Variant

Variant ID Consequence Effect Gene AC AN AF NS NHOM maxEAF
22-21322078-C-T n.42-3C>T splice_region AIFM3 2 70488 2.83736E-5 35244 0 NA
22-21322095-C-T c.-64C>T splice_region AIFM3 1 72432 1.38061E-5 36216 0 3.18857E-5
22-21322115-A-T c.-118A>T 5_prime_UTR_premature_start_codon_gain AIFM3 1 74180 1.34807E-5 37090 0 NA
22-21322168-G-C p.Ala4Pro missense AIFM3 2 77982 2.56469E-5 38991 0 1.21671E-5
22-21322169-C-A p.Ala4Asp missense AIFM3 1 78150 1.27959E-5 39075 0 4.05032E-6
22-21322180-C-T p.Arg8* stop_gained AIFM3 1 78758 1.26971E-5 39379 0 1.61189E-5
22-21322190-C-A p.Pro11His missense AIFM3 4 79320 5.04286E-5 39660 0 1.20628E-5
22-21322191-C-T p.Pro11Pro synonymous AIFM3 3 79342 3.7811E-5 39671 0 8.40308E-6
22-21322198-G-A p.Ala14Thr missense AIFM3 1 79468 1.25837E-5 39734 0 1.67591E-5
22-21322198-G-T p.Ala14Ser missense AIFM3 1 79468 1.25837E-5 39734 0 1.67591E-5
22-21322199-C-T p.Ala14Val missense AIFM3 1 79586 1.2565E-5 39793 0 4.01868E-6
22-21322201-C-T p.Pro15Ser missense AIFM3 1 79688 1.25489E-5 39844 0 1.67395E-5
22-21322208-G-A p.Cys17Tyr missense AIFM3 2 79908 2.50288E-5 39954 0 1.66959E-5
22-21322210-C-T p.Arg18Trp missense AIFM3 6 79952 7.5045E-5 39976 0 6.25E-4
22-21322211-G-A p.Arg18Gln missense AIFM3 14 79994 1.75013E-4 39997 0 5.73943E-4
22-21322222-G-A p.Gly22Ser missense AIFM3 5 80286 6.22774E-5 40143 0 2.49493E-5
22-21322226-A-C p.His23Pro missense AIFM3 1 80214 1.24667E-5 40107 0 8.31241E-6
22-21322238-C-T p.Ala27Val missense AIFM3 299 80264 0.00372521 40132 4 0.00701441
22-21322239-G-A p.Gly3Ser missense AIFM3 1 80248 1.24614E-5 40124 0 1.6603E-5
22-21322243-G-C p.Cys4Ser missense AIFM3 31 80280 3.86148E-4 40140 0 6.25E-4
22-21322261-C-CAGTGGAGCTCAAGATCG p.Pro19fs frameshift AIFM3 1 79878 1.25191E-5 39939 0 NA
22-21322262-A-G p.Gln35Arg missense+splice_region AIFM3 4 79802 5.01241E-5 39901 0 3.19183E-5
22-21327579-C-T p.Gly11Gly splice_region+synonymous AIFM3 6 79904 7.50901E-5 39952 0 6.25E-4
22-21327580-G-A p.Ala12Thr missense+splice_region AIFM3 3 80002 3.74991E-5 40001 0 1.91883E-4
22-21327587-TGC-CGT p.LeuPro14SerSer missense AIFM3 1 80384 1.24403E-5 40192 0 NA
22-21327589-C-T p.Pro15Ser missense AIFM3 10702 79960 0.133842 39980 773 0.263982
22-21327594-A-C c.32-2A>C splice_acceptor AIFM3 1 80634 1.24017E-5 40317 0 3.19509E-5
22-21327621-G-T p.Cys44Phe missense AIFM3 1 81134 1.23253E-5 40567 0 NA
22-21327634-C-T p.Arg24* stop_gained AIFM3 1 81138 1.23247E-5 40569 0 1.27665E-4
22-21327635-G-A p.Arg24Gln missense AIFM3 1 81234 1.23101E-5 40617 0 1.68577E-5
22-21327642-G-A p.Arg51Lys missense AIFM3 177 81274 0.00217782 40637 0 0.00150616
22-21327648-G-C p.Glu28Asp missense AIFM3 1 81220 1.23122E-5 40610 0 NA
22-21327653-C-T p.Ser30Leu missense AIFM3 10 81140 1.23244E-4 40570 0 6.94367E-5
22-21327653-C-A p.Ser30* stop_gained AIFM3 3 81140 3.69731E-5 40570 0 NA
22-21327663-G-A p.Gly58Glu missense AIFM3 1 81058 1.23368E-5 40529 0 NA
22-21327667-G-A p.Gly35Ser missense AIFM3 1 80926 1.2357E-5 40463 0 NA
22-21327676-C-T p.Arg38Trp missense AIFM3 2 80696 2.47844E-5 40348 0 3.37314E-5
22-21327677-G-A p.Arg38Gln missense AIFM3 2 80732 2.47733E-5 40366 0 4.1265E-6
22-21327690-C-T p.Ala67Val missense AIFM3 1 80316 1.24508E-5 40158 0 8.20641E-6
22-21327699-G-A p.Arg70Gln missense AIFM3 1 79938 1.25097E-5 39969 0 1.64038E-5
22-21327703-C-T p.Arg47Cys missense AIFM3 2 81474 2.45477E-5 40737 0 3.18939E-5
22-21327716-C-T p.Thr51Met missense AIFM3 1 81608 1.22537E-5 40804 0 3.18674E-5
22-21327717-G-A p.Arg76Gln missense AIFM3 1 81612 1.22531E-5 40806 0 2.62343E-5
22-21327721-G-T p.Glu53* stop_gained AIFM3 5 81616 6.12625E-5 40808 0 1.20521E-5
22-21327724-C-G p.Arg54Gly missense AIFM3 4 81534 4.90593E-5 40767 0 6.37918E-5
22-21327724-C-T p.Arg54Cys missense AIFM3 1 81536 1.22645E-5 40768 0 2.00889E-5
22-21327725-G-T p.Arg54Leu missense AIFM3 2 81520 2.45339E-5 40760 0 8.03503E-6
22-21327727-C-A p.Leu55Met missense AIFM3 3 81520 3.68008E-5 40760 0 8.03213E-6
22-21327727-C-T p.Leu55Leu synonymous AIFM3 1 81520 1.22669E-5 40760 0 NA
22-21327733-AC-A p.Pro58fs frameshift AIFM3 1 81258 1.23065E-5 40629 0 1.73112E-5
22-21327760-G-T p.Asp66Tyr missense AIFM3 1 80536 1.24168E-5 40268 0 4.02512E-6
22-21327766-G-A p.Val68Met missense AIFM3 1 80180 1.24719E-5 40090 0 NA
22-21327787-G-A p.Val75Ile missense AIFM3 14 78520 1.78299E-4 39260 0 0.00125
22-21327792-G-A p.Arg101Lys missense AIFM3 12 78054 1.5374E-4 39027 0 0.00100806
22-21327796-C-T p.Leu78Phe missense AIFM3 1 76742 1.30307E-5 38371 0 9.4058E-5
22-21327798-C-T p.Ser103Leu missense AIFM3 1 76084 1.31434E-5 38042 0 3.19163E-5
22-21327966-C-A n.591C>A splice_region AIFM3 1 69490 1.43906E-5 34745 0 NA
22-21327967-AGAA-CGCC n.592_*3delAGAAinsCGCC splice_region AIFM3 1 69660 1.43554E-5 34830 0 NA
22-21328051-C-A p.Cys62* stop_gained AIFM3 4 78000 5.12821E-5 39000 0 1.07504E-4
22-21328051-C-T p.Arg84Trp missense AIFM3 1 78000 1.28205E-5 39000 0 5.37519E-5
22-21328077-G-A p.Arg71Lys missense AIFM3 27 78850 3.42422E-4 39425 0 0.00102881
22-21328079-T-C p.Val93Ala missense AIFM3 1 78906 1.26733E-5 39453 0 NA
22-21328098-T-C p.Asn99Asn synonymous AIFM3 1 79230 1.26215E-5 39615 0 4.91777E-6
22-21328111-G-A p.Ala104Thr missense AIFM3 1 79332 1.26053E-5 39666 0 3.5524E-5
22-21328112-C-G p.Ala104Gly missense AIFM3 7 79380 8.81834E-5 39690 0 1.42339E-4
22-21328114-C-G p.Leu105Val missense AIFM3 19 79418 2.3924E-4 39709 0 5.39258E-4
22-21328114-C-T p.Leu105Leu synonymous AIFM3 1 79418 1.25916E-5 39709 0 1.01588E-5
22-21328121-A-G p.His107Arg missense AIFM3 5 79532 6.28678E-5 39766 1 1.86261E-4
22-21328130-C-T p.Pro110Leu missense AIFM3 1 79548 1.2571E-5 39774 0 1.30936E-4
22-21328131-G-A p.Pro110Pro synonymous AIFM3 1 79530 1.25739E-5 39765 0 1.74171E-4
22-21328134-C-G p.His111Gln missense AIFM3 1 79610 1.25612E-5 39805 0 NA
22-21328134-C-A p.His111Gln missense AIFM3 1 79610 1.25612E-5 39805 0 NA
22-21328137-C-T p.Tyr112Tyr synonymous AIFM3 21 79620 2.63753E-4 39810 0 3.50855E-4
22-21328138-G-A p.Gly113Ser missense AIFM3 4 79576 5.02664E-5 39788 0 4.00142E-4
22-21328139-G-A p.Gly113Asp missense AIFM3 1 79604 1.25622E-5 39802 0 NA
22-21328140-C-T p.Gly113Gly synonymous AIFM3 1 79530 1.25739E-5 39765 0 0.00153531
22-21328141-G-A p.Ala114Thr missense AIFM3 2 79508 2.51547E-5 39754 0 0.00153689
22-21328353-C-T p.Arg83Cys missense+splice_region AIFM3 1 81358 1.22914E-5 40679 0 2.96497E-5
22-21328355-T-C p.Val120Ala missense AIFM3 1 81402 1.22847E-5 40701 0 NA
22-21328361-C-T p.Ser122Phe missense AIFM3 3 81494 3.68125E-5 40747 0 NA
22-21328363-C-T p.Arg123Cys missense AIFM3 4 81492 4.90846E-5 40746 0 3.71689E-5
22-21328369-C-T p.Arg125Trp missense AIFM3 1 81512 1.22681E-5 40756 0 3.34993E-5
22-21328370-G-A p.Arg125Gln missense AIFM3 4 81554 4.90473E-5 40777 0 NA
22-21328375-C-T p.Arg127Cys missense AIFM3 1 81598 1.22552E-5 40799 0 2.8539E-5
22-21328376-G-A p.Arg127His missense AIFM3 6 81622 7.35096E-5 40811 0 6.37755E-5
22-21328381-C-A p.Pro129Thr missense AIFM3 2 81720 2.44738E-5 40860 0 5.97217E-5
22-21328389-C-G p.His131Gln missense AIFM3 1 81732 1.22351E-5 40866 0 NA
22-21328389-C-T p.Arg95Trp missense AIFM3 3 81732 3.67053E-5 40866 0 1.92086E-5
22-21328392-C-T p.Arg96Cys missense AIFM3 2 81698 2.44804E-5 40849 0 1.89401E-5
22-21328410-C-T p.His102Tyr missense AIFM3 1 81786 1.2227E-5 40893 0 NA
22-21328434-T-C p.Trp110Arg missense AIFM3 1 81620 1.22519E-5 40810 0 4.02236E-6
22-21328435-G-A p.Trp110* stop_gained AIFM3 3 81600 3.67647E-5 40800 0 6.37552E-5
22-21328458-C-T p.Pro118Ser missense AIFM3 1 81466 1.22751E-5 40733 0 NA
22-21328458-CCAGGTGGGGCCAGGAGTGCGATGGGGTGGGAACCTGGGGGTGTGGGGTTCGGGGCTGGTCCTGAGCAATGCAGCCCTTG-C p.Gln155del splice_donor AIFM3 7 81466 8.59254E-5 40733 1 NA
22-21328567-C-T p.Tyr164Tyr synonymous AIFM3 4 82144 4.8695E-5 41072 0 5.06586E-4
22-21328568-G-A p.Val165Ile missense AIFM3 1818 82026 0.0221637 41013 29 0.0184713
22-21328568-G-C p.Val165Leu missense AIFM3 2 82096 2.43617E-5 41048 0 NA
22-21328571-C-T p.Arg166Trp missense AIFM3 19 82066 2.31521E-4 41033 0 1.1627E-4
22-21328572-G-A p.Arg166Gln missense AIFM3 27 82100 3.28867E-4 41050 0 3.20579E-4
22-21328576-C-T p.Ala167Ala synonymous AIFM3 1 82048 1.2188E-5 41024 0 2.61019E-5
22-21328579-C-A p.Ser168Arg missense AIFM3 1 82010 1.21936E-5 41005 0 4.01519E-6
22-21328586-G-T c.510+1G>T splice_donor AIFM3 1 81888 1.22118E-5 40944 0 1.76274E-5
22-21328588-G-T c.510+3G>T splice_region AIFM3 1 81876 1.22136E-5 40938 0 NA
22-21328590-G-C c.510+5G>C splice_region AIFM3 3 81858 3.66488E-5 40929 0 4.02334E-6
22-21328592-G-C c.510+7G>C splice_region AIFM3 3 81808 3.66712E-5 40904 0 NA
22-21328829-C-T p.Arg176* stop_gained AIFM3 3 82848 3.62109E-5 41424 0 3.18857E-5
22-21328841-G-A p.Val180Met missense AIFM3 1 82976 1.20517E-5 41488 0 NA
22-21328847-G-C p.Ala182Pro missense AIFM3 1 82990 1.20496E-5 41495 0 NA
22-21328867-T-G p.Ser188Arg missense AIFM3 2 83018 2.40912E-5 41509 0 NA
22-21328876-C-T p.Tyr191Tyr synonymous AIFM3 2 83036 2.40859E-5 41518 0 3.56322E-5
22-21328888-C-T p.Thr195Thr synonymous AIFM3 5 83036 6.02148E-5 41518 0 3.18796E-5
22-21328899-T-C p.Ile199Thr missense AIFM3 32 83030 3.85403E-4 41515 0 0.0015052
22-21328903-G-T p.Val200Val synonymous AIFM3 3 83034 3.61298E-5 41517 0 4.14462E-4
22-21328907-GCAGGTTGGTAGTGGGGTCATGAGGGGCAGGGTGGGAGATGGGATTGGTGAGAAGTGGTTCCTGGCCCACGGGCCCCTCCCCT-G p.Ala202del splice_donor AIFM3 1 83006 1.20473E-5 41503 0 NA
22-21328910-G-A p.Gly203Ser missense+splice_region AIFM3 1 83000 1.20482E-5 41500 0 1.75488E-5
22-21328988-C-A c.608-5C>A splice_region AIFM3 3 82918 3.61803E-5 41459 0 3.9901E-6
22-21328999-C-G p.Ala205Gly missense AIFM3 1 82938 1.20572E-5 41469 0 9.18028E-5
22-21329013-G-C p.Ala210Pro missense AIFM3 1 82978 1.20514E-5 41489 0 NA
22-21329025-C-T p.Arg214Trp missense AIFM3 10 82974 1.2052E-4 41487 0 6.38447E-5
22-21329026-G-A p.Arg214Gln missense AIFM3 1 82976 1.20517E-5 41488 0 3.32441E-5
22-21329035-G-T p.Gly217Val missense AIFM3 3 82914 3.61821E-5 41457 0 1.59632E-4
22-21329042-C-T p.Ser219Ser synonymous AIFM3 1 82892 1.20639E-5 41446 0 4.15317E-5
22-21329046-C-A p.Arg221Arg synonymous AIFM3 2 82872 2.41336E-5 41436 0 3.9847E-6
22-21329047-G-A p.Arg221Gln missense AIFM3 2 82850 2.414E-5 41425 0 1.66102E-5
22-21329051-C-A p.Ile222Ile synonymous AIFM3 1 82822 1.20741E-5 41411 0 NA
22-21329052-G-A p.Val223Ile missense AIFM3 2 82782 2.41598E-5 41391 0 5.0813E-4
22-21329053-T-G p.Val223Gly missense AIFM3 1 82786 1.20793E-5 41393 0 3.98492E-6
22-21329063-G-A p.Thr226Thr synonymous AIFM3 8 82692 9.67445E-5 41346 0 6.3857E-5
22-21329070-C-T p.Arg229Trp missense AIFM3 13 82614 1.57358E-4 41307 0 1.55444E-4
22-21329070-C-G p.Arg229Gly missense AIFM3 1 82614 1.21045E-5 41307 0 NA
22-21329071-G-A p.Arg229Gln missense AIFM3 2 82548 2.42283E-5 41274 0 4.78351E-5
22-21329072-G-T p.Arg229Arg synonymous AIFM3 1 82546 1.21145E-5 41273 0 4.15151E-5
22-21329081-C-G p.Pro232Pro synonymous AIFM3 2 82412 2.42683E-5 41206 0 1.66118E-5
22-21329083-A-G p.Tyr233Cys missense AIFM3 1 82316 1.21483E-5 41158 0 8.30841E-6
22-21329084-C-T p.Tyr233Tyr synonymous AIFM3 3 82278 3.64618E-5 41139 0 5.13347E-4
22-21329085-G-A p.Asp234Asn missense AIFM3 1 82190 1.21669E-5 41095 0 6.38284E-5
22-21329088-C-T p.Arg235Cys missense AIFM3 1 82140 1.21743E-5 41070 0 1.66268E-5
22-21329088-C-G p.Arg235Gly missense AIFM3 2 82140 2.43487E-5 41070 0 NA
22-21329089-G-A p.Arg235His missense AIFM3 1 82050 1.21877E-5 41025 0 5.81956E-5
22-21329096-G-C p.Lys237Asn missense AIFM3 4 81960 4.88043E-5 40980 0 3.18939E-5
22-21329975-CTGCAG-C c.721-5_721-1delTGCAG splice_acceptor AIFM3 1 80432 1.24329E-5 40216 0 NA
22-21329981-T-C p.Ser241Pro missense+splice_region AIFM3 1 80438 1.24319E-5 40219 0 1.66055E-5
22-21329985-T-G p.Leu242Arg missense AIFM3 1 80548 1.2415E-5 40274 0 NA
22-21329995-G-A p.Gln245Gln synonymous AIFM3 5 80636 6.2007E-5 40318 0 1.27405E-4
22-21330001-G-A p.Glu247Glu synonymous AIFM3 2 80658 2.47961E-5 40329 0 3.31917E-5
22-21330019-C-T p.Pro253Pro synonymous AIFM3 2 80564 2.4825E-5 40282 0 2.5921E-4
22-21330028-T-C p.Phe256Phe synonymous AIFM3 1 80414 1.24356E-5 40207 0 1.65912E-5
22-21330032-C-T p.Arg258* stop_gained AIFM3 7 80204 8.72774E-5 40102 0 3.596E-5
22-21330034-A-G p.Arg258Arg synonymous AIFM3 3 80182 3.74149E-5 40091 0 1.19715E-5
22-21330036-C-T p.Ala259Val missense AIFM3 1 80086 1.24866E-5 40043 0 NA
22-21330040-T-A p.Tyr260* stop_gained AIFM3 1 80024 1.24963E-5 40012 0 NA
22-21330058-C-T p.Thr266Thr synonymous AIFM3 3 78734 3.8103E-5 39367 0 3.18512E-5
22-21330514-T-G p.Val273Gly missense AIFM3 1 82026 1.21913E-5 41013 0 NA
22-21330518-C-T p.Asp274Asp synonymous AIFM3 4 82090 4.8727E-5 41045 0 9.27265E-5
22-21330527-T-A p.Thr277Thr synonymous AIFM3 1 82330 1.21462E-5 41165 0 NA
22-21330534-G-A p.Val280Ile missense AIFM3 4 82420 4.85319E-5 41210 0 3.18471E-5
22-21330536-C-T p.Val280Val synonymous AIFM3 6 82390 7.28244E-5 41195 0 0.00100908
22-21330537-G-A p.Val281Met missense AIFM3 10 82420 1.2133E-4 41210 0 1.27397E-4
22-21330558-C-G p.Leu288Val missense AIFM3 1 82444 1.21294E-5 41222 0 NA
22-21330574-T-C p.Leu293Pro missense AIFM3 1 82330 1.21462E-5 41165 0 NA
22-21330587-A-C p.Pro297Pro synonymous AIFM3 2 82052 2.43748E-5 41026 0 NA
22-21330592-GCAGGTGGGAGGGTCTCCTTTTTACCCATCGGACACTAGGCAGGGCACTGGCCTGGACGGGGCTGGGGCTGCCAGGAGGCCCTCACTGACACGGCCATGTCT-G p.Ser300del splice_donor AIFM3 8 81900 9.76801E-5 40950 3 NA
22-21330700-C-G p.Pro301Pro synonymous AIFM3 1 79724 1.25433E-5 39862 0 NA
22-21330716-A-C p.Lys307Gln missense AIFM3 1 80112 1.24825E-5 40056 0 3.18492E-5
22-21330730-G-A p.Val311Val synonymous AIFM3 1 80546 1.24153E-5 40273 0 3.99316E-6
22-21330736-C-T p.Asn313Asn synonymous AIFM3 2 80566 2.48244E-5 40283 0 2.5074E-5
22-21330737-G-A p.Val314Met missense AIFM3 1 80654 1.23986E-5 40327 0 2.79455E-5
22-21330746-A-C p.Ile317Leu missense AIFM3 2 81034 2.4681E-5 40517 0 2.42159E-4
22-21330748-C-T p.Ile317Ile synonymous AIFM3 2 81096 2.46621E-5 40548 0 1.99577E-5
22-21330749-C-T p.Arg318Trp missense AIFM3 5 81114 6.16416E-5 40557 0 0.00100705
22-21330750-G-A p.Arg318Gln missense AIFM3 17 81102 2.09613E-4 40551 0 1.99652E-5
22-21330753-C-T p.Thr319Met missense AIFM3 1 81202 1.2315E-5 40601 0 3.18451E-5
22-21330754-G-A p.Thr319Thr synonymous AIFM3 8 81242 9.84712E-5 40621 0 7.98473E-5
22-21330760-G-A p.Glu321Glu synonymous AIFM3 7 81558 8.58285E-5 40779 0 5.04032E-4
22-21330768-A-G p.Asn324Ser missense AIFM3 1 81730 1.22354E-5 40865 0 8.33945E-6
22-21330771-G-A p.Arg325His missense AIFM3 1 81742 1.22336E-5 40871 0 5.58998E-5
22-21330772-C-T p.Arg325Arg synonymous AIFM3 2 81788 2.44535E-5 40894 0 2.39548E-5
22-21330773-G-A p.Val326Met missense AIFM3 3 81832 3.66605E-5 40916 1 1.08388E-4
22-21330776-G-A p.Val327Met missense AIFM3 1 81898 1.22103E-5 40949 0 NA
22-21330787-C-T p.Ala330Ala synonymous AIFM3 23112 81366 0.28405 40683 3472 0.281875
22-21330787-CCG-TCT p.AlaArg330AlaLeu missense AIFM3 1 81954 1.2202E-5 40977 0 NA
22-21330787-CCG-TCA p.AlaArg330AlaGln missense AIFM3 1 81954 1.2202E-5 40977 0 NA
22-21330788-C-T p.Arg331* stop_gained AIFM3 3 81928 3.66175E-5 40964 0 3.18735E-5
22-21330789-G-A p.Arg331Gln missense AIFM3 3 81944 3.66104E-5 40972 0 1.67149E-5
22-21330795-G-A p.Arg333His missense AIFM3 4 81998 4.87817E-5 40999 0 0.0020141
22-21330795-G-T p.Arg333Leu missense AIFM3 1 81998 1.21954E-5 40999 0 NA
22-21330799-C-T p.Asn334Asn synonymous AIFM3 1 82060 1.21862E-5 41030 0 1.67316E-5
22-21330800-G-A p.Val335Met missense AIFM3 2 82092 2.43629E-5 41046 0 5.01907E-5
22-21330805-C-T p.Val336Val synonymous AIFM3 3 82086 3.6547E-5 41043 0 9.56267E-5
22-21330806-G-A p.Val337Ile missense AIFM3 6 82096 7.30852E-5 41048 0 1.32195E-4
22-21330808-C-T p.Val337Val synonymous AIFM3 2 82102 2.43599E-5 41051 0 NA
22-21330809-G-A p.Val338Met missense AIFM3 4 82148 4.86926E-5 41074 0 6.37349E-5
22-21330818-G-A p.Gly341Ser missense AIFM3 305 82162 0.00371218 41081 3 0.0125881
22-21330825-T-C p.Leu343Pro missense+splice_region AIFM3 1 82232 1.21607E-5 41116 0 5.03525E-4
22-21330833-A-C c.1030+6A>C splice_region AIFM3 43 82110 5.23688E-4 41055 0 8.94226E-4
22-21330933-T-A c.1031-7T>A splice_region AIFM3 1 81516 1.22675E-5 40758 0 1.99992E-5
22-21330939-G-A c.1031-1G>A splice_acceptor AIFM3 1 81614 1.22528E-5 40807 0 3.18715E-5
22-21330942-A-T p.Met345Leu missense+splice_region AIFM3 1 81632 1.22501E-5 40816 0 NA
22-21330953-C-T p.Ala348Ala synonymous AIFM3 2 81620 2.45038E-5 40810 0 2.09682E-5
22-21330954-G-A p.Ala349Thr missense AIFM3 3 81646 3.6744E-5 40823 0 6.37471E-5
22-21330964-C-A p.Thr352Lys missense AIFM3 1 81834 1.22199E-5 40917 0 1.03879E-5
22-21330965-G-A p.Thr352Thr synonymous AIFM3 6 81812 7.33389E-5 40906 0 6.37552E-5
22-21330973-C-T p.Ala355Val missense AIFM3 8 81884 9.76992E-5 40942 0 0.0015121
22-21330979-C-A p.Ser357Tyr missense AIFM3 8 82028 9.75277E-5 41014 0 5.20606E-5
22-21330989-G-A p.Val360Val synonymous AIFM3 1 82098 1.21806E-5 41049 0 NA
22-21330996-C-T p.Leu363Leu synonymous AIFM3 6 82076 7.3103E-5 41038 0 3.50832E-4
22-21331006-C-T p.Thr366Met missense AIFM3 8 82138 9.73971E-5 41069 0 1.0533E-4
22-21331007-G-A p.Thr366Thr synonymous AIFM3 4 82126 4.87056E-5 41063 0 2.44293E-4
22-21331012-T-G p.Phe368Cys missense AIFM3 9 82172 1.09526E-4 41086 0 6.38488E-5
22-21331026-G-A p.Gly373Arg missense AIFM3 1 82258 1.21569E-5 41129 0 5.04032E-4
22-21331028-G-A p.Gly373Gly synonymous AIFM3 2 82276 2.43084E-5 41138 0 NA
22-21331032-C-T p.Arg375Cys missense AIFM3 384 82198 0.00467165 41099 1 0.00668294
22-21331033-G-A p.Arg375His missense AIFM3 2 82254 2.43149E-5 41127 0 9.20057E-5
22-21331034-C-T p.Arg375Arg synonymous AIFM3 3 82288 3.64573E-5 41144 0 0.00100705
22-21331035-G-A p.Val376Met missense AIFM3 1 82320 1.21477E-5 41160 0 1.03554E-4
22-21331043-A-T p.Arg378Arg synonymous AIFM3 81284 81286 0.999975 40643 40642 1.0
22-21331044-G-A p.Ala379Thr missense AIFM3 2 82356 2.42848E-5 41178 0 NA
22-21331053-AAGGTGAGCCCACCCCAGCACCCAGTGCCTTGGAGCCCTGGGGCCCAGCCCGGCCCCTGGCTGGGCTCTCATCCACCGCCCACCTGCCCACTTGCCCTGAC-A p.Lys382fs frameshift AIFM3 7 82482 8.4867E-5 41241 2 NA
22-21331063-C-T c.1146+8C>T splice_region AIFM3 1 82462 1.21268E-5 41231 0 NA
22-21331171-C-T p.Arg388Trp missense AIFM3 35 83048 4.21443E-4 41524 0 8.2924E-4
22-21331172-G-A p.Arg388Gln missense AIFM3 5 83074 6.01873E-5 41537 0 1.27624E-4
22-21331173-G-A p.Arg388Arg synonymous AIFM3 6 83078 7.22213E-5 41539 0 6.37877E-5
22-21331174-G-T p.Val389Leu missense AIFM3 1 83080 1.20366E-5 41540 0 3.18918E-5
22-21331176-GA-G p.Lys390fs frameshift AIFM3 1 83096 1.20343E-5 41548 0 NA
22-21331179-G-A p.Lys390Lys synonymous AIFM3 1 83116 1.20314E-5 41558 0 6.37714E-5
22-21331187-T-G p.Met393Arg missense AIFM3 18 83154 2.16466E-4 41577 0 2.55249E-4
22-21331194-G-C p.Thr395Thr synonymous AIFM3 1 83144 1.20273E-5 41572 0 3.18939E-5
22-21331211-G-A p.Arg401Gln missense AIFM3 2 83158 2.40506E-5 41579 0 6.37999E-5
22-21331213-G-A p.Gly402Ser missense AIFM3 1 83164 1.20244E-5 41582 0 1.60044E-5
22-21331215-C-G p.Gly402Gly synonymous AIFM3 2 83150 2.40529E-5 41575 0 NA
22-21331225-AAGGTGGGCCCTTCTCCCTTCTCCCTGCTGCTTTCTGTCCTCTGTCCCCTGAGCCTGGGAGCTGGGTCCACCTGTTTATCCACCCACTCCCCAC-A c.1218+1_1219-1delGTGGGCCCTTCTCCCTTCTCCCTGCTGCTTTCTGTCCTCTGTCCCCTGAGCCTGGGAGCTGGGTCCACCTGTTTATCCACCCACTCCCCACAG splice_acceptor AIFM3 6 83176 7.21362E-5 41588 0 NA
22-21331314-C-T c.1219-7C>T splice_region AIFM3 1 83174 1.2023E-5 41587 0 NA
22-21331318-C-A c.1219-3C>A splice_region AIFM3 2 83184 2.40431E-5 41592 0 4.13012E-5
22-21331324-A-G p.Lys408Glu missense AIFM3 2 83196 2.40396E-5 41598 0 6.37714E-5
22-21331330-G-T p.Val410Phe missense AIFM3 2 83210 2.40356E-5 41605 0 3.97864E-6
22-21331353-C-T p.Val417Val synonymous AIFM3 11 83144 1.32301E-4 41572 0 6.62186E-5
22-21331354-G-A p.Val418Met missense AIFM3 7 83144 8.41913E-5 41572 0 1.59256E-4
22-21331357-C-T p.Arg419Trp missense AIFM3 2 83138 2.40564E-5 41569 0 1.99016E-5
22-21331358-G-A p.Arg419Gln missense AIFM3 1 83130 1.20294E-5 41565 0 1.15955E-4
22-21331362-T-C p.Ala420Ala synonymous AIFM3 1 83128 1.20296E-5 41564 0 8.28679E-6
22-21331366-G-A p.Val422Ile missense AIFM3 2 83114 2.40633E-5 41557 0 1.19437E-5
22-21331371-C-T p.Cys423Cys synonymous AIFM3 6 83048 7.22474E-5 41524 0 6.37349E-5
22-21331372-G-A p.Val424Met missense AIFM3 3 83048 3.61237E-5 41524 0 6.37146E-5
22-21331383-T-C p.Ile427Ile splice_region+synonymous AIFM3 2 82992 2.40987E-5 41496 0 NA
22-21331384-G-GATGATGCAGACCAATGTCCCAGGC c.1282_1282+1insATGATGCAGACCAATGTCCCAGGC splice_donor AIFM3 1 82968 1.20528E-5 41484 0 NA
22-21331385-G-A c.1282+1G>A splice_donor AIFM3 1 82966 1.20531E-5 41483 0 3.98394E-6
22-21331387-G-GCAGTGCCCGCCACAGGCTTCCTGAGGCAA c.1282+3_1282+4insCAGTGCCCGCCACAGGCTTCCTGAGGCAA splice_region AIFM3 1 82938 1.20572E-5 41469 0 NA
22-21331387-G-GCAGTGCCCGCCACAGGCTTCCTGAGGCA c.1282+3_1282+4insCAGTGCCCGCCACAGGCTTCCTGAGGCA splice_region AIFM3 1 82938 1.20572E-5 41469 0 NA
22-21331389-G-T c.1282+5G>T splice_region AIFM3 10 82892 1.20639E-4 41446 0 1.07583E-4
22-21331392-G-A c.1282+8G>A splice_region AIFM3 1 82864 1.2068E-5 41432 0 NA
22-21331982-C-T c.1283-7C>T splice_region AIFM3 1 83022 1.2045E-5 41511 0 3.18674E-5
22-21331987-A-T c.1283-2A>T splice_acceptor AIFM3 1 83044 1.20418E-5 41522 0 3.30017E-5
22-21331997-C-A p.Pro431Thr missense AIFM3 1 83144 1.20273E-5 41572 0 1.1934E-5
22-21331999-C-T p.Pro431Pro synonymous AIFM3 3 83206 3.60551E-5 41603 0 5.03525E-4
22-21332000-G-A p.Ala432Thr missense AIFM3 1 83222 1.20161E-5 41611 0 6.25E-4
22-21332029-C-T p.Ile441Ile synonymous AIFM3 1 83294 1.20057E-5 41647 0 5.03525E-4
22-21332030-G-A p.Gly442Ser missense AIFM3 8 83296 9.6043E-5 41648 0 7.32858E-4
22-21332030-G-T p.Gly442Cys missense AIFM3 4 83296 4.80215E-5 41648 0 NA
22-21332039-T-C p.Ser445Pro missense AIFM3 2 83296 2.40108E-5 41648 0 NA
22-21332042-C-T p.Arg446* stop_gained AIFM3 3 83306 3.60118E-5 41653 0 3.18695E-5
22-21332043-G-A p.Arg446Gln missense AIFM3 1 83302 1.20045E-5 41651 0 3.29549E-5
22-21332045-G-A p.Gly447Ser missense AIFM3 4 83310 4.80134E-5 41655 0 2.47162E-5
22-21332046-G-A p.Gly447Asp missense AIFM3 3 83306 3.60118E-5 41653 0 NA
22-21332063-AAGGTGGGGTGGATGGCACTGGGTGGGGAGGACCCGGTGCTGGGCTGGGAGTGGCAGGAGGTTCAGGTCAGGGCCCCTGTCACACCCATGGAGCTCTGGGCCCTCTCTCTAC-A p.Lys453fs frameshift AIFM3 3 83314 3.60084E-5 41657 0 NA
22-21332068-G-A c.1359+3G>A splice_region AIFM3 4 83310 4.80134E-5 41655 0 1.31235E-4
22-21332068-G-C c.1359+3G>C splice_region AIFM3 1 83310 1.20034E-5 41655 0 2.38608E-5
22-21332187-C-G p.Thr457Ser missense AIFM3 140 83316 0.00168035 41658 0 0.00162319
22-21332196-C-T p.Pro460Leu missense AIFM3 1 83330 1.20005E-5 41665 0 6.37796E-5
22-21332200-C-T p.Gly461Gly synonymous AIFM3 1 83312 1.20031E-5 41656 0 2.38608E-5
22-21332209-A-T p.Ala464Ala synonymous AIFM3 1 83320 1.20019E-5 41660 0 3.18837E-5
22-21332212-T-A p.Ala465Ala synonymous AIFM3 1 83316 1.20025E-5 41658 0 NA
22-21332215-C-T p.Gly466Gly synonymous AIFM3 1 83294 1.20057E-5 41647 0 0.00100705
22-21332222-G-C p.Val469Leu missense AIFM3 1 83280 1.20077E-5 41640 0 1.6484E-5
22-21332226-C-G p.Thr470Ser missense AIFM3 2 83278 2.40159E-5 41639 0 NA
22-21332238-C-T p.Ala474Val missense AIFM3 1 83256 1.20111E-5 41628 0 NA
22-21332241-G-T p.Trp475Leu missense AIFM3 1 83256 1.20111E-5 41628 0 3.97741E-6
22-21332252-C-T p.Arg479Cys missense AIFM3 11 83208 1.32199E-4 41604 0 6.37592E-5
22-21332253-G-A p.Arg479His missense AIFM3 2 83218 2.40333E-5 41609 0 6.37796E-5
22-21332263-C-T p.Asn482Asn synonymous AIFM3 500 83146 0.00601352 41573 8 0.0149525
22-21332273-T-C p.Trp486Arg missense AIFM3 1 83114 1.20317E-5 41557 0 1.59147E-5
22-21332285-C-T p.His490Tyr missense AIFM3 1 83002 1.20479E-5 41501 0 3.9801E-6
22-21332293-GGGTATGGCCAGTCCCGAGGCACATGGAGGGGTGGGAGGGAGTCTCAGGGTCTCAGTGTCCCCATGCCCATGCCTCAGTTGCTGACCTTGGGTCCTGGACACTGTTA-G p.Arg494fs frameshift AIFM3 1 82890 1.20642E-5 41445 0 NA
22-21332293-G-T p.Gln492His missense+splice_region AIFM3 1 82888 1.20645E-5 41444 0 NA
22-21332296-T-C c.1477+2T>C splice_donor AIFM3 14 82806 1.6907E-4 41403 0 1.91253E-4
22-21333552-T-A c.1478-8T>A splice_region AIFM3 2 79998 2.50006E-5 39999 0 1.0673E-4
22-21333554-C-T c.1478-6C>T splice_region AIFM3 2 80010 2.49969E-5 40005 0 NA
22-21333562-C-G p.Arg494Gly missense+splice_region AIFM3 3 80024 3.74888E-5 40012 0 1.2394E-5
22-21333562-C-CG p.Val495fs frameshift AIFM3 1 80024 1.24963E-5 40012 0 NA
22-21333563-G-A p.Arg494His missense AIFM3 1 80070 1.24891E-5 40035 0 NA
22-21333605-G-C p.Ser508Thr missense AIFM3 1628 78900 0.0206337 39450 98 0.0408346
22-21333609-T-C p.Thr509Thr synonymous AIFM3 1 78784 1.26929E-5 39392 0 NA
22-21333612-G-C p.Val510Val synonymous AIFM3 1 78516 1.27363E-5 39258 0 1.17884E-5
22-21333612-G-A p.Val510Val synonymous AIFM3 1 78516 1.27363E-5 39258 0 1.17884E-5
22-21333617-A-G p.Tyr512Cys missense AIFM3 1 78268 1.27766E-5 39134 0 4.65853E-5
22-21333617-A-T p.Tyr512Phe missense AIFM3 1 78268 1.27766E-5 39134 0 4.65853E-5
22-21333621-C-G p.Leu513Leu synonymous AIFM3 11 77972 1.41076E-4 38986 0 3.50922E-4
22-21333628-G-A p.Ala516Thr missense AIFM3 2 76946 2.59923E-5 38473 0 0.00261233
22-21333639-C-G p.Gly519Gly synonymous AIFM3 1 76306 1.31051E-5 38153 0 NA
22-21333640-A-G p.Lys520Glu missense AIFM3 7 76274 9.17744E-5 38137 0 6.38896E-5
22-21333647-T-G p.Leu522Arg missense AIFM3 1 75410 1.32608E-5 37705 0 NA
22-21333650-G-A p.Arg523His missense AIFM3 1 74560 1.3412E-5 37280 0 9.84931E-5
22-21333658-G-T p.Gly526Cys missense+splice_region AIFM3 1 74034 1.35073E-5 37017 0 6.46914E-6
22-21333659-G-GC c.1576+1_1576+2insC splice_donor AIFM3 2 73814 2.70951E-5 36907 0 NA
22-21333666-C-A c.1576+8C>A splice_region AIFM3 2 72124 2.773E-5 36062 0 6.90531E-5
22-21333913-C-G c.1577-3C>G splice_region AIFM3 3 82698 3.62766E-5 41349 0 NA
22-21333920-C-T p.Tyr527Tyr synonymous AIFM3 25 82784 3.01991E-4 41392 0 9.947E-5
22-21333921-G-A p.Gly528Arg missense AIFM3 2 82812 2.41511E-5 41406 0 6.37105E-5
22-21333922-G-T p.Gly528Val missense AIFM3 3 82826 3.62205E-5 41413 0 0.00100908
22-21333927-G-A p.Gly530Ser missense AIFM3 18 82872 2.17202E-4 41436 0 3.97823E-6
22-21333929-C-A p.Gly530Gly synonymous AIFM3 1 82864 1.2068E-5 41432 0 NA
22-21333939-G-T p.Val534Phe missense AIFM3 1 82956 1.20546E-5 41478 0 1.19335E-5
22-21333939-G-A p.Val534Ile missense AIFM3 1 82956 1.20546E-5 41478 0 NA
22-21333939-G-C p.Val534Leu missense AIFM3 1 82956 1.20546E-5 41478 0 NA
22-21333947-C-T p.Ile536Ile synonymous AIFM3 1 82982 1.20508E-5 41491 0 NA
22-21333954-G-T p.Asp539Tyr missense AIFM3 6 83012 7.22787E-5 41506 0 6.84751E-4
22-21333966-C-T p.Leu543Leu synonymous AIFM3 1 83004 1.20476E-5 41502 0 3.18756E-5
22-21333988-CTAAG-C p.Lys551fs frameshift AIFM3 1 82918 1.20601E-5 41459 0 4.12691E-5
22-21333994-G-A c.1652+3G>A splice_region AIFM3 3 82894 3.61908E-5 41447 0 2.47668E-5
22-21333998-G-T c.1652+7G>T splice_region AIFM3 2 82834 2.41447E-5 41417 0 NA
22-21334310-G-A p.Gly552Ser missense+splice_region AIFM3 1 82016 1.21927E-5 41008 0 NA
22-21334312-C-CGACGAGGTGATG p.Val555_Ile556insMetAspGluVal disruptive_inframe_insertion AIFM3 1 82000 1.21951E-5 41000 0 NA
22-21334313-G-C p.Asp553His missense AIFM3 1 82048 1.2188E-5 41024 0 8.10143E-6
22-21334316-G-C p.Glu554Gln missense AIFM3 1 82080 1.21832E-5 41040 0 NA
22-21334324-C-T p.Ile556Ile synonymous AIFM3 1 82140 1.21743E-5 41070 0 NA
22-21334325-G-C p.Ala557Pro missense AIFM3 2 82138 2.43493E-5 41069 0 4.04282E-6
22-21334327-C-T p.Ala557Ala synonymous AIFM3 1 82170 1.21699E-5 41085 0 2.61502E-5
22-21334327-C-G p.Ala557Ala synonymous AIFM3 2 82168 2.43404E-5 41084 0 3.48669E-5
22-21334341-A-T p.Asn562Ile missense AIFM3 3 82418 3.63998E-5 41209 0 1.27389E-4
22-21334367-G-T p.Ala571Ser missense AIFM3 1 82402 1.21356E-5 41201 0 4.03708E-6
22-21334368-C-T p.Ala571Val missense AIFM3 1 82430 1.21315E-5 41215 0 NA
22-21334389-G-A p.Arg578His missense AIFM3 35 82292 4.25315E-4 41146 0 6.68662E-4
22-21334414-G-GACTGGCGACATGTCCTGGCTTACGGGGAAAGGATCC c.1757+1_1757+2insACTGGCGACATGTCCTGGCTTACGGGGAAAGGATCC splice_donor AIFM3 1 81636 1.22495E-5 40818 0 NA
22-21334414-G-GAC c.1757+1_1757+2insAC splice_donor AIFM3 1 81636 1.22495E-5 40818 0 NA
22-21334417-A-G c.1757+4A>G splice_region AIFM3 2 81474 2.45477E-5 40737 0 NA
22-21335030-G-A c.1758-6G>A splice_region AIFM3 1 82540 1.21153E-5 41270 0 3.18776E-5
22-21335036-G-T p.Glu586Asp missense+splice_region AIFM3 1 82574 1.21103E-5 41287 0 3.18735E-5
22-21335041-T-C p.Phe588Ser missense AIFM3 2 82576 2.42201E-5 41288 0 6.37552E-5
22-21335048-G-T p.Leu590Leu synonymous AIFM3 2 82590 2.4216E-5 41295 0 9.56267E-5
22-21335053-G-A p.Ser592Asn missense AIFM3 1 82598 1.21068E-5 41299 0 NA
22-21335057-G-T c.1778+1G>T splice_donor AIFM3 1 82608 1.21054E-5 41304 0 NA
22-21335061-G-A c.1778+5G>A splice_region AIFM3 4 82612 4.84191E-5 41306 0 6.25E-4
22-21335286-G-A p.Gly588Asp missense AIFM3 1 83088 1.20354E-5 41544 0 3.97861E-6
22-21335288-G-A p.Asp589Asn missense AIFM3 1 83096 1.20343E-5 41548 0 1.6539E-5
22-21335304-C-T p.Thr594Met missense AIFM3 3 83094 3.61037E-5 41547 0 3.31439E-5
22-21335305-G-A p.Thr594Thr synonymous AIFM3 4 83098 4.81359E-5 41549 0 1.27429E-4
22-21335307-G-A p.Gly595Glu missense AIFM3 1 83096 1.20343E-5 41548 0 3.1835E-5
22-21335312-G-T p.Gly597* stop_gained AIFM3 1 83086 1.20357E-5 41543 0 NA