.Gly1271Asp missense AIM1 1 83372 1.19944E-5 41686 0 1.5959E-5
6-106991471-A-G p.Ile1272Val missense+splice_region AIM1 1 83376 1.19939E-5 41688 0 NA
6-106992442-G-A c.3816-4G>A splice_region AIM1 17 83078 2.04627E-4 41539 0 1.27389E-4
6-106992445-G-T c.3816-1G>T splice_acceptor AIM1 2 83108 2.40651E-5 41554 1 NA
6-106992450-G-A p.Val1274Ile missense AIM1 1 83110 1.20322E-5 41555 0 7.97353E-5
6-106992464-A-G p.Lys1278Lys synonymous AIM1 76925 82428 0.933239 41214 35935 0.951946
6-106992465-C-T p.Pro1279Ser missense AIM1 1 83124 1.20302E-5 41562 0 8.2375E-6
6-106992472-T-C p.Phe1281Ser missense AIM1 218 83130 0.0026224 41565 1 0.0058921
6-106992474-A-G p.Thr1282Ala missense AIM1 1 83130 1.20294E-5 41565 0 NA
6-106992475-C-T p.Thr1282Ile missense AIM1 2 83128 2.40593E-5 41564 0 1.59246E-4
6-106992476-C-T p.Thr1282Thr synonymous AIM1 2 83132 2.40581E-5 41566 0 1.99073E-5
6-106992477-G-A p.Gly1283Ser missense AIM1 13 83122 1.56397E-4 41561 0 6.25E-4
6-106992479-T-C p.Gly1283Gly synonymous AIM1 1 83104 1.20331E-5 41552 0 NA
6-106992504-G-A p.Glu1292Lys missense AIM1 51 83126 6.13526E-4 41563 0 0.00704935
6-106992522-G-A p.Ala1298Thr missense AIM1 1 83126 1.20299E-5 41563 0 3.98007E-6
6-106992528-G-A p.Gly1300Arg missense AIM1 1 83128 1.20296E-5 41564 0 NA
6-106992536-C-A p.Tyr1302* stop_gained AIM1 1 83114 1.20317E-5 41557 0 3.1841E-5
6-106992538-A-G p.Asn1303Ser missense AIM1 1 83128 1.20296E-5 41564 0 5.17421E-5
6-106992539-T-A p.Asn1303Lys missense AIM1 13 83130 1.56382E-4 41565 0 1.89566E-4
6-106992547-T-C p.Leu1306Pro missense AIM1 2 83130 2.40587E-5 41565 0 2.47329E-5
6-106992548-T-C p.Leu1306Leu synonymous AIM1 1 83138 1.20282E-5 41569 0 8.2447E-5
6-106992564-A-G p.Ile1312Val missense AIM1 2 83128 2.40593E-5 41564 0 2.47451E-5
6-106992565-T-C p.Ile1312Thr missense AIM1 1 83128 1.20296E-5 41564 0 NA
6-106992569-A-C p.Leu1313Phe missense AIM1 2 83134 2.40575E-5 41567 0 NA
6-106992570-G-A p.Gly1314Ser missense+splice_region AIM1 4 83134 4.81151E-5 41567 0 3.1839E-5
6-106992572-TGTAAGTAAAGGACAAGCTAATGGCTAATACTTGGTCTTCTTTGGATAATAAATGGCTAGCCTTTGAATTTTGAATTTTTTTTCTCAATAG-T c.3942+1_3943-1delGTAAGTAAAGGACAAGCTAATGGCTAATACTTGGTCTTCTTTGGATAATAAATGGCTAGCCTTTGAATTTTGAATTTTTTTTCTCAATAG splice_acceptor AIM1 13 83142 1.56359E-4 41571 6 NA
6-106992576-A-G c.3942+4A>G splice_region AIM1 11 83130 1.32323E-4 41565 0 6.0197E-5
6-106992655-C-G c.3943-8C>G splice_region AIM1 1 82928 1.20587E-5 41464 0 NA
6-106992669-T-C p.Ser1317Pro missense AIM1 2 82856 2.41383E-5 41428 0 8.33069E-6
6-106992670-C-T p.Ser1317Leu missense AIM1 1 82850 1.207E-5 41425 0 NA
6-106992685-T-G p.Ile1322Arg missense AIM1 1 82830 1.20729E-5 41415 0 1.66011E-5
6-106992693-A-G p.Ser1325Gly missense AIM1 1 82832 1.20726E-5 41416 0 1.65736E-5
6-106992696-G-GA p.Asn1328fs frameshift AIM1 1 82838 1.20718E-5 41419 0 NA
6-106992703-A-T p.Asn1328Ile missense AIM1 2 82844 2.41418E-5 41422 0 2.02605E-5
6-106992724-G-A p.Ser1335Asn missense AIM1 1 82920 1.20598E-5 41460 0 NA
6-106992725-T-C p.Ser1335Ser synonymous AIM1 1 82924 1.20592E-5 41462 0 8.25573E-6
6-106992727-T-C p.Ile1336Thr missense AIM1 1 82940 1.20569E-5 41470 0 4.12725E-5
6-106992729-G-A p.Asp1337Asn missense AIM1 1 82942 1.20566E-5 41471 0 NA
6-106992733-T-G p.Val1338Gly missense AIM1 13 82962 1.56698E-4 41481 0 0.00100806
6-106992736-T-A p.Leu1339* stop_gained AIM1 1 82980 1.20511E-5 41490 0 6.25E-4
6-106992747-G-A p.Ala1343Thr missense AIM1 1 83002 1.20479E-5 41501 0 8.25409E-6
6-106992765-G-C p.Gly1349Arg missense AIM1 2 82992 2.40987E-5 41496 0 8.25873E-6
6-106992771-G-A p.Gly1351Arg missense AIM1 1 82988 1.20499E-5 41494 0 NA
6-106992789-A-G p.Ile1357Val missense AIM1 1 82904 1.20621E-5 41452 0 4.07691E-6
6-106992792-A-C p.Asn1358His missense AIM1 1 82894 1.20636E-5 41447 0 3.1837E-5
6-106992795-G-A p.Val1359Ile missense AIM1 1 82874 1.20665E-5 41437 0 8.3185E-6
6-106992799-T-G p.Leu1360Arg missense AIM1 2 82848 2.41406E-5 41424 0 8.3325E-6
6-106999766-G-A p.Gln1376Gln synonymous AIM1 1 82884 1.20651E-5 41442 0 1.19628E-5
6-106999771-T-C p.Ile1378Thr missense AIM1 2 82898 2.4126E-5 41449 0 8.24688E-6
6-106999775-G-A p.Leu1379Leu synonymous AIM1 10 82908 1.20616E-4 41454 0 6.3805E-5
6-106999779-A-G p.Lys1381Glu missense AIM1 1 82932 1.20581E-5 41466 0 NA
6-106999787-T-G p.Phe1383Leu missense AIM1 1 82964 1.20534E-5 41482 0 1.64924E-5
6-106999798-T-A p.Phe1387Tyr missense AIM1 2 83020 2.40906E-5 41510 0 1.19563E-5
6-106999803-G-T p.Asp1389Tyr missense AIM1 1 83014 1.20462E-5 41507 0 NA
6-106999822-G-A p.Cys1395Tyr missense AIM1 22130 82422 0.268496 41211 3167 0.339375
6-106999851-T-C p.Leu1405Leu splice_region+synonymous AIM1 34 83034 4.09471E-4 41517 0 5.04541E-4
6-107000053-T-G c.4216-6T>G splice_region AIM1 20 82238 2.43197E-4 41119 0 6.45995E-4
6-107000055-T-G c.4216-4T>G splice_region AIM1 2 82228 2.43226E-5 41114 0 NA
6-107000060-A-G p.Asp1406Gly missense+splice_region AIM1 2 82212 2.43273E-5 41106 0 NA
6-107000063-C-A p.Ser1407Tyr missense AIM1 1 82194 1.21663E-5 41097 0 6.45161E-4
6-107000079-G-C p.Arg1412Ser missense AIM1 2 82068 2.437E-5 41034 0 6.5445E-4
6-107000083-C-T p.Arg1414* stop_gained AIM1 1 81838 1.22193E-5 40919 0 6.62252E-4
6-107000084-G-A p.Arg1414Gln missense AIM1 1 81828 1.22208E-5 40914 0 6.39672E-5
6-107001331-T-C p.Ile1417Thr missense+splice_region AIM1 1 82990 1.20496E-5 41495 0 NA
6-107001375-T-G p.Phe1432Val missense AIM1 3 83170 3.60707E-5 41585 0 1.65177E-4
6-107001376-T-TTGA p.Phe1432_Glu1433insAsp disruptive_inframe_insertion AIM1 1 83176 1.20227E-5 41588 0 6.36699E-5
6-107001382-AAAC-A p.Thr1436del disruptive_inframe_deletion AIM1 4 83174 4.8092E-5 41587 0 8.25873E-5
6-107001385-C-T p.Thr1435Ile missense AIM1 2 83164 2.40489E-5 41582 0 1.59256E-4
6-107001414-A-T p.Thr1445Ser missense AIM1 2560 83064 0.0308196 41532 183 0.0577401
6-107001416-C-T p.Thr1445Thr synonymous AIM1 41 83092 4.93429E-4 41546 0 0.00176807
6-107001433-C-T p.Ser1451Leu missense AIM1 1 83014 1.20462E-5 41507 0 3.18451E-5
6-107001438-G-C p.Gly1453Arg missense AIM1 1 82966 1.20531E-5 41483 0 1.19698E-5
6-107001439-G-A p.Gly1453Asp missense AIM1 1 82958 1.20543E-5 41479 0 1.19698E-5
6-107003636-ATTGTAGCTGGG-A p.Trp1455fs frameshift AIM1 1 83272 1.20088E-5 41636 0 1.64957E-5
6-107003646-G-T p.Trp1455Cys missense AIM1 2 83290 2.40125E-5 41645 0 NA
6-107003652-A-G p.Val1457Val synonymous AIM1 8 83302 9.60361E-5 41651 0 1.64818E-5
6-107003667-T-C p.Asn1462Asn synonymous AIM1 1 83308 1.20036E-5 41654 0 NA
6-107003672-C-T p.Thr1464Ile missense AIM1 2 83314 2.40056E-5 41657 0 3.18492E-5
6-107003674-G-A p.Gly1465Ser missense AIM1 1 83314 1.20028E-5 41657 0 NA
6-107003685-C-T p.Tyr1468Tyr synonymous AIM1 2 83334 2.39998E-5 41667 0 3.29527E-5
6-107003685-C-A p.Tyr1468* stop_gained AIM1 1 83334 1.19999E-5 41667 0 3.18471E-5
6-107003686-G-A p.Val1469Met missense AIM1 292 83326 0.00350431 41663 3 0.008125
6-107003702-A-G p.His1474Arg missense AIM1 1 83344 1.19985E-5 41672 0 NA
6-107003706-T-A p.Tyr1475* stop_gained AIM1 16 83344 1.91975E-4 41672 0 2.50561E-4
6-107003724-G-A p.Met1481Ile missense AIM1 3 83336 3.59988E-5 41668 0 2.80066E-4
6-107003727-A-T p.Gly1482Gly synonymous AIM1 1 83338 1.19993E-5 41669 0 3.97735E-6
6-107003727-A-C p.Gly1482Gly synonymous AIM1 2 83338 2.39987E-5 41669 0 4.94218E-5
6-107003732-C-T p.Pro1484Leu missense AIM1 1 83336 1.19996E-5 41668 0 1.19321E-5
6-107003746-T-C p.Phe1489Leu missense AIM1 1 83330 1.20005E-5 41665 0 6.36902E-5
6-107003750-A-G p.Lys1490Arg missense AIM1 1 83322 1.20016E-5 41661 0 8.23791E-6
6-107003751-G-C p.Lys1490Asn missense AIM1 3 83318 3.60066E-5 41659 0 8.23764E-6
6-107003758-C-T p.Arg1493Cys missense AIM1 1 83308 1.20036E-5 41654 0 1.1936E-5
6-107003759-G-A p.Arg1493His missense AIM1 3 83306 3.60118E-5 41653 0 1.59153E-5
6-107003761-T-A p.Phe1494Ile missense AIM1 12 83304 1.44051E-4 41652 0 6.36862E-5
6-107003770-G-A p.Val1497Ile missense+splice_region AIM1 2 83256 2.40223E-5 41628 0 NA
6-107003778-T-G c.4491+6T>G splice_region AIM1 1 83210 1.20178E-5 41605 0 NA
6-107003779-A-G c.4491+7A>G splice_region AIM1 2 83210 2.40356E-5 41605 0 6.36821E-5
6-107006353-C-T c.4492-8C>T splice_region AIM1 5 82782 6.03996E-5 41391 0 NA
6-107006374-C-G p.Pro1502Arg missense AIM1 1 82942 1.20566E-5 41471 0 8.5317E-6
6-107006390-T-C p.Phe1507Phe synonymous AIM1 4 82996 4.81951E-5 41498 0 3.18532E-5
6-107006392-A-G p.Glu1508Gly missense AIM1 1 83002 1.20479E-5 41501 0 4.02625E-6
6-107006400-G-A p.Asp1511Asn missense AIM1 1 83010 1.20467E-5 41505 0 NA
6-107006429-T-C p.Asn1520Asn synonymous AIM1 1 83026 1.20444E-5 41513 0 3.99049E-6
6-107006433-G-A p.Glu1522Lys missense AIM1 1 83012 1.20465E-5 41506 0 NA
6-107006438-T-G p.Thr1523Thr synonymous AIM1 4 82992 4.81974E-5 41496 0 6.25E-4
6-107006445-C-T p.Leu1526Phe missense AIM1 1 82988 1.20499E-5 41494 0 NA
6-107006448-C-T p.Arg1527* stop_gained AIM1 1 82976 1.20517E-5 41488 0 3.18471E-5
6-107006449-G-A p.Arg1527Gln missense AIM1 3 82970 3.61576E-5 41485 0 1.65418E-5
6-107006451-TC-T p.Leu1529fs frameshift AIM1 18 82952 2.16993E-4 41476 0 2.48118E-5
6-107006461-T-C p.Phe1531Ser missense AIM1 1 82886 1.20648E-5 41443 0 NA
6-107006464-A-C p.Asn1532Thr missense AIM1 2 82874 2.4133E-5 41437 0 2.39534E-5
6-107006467-C-T p.Thr1533Ile missense AIM1 5 82858 6.03442E-5 41429 0 6.25E-4
6-107006475-C-T p.Arg1536Cys missense AIM1 1 82784 1.20796E-5 41392 0 3.31691E-5
6-107006476-G-A p.Arg1536His missense AIM1 12 82768 1.44984E-4 41384 1 0.0040282
6-107006478-T-A p.Ser1537Thr missense AIM1 1 82752 1.20843E-5 41376 0 NA
6-107006487-G-A p.Val1540Ile missense AIM1 1 82660 1.20978E-5 41330 0 5.03525E-4
6-107006506-T-C c.4631+6T>C splice_region AIM1 1 82360 1.21418E-5 41180 0 8.37942E-6
6-107008676-A-C c.4632-2A>C splice_acceptor AIM1 1 83210 1.20178E-5 41605 0 0.00125
6-107008681-G-A p.Trp1545* stop_gained AIM1 19 83250 2.28228E-4 41625 0 1.39155E-4
6-107008692-A-AAT p.Gly1551fs frameshift AIM1 5 83260 6.00528E-5 41630 0 6.37064E-5
6-107008699-C-T p.Gly1551Gly synonymous AIM1 2 83262 2.40206E-5 41631 0 2.47374E-5
6-107008709-G-C p.Gly1555Arg missense AIM1 4 83254 4.80457E-5 41627 0 1.59953E-5
6-107008712-C-T p.Arg1556* stop_gained AIM1 3 83240 3.60404E-5 41620 0 3.18471E-5
6-107008713-G-A p.Arg1556Gln missense AIM1 3 83248 3.60369E-5 41624 0 5.77025E-5
6-107008723-A-G p.Leu1559Leu synonymous AIM1 1 83266 1.20097E-5 41633 0 3.98874E-6
6-107008739-G-T p.Val1565Leu missense AIM1 2 83256 2.40223E-5 41628 0 NA
6-107008739-G-A p.Val1565Ile missense AIM1 3 83256 3.60334E-5 41628 0 6.39626E-5
6-107008742-C-A p.Pro1566Thr missense AIM1 7 83260 8.4074E-5 41630 0 6.3674E-5
6-107008769-C-T p.Arg1575Cys missense AIM1 5 83216 6.00846E-5 41608 0 9.54988E-5
6-107008770-G-A p.Arg1575His missense AIM1 4 83226 4.80619E-5 41613 0 6.25E-4
6-107008779-G-C p.Gly1578Ala missense AIM1 2 83244 2.40258E-5 41622 0 4.01471E-6
6-107008779-G-T p.Gly1578Val missense AIM1 1 83244 1.20129E-5 41622 0 8.27719E-6