Variant

Variant ID Consequence Effect Gene AC AN AF NS NHOM maxEAF
6-143381719-C-T c.-63C>T 5_prime_UTR_premature_start_codon_gain AIG1 1 26024 3.84261E-5 13012 0 NA
6-143381742-C-T c.-40C>T 5_prime_UTR_premature_start_codon_gain AIG1 1 28524 3.50582E-5 14262 0 7.90889E-5
6-143381763-C-T c.-19C>T 5_prime_UTR_premature_start_codon_gain AIG1 23 28936 7.94858E-4 14468 0 0.00125
6-143381792-T-G c.9+2T>G splice_donor AIG1 1 27068 3.6944E-5 13534 0 NA
6-143381796-G-A c.9+6G>A splice_region AIG1 2 26490 7.55002E-5 13245 0 NA
6-143381983-C-T c.-80C>T 5_prime_UTR_premature_start_codon_gain AIG1 1 32564 3.07088E-5 16282 0 NA
6-143381996-C-T c.-67C>T 5_prime_UTR_premature_start_codon_gain AIG1 53 49552 0.00106958 24776 0 5.92016E-4
6-143382028-C-G c.-35C>G 5_prime_UTR_premature_start_codon_gain AIG1 1 71788 1.39299E-5 35894 0 NA
6-143382030-T-C c.-33T>C 5_prime_UTR_premature_start_codon_gain AIG1 1 72294 1.38324E-5 36147 0 5.4197E-6
6-143382030-T-A c.-33T>A 5_prime_UTR_premature_start_codon_gain AIG1 1 72294 1.38324E-5 36147 0 NA
6-143382034-C-T c.-29C>T 5_prime_UTR_premature_start_codon_gain AIG1 5 73284 6.82277E-5 36642 0 1.05863E-5
6-143382042-C-T c.-21C>T 5_prime_UTR_premature_start_codon_gain AIG1 1 75042 1.33259E-5 37521 0 1.02678E-5
6-143382081-C-A p.Gln7Lys missense AIG1 3 80622 3.72107E-5 40311 0 3.23604E-5
6-143382091-GGATGGCAATCCT-G p.Met11_Leu14del conservative_inframe_deletion AIG1 2 80988 2.4695E-5 40494 0 NA
6-143382098-A-G p.Ala12Ala synonymous AIG1 3 81460 3.68279E-5 40730 0 1.66381E-5
6-143382099-A-G p.Ile13Val missense AIG1 4 81534 4.90593E-5 40767 0 6.44122E-5
6-143382110-T-C p.Ser16Ser synonymous AIG1 11964 80618 0.148404 40309 880 0.202864
6-143382110-TTA-CTG p.SerTyr16SerCys missense AIG1 1 81980 1.21981E-5 40990 0 NA
6-143382112-A-G p.Tyr17Cys missense AIG1 1 82000 1.21951E-5 41000 0 5.04032E-4
6-143382115-GC-CT p.Cys18Ser missense AIG1 1 82054 1.21871E-5 41027 0 NA
6-143382118-C-T p.Ser19Phe missense AIG1 1 82186 1.21675E-5 41093 0 NA
6-143382118-C-G p.Ser19Cys missense AIG1 1 82186 1.21675E-5 41093 0 NA
6-143382128-T-TA p.Asn23fs frameshift AIG1 1 82436 1.21306E-5 41218 0 NA
6-143382129-A-T p.Asn23Tyr missense AIG1 2 82440 2.42601E-5 41220 0 3.98384E-6
6-143382142-T-C p.Ile27Thr missense AIG1 3 82624 3.63091E-5 41312 0 1.59289E-5
6-143382143-C-G p.Ile27Met missense AIG1 1 82650 1.20992E-5 41325 0 NA
6-143382156-C-T p.His32Tyr missense AIG1 8 82652 9.67914E-5 41326 0 2.24086E-4
6-143382157-A-C p.His32Pro missense AIG1 1 82656 1.20983E-5 41328 0 8.27321E-6
6-143382172-G-T p.Gly37Val missense AIG1 1 82446 1.21292E-5 41223 0 NA
6-143382182-A-G p.Lys40Lys synonymous AIG1 2 82340 2.42895E-5 41170 0 NA
6-143382186-C-T p.Leu42Leu synonymous AIG1 3 82278 3.64618E-5 41139 0 NA
6-143382195-A-T p.Ile45Phe missense AIG1 1 82004 1.21945E-5 41002 0 NA
6-143382202-T-C p.Leu47Pro missense+splice_region AIG1 1 81638 1.22492E-5 40819 0 NA
6-143382205-T-TTATCCAGGCTGTCTTTTTTGGCATCTGTGTGCTGACTG c.141+2_141+3insTATCCAGGCTGTCTTTTTTGGCATCTGTGTGCTGACTG splice_region AIG1 2 81428 2.45616E-5 40714 1 NA
6-143382343-T-C c.142-8T>C splice_region AIG1 1 76040 1.3151E-5 38020 0 NA
6-143382741-T-C c.*388T>C splice_region AIG1 1 4702 2.12675E-4 2351 0 3.18471E-4
6-143457966-C-T c.142-6C>T splice_region AIG1 1 78808 1.26891E-5 39404 0 NA
6-143457969-C-CA c.142-3_142-2insA splice_acceptor AIG1 1 78854 1.26817E-5 39427 0 NA
6-143457981-G-T p.Ala51Ser missense AIG1 11 79200 1.38889E-4 39600 0 1.09641E-5
6-143457982-C-G p.Ala51Gly missense AIG1 2 79234 2.52417E-5 39617 0 NA
6-143457988-T-G p.Phe53Cys missense AIG1 1 79494 1.25796E-5 39747 0 NA
6-143457992-T-G p.Phe54Leu missense AIG1 4 79704 5.01857E-5 39852 0 6.37024E-5
6-143458004-G-A p.Val58Val synonymous AIG1 1 80856 1.23677E-5 40428 0 NA
6-143458026-C-G p.Leu66Val missense AIG1 1 81306 1.22992E-5 40653 0 3.18756E-5
6-143458040-T-G p.Ser70Arg missense AIG1 2 81208 2.46281E-5 40604 0 6.73582E-5
6-143458043-G-A p.Gly71Gly synonymous AIG1 1 81302 1.22998E-5 40651 0 NA
6-143458049-G-C p.Gln73His missense AIG1 1 81334 1.2295E-5 40667 0 8.40986E-6
6-143458081-C-T p.Ser84Phe missense AIG1 1 81188 1.23171E-5 40594 0 5.03525E-4
6-143458087-G-A p.Arg86Gln missense AIG1 2 81152 2.46451E-5 40576 0 9.55353E-5
6-143458088-G-A p.Arg86Arg synonymous AIG1 1 81154 1.23223E-5 40577 0 8.54088E-6
6-143458100-A-C p.Leu90Phe missense AIG1 1 80124 1.24807E-5 40062 0 NA
6-143458124-G-GGTTTTT p.Val92_Leu93insPheLeu disruptive_inframe_insertion AIG1 6 78610 7.63262E-5 39305 3 NA
6-143458125-G-A p.Val99Ile missense+splice_region AIG1 1 78626 1.27184E-5 39313 0 1.75583E-5
6-143458125-G-GTTT p.Pro96delinsLeuSer disruptive_inframe_insertion AIG1 2 78626 2.54369E-5 39313 1 NA
6-143486211-C-T c.298-8C>T splice_region AIG1 1352 82250 0.0164377 41125 13 0.015976
6-143486213-T-C c.298-6T>C splice_region AIG1 142 82386 0.00172359 41193 1 0.00375
6-143486241-T-A p.Ile107Asn missense AIG1 2 82764 2.41651E-5 41382 0 NA
6-143486251-C-T p.Ala110Ala synonymous AIG1 1 82740 1.20861E-5 41370 0 NA
6-143486270-T-C p.Tyr117His missense AIG1 24 82694 2.90227E-4 41347 0 1.9101E-4
6-143486271-A-T p.Tyr117Phe missense AIG1 1 82714 1.20899E-5 41357 0 3.98206E-6
6-143486274-C-T p.Pro118Leu missense AIG1 6 82722 7.25321E-5 41361 0 6.25E-4
6-143486275-G-A p.Pro118Pro synonymous AIG1 2 82736 2.41733E-5 41368 0 3.29669E-5
6-143486297-C-T p.Pro126Ser missense AIG1 4 82664 4.83887E-5 41332 0 2.47304E-5
6-143486302-G-A p.Gly127Gly synonymous AIG1 5 82650 6.04961E-5 41325 0 2.54761E-4
6-143486305-G-A p.Trp128* stop_gained AIG1 1 82638 1.2101E-5 41319 0 NA
6-143486312-C-T p.His131Tyr missense AIG1 1 82584 1.21089E-5 41292 0 NA
6-143486312-C-A p.His131Asn missense AIG1 1 82584 1.21089E-5 41292 0 NA
6-143486314-C-T p.His131His synonymous AIG1 68 82526 8.23983E-4 41263 0 0.00286486
6-143508519-T-A c.400-6T>A splice_region AIG1 2 51232 3.90381E-5 25616 0 7.77315E-6
6-143508751-CCTTT-C n.387-8_387-5delTTCT splice_region AIG1 3 75814 3.95705E-5 37907 0 9.67075E-5
6-143508778-T-A p.Ter138Lysext*? stop_lost AIG1 2 75874 2.63595E-5 37937 0 7.43926E-6
6-143605244-C-T c.400-3C>T splice_region AIG1 4 82744 4.83419E-5 41372 0 NA
6-143605251-C-T p.Thr135Met missense AIG1 1 82906 1.20619E-5 41453 0 3.18613E-5
6-143605252-G-C p.Thr135Thr synonymous AIG1 1 82908 1.20616E-5 41454 0 1.70961E-5
6-143605252-G-A p.Thr135Thr synonymous AIG1 5 82908 6.03078E-5 41454 0 3.18695E-5
6-143605254-C-T p.Thr136Met missense AIG1 1 82950 1.20555E-5 41475 0 4.25894E-5
6-143605256-G-A p.Val137Ile missense AIG1 1 83028 1.20441E-5 41514 0 NA
6-143605261-G-A p.Leu138Leu synonymous AIG1 438 83064 0.00527304 41532 8 0.0112796
6-143605276-C-T p.Ile143Ile synonymous AIG1 2 83144 2.40547E-5 41572 0 3.97921E-6
6-143605282-G-A p.Met145Ile missense AIG1 1 83188 1.2021E-5 41594 0 8.33667E-6
6-143605291-G-A p.Ser148Ser synonymous AIG1 49 83190 5.89013E-4 41595 1 8.92061E-4
6-143605296-A-G p.His150Arg missense AIG1 1 83204 1.20187E-5 41602 0 3.18573E-5
6-143605307-A-G p.Ser154Gly missense AIG1 4 83190 4.80827E-5 41595 0 1.59137E-5
6-143605309-C-A p.Ser154Arg missense AIG1 1 83192 1.20204E-5 41596 0 NA
6-143605318-C-T p.Ser157Ser synonymous AIG1 2 83154 2.40518E-5 41577 0 6.25E-4
6-143605319-G-A p.Gly158Arg missense AIG1 1 83154 1.20259E-5 41577 0 3.35734E-5
6-143605327-C-T p.Thr160Thr synonymous AIG1 3 83122 3.60915E-5 41561 0 3.18451E-5
6-143605332-T-C p.Ile162Thr missense AIG1 1 83098 1.2034E-5 41549 0 NA
6-143605341-T-C p.Phe165Ser missense AIG1 1 83046 1.20415E-5 41523 0 NA
6-143605346-G-A p.Val167Ile missense AIG1 4 83032 4.81742E-5 41516 0 NA
6-143605353-A-G p.Tyr169Cys missense AIG1 6 82908 7.23694E-5 41454 0 3.18532E-5
6-143605355-A-G p.Ile170Val missense AIG1 1 82934 1.20578E-5 41467 0 9.55353E-5
6-143605357-A-T p.Ile170Ile synonymous AIG1 3 82916 3.61812E-5 41458 0 NA
6-143605361-T-A p.Trp172Arg missense+splice_region AIG1 2 82886 2.41295E-5 41443 0 NA
6-143605368-G-T c.515+6G>T splice_region AIG1 9 82758 1.08751E-4 41379 0 3.07662E-4
6-143605370-C-T c.515+8C>T splice_region AIG1 1 82698 1.20922E-5 41349 0 1.99984E-5
6-143654424-G-T p.Cys174Phe missense AIG1 1 83054 1.20404E-5 41527 0 NA
6-143654447-ATGTGGG-A p.Trp183_Val184del disruptive_inframe_deletion AIG1 1 83214 1.20172E-5 41607 0 1.65623E-5
6-143654449-G-A p.Met182Ile missense AIG1 1 83220 1.20163E-5 41610 0 8.27678E-5
6-143654458-C-T p.Tyr185Tyr synonymous AIG1 1 83242 1.20132E-5 41621 0 NA
6-143654460-C-T p.Pro186Leu missense AIG1 1 83254 1.20114E-5 41627 0 8.25846E-6
6-143654467-G-C p.Leu188Leu synonymous AIG1 1 83268 1.20094E-5 41634 0 1.19485E-5
6-143654484-G-A p.Gly194Glu missense AIG1 1 83306 1.20039E-5 41653 0 3.1835E-5
6-143654492-A-G p.Ile197Val missense AIG1 1 83328 1.20008E-5 41664 0 NA
6-143654494-CATCTTCTTTGGGTCTACAA-C p.Ile198fs frameshift AIG1 1 83330 1.20005E-5 41665 0 NA
6-143654497-C-T p.Ile198Ile synonymous AIG1 8 83326 9.60085E-5 41663 0 0.00100806
6-143654506-G-A p.Gly201Gly synonymous AIG1 1 83318 1.20022E-5 41659 0 NA
6-143654509-T-C p.Ser202Ser synonymous AIG1 1 83308 1.20036E-5 41654 0 1.64842E-5
6-143654537-C-A p.Leu212Met missense AIG1 1 83328 1.20008E-5 41664 0 5.04541E-4
6-143654567-T-C p.Trp222Arg missense AIG1 1 83286 1.20068E-5 41643 0 NA
6-143654583-G-T c.679+1G>T splice_donor AIG1 1 83188 1.2021E-5 41594 0 NA
6-143654585-A-ATGGAAGAAGAGAAAGAAAAGCCTAAATTGGAATGAG c.679+3_679+4insTGGAAGAAGAGAAAGAAAAGCCTAAATTGGAATGAG splice_region AIG1 1 83174 1.2023E-5 41587 0 NA
6-143655214-G-C c.680-1G>C splice_acceptor AIG1 1 76900 1.30039E-5 38450 0 NA
6-143655225-T-A p.Ser230Ser synonymous AIG1 1 76938 1.29975E-5 38469 0 NA
6-143655237-G-A c.697+5G>A splice_region AIG1 8 76874 1.04066E-4 38437 0 6.25E-4
6-143656184-T-G c.698-4T>G splice_region AIG1 1 73736 1.35619E-5 36868 0 NA
6-143656207-G-A p.Met239Ile missense AIG1 1 74234 1.34709E-5 37117 0 3.18654E-5
6-143656223-A-C p.Ser245Arg missense AIG1 1 74554 1.34131E-5 37277 0 NA
6-143660754-AACACTTTGCCTGTATTTCTAG-A c.524-21_524-1delACACTTTGCCTGTATTTCTAG splice_acceptor AIG1 1 82382 1.21386E-5 41191 0 NA
6-143660778-A-G p.Met176Val missense+splice_region AIG1 1 82748 1.20849E-5 41374 0 NA
6-143660781-G-C p.Glu177Gln missense AIG1 1 82830 1.20729E-5 41415 0 NA
6-143660787-G-A p.Glu179Lys missense AIG1 1 82874 1.20665E-5 41437 0 NA
6-143660798-G-A p.Lys182Lys synonymous AIG1 1 82912 1.2061E-5 41456 0 NA
6-143660801-TA-T p.Lys184fs frameshift AIG1 1 82926 1.20589E-5 41463 0 5.03525E-4
6-143660807-G-T p.Leu185Phe missense AIG1 1 82906 1.20619E-5 41453 0 NA