Variant

Variant ID Consequence Effect Gene AC AN AF NS NHOM maxEAF
X-129263541-A-G p.His611His synonymous AIFM1 233 82848 0.00281238 41424 62 0.0044915
X-129263547-G-A p.Asn609Asn synonymous AIFM1 4 82856 4.82765E-5 41428 1 NA
X-129263592-G-A p.Asp594Asp synonymous AIFM1 3 82312 3.64467E-5 41156 1 4.5977E-5
X-129263938-C-A c.1770+7G>T splice_region AIFM1 1 81734 1.22348E-5 40867 0 1.14078E-5
X-129263990-C-T p.Gly575Gly synonymous AIFM1 1 82962 1.20537E-5 41481 0 NA
X-129263995-C-T p.Val574Met missense AIFM1 2 82982 2.41016E-5 41491 1 NA
X-129264008-C-T p.Arg569Arg synonymous AIFM1 1 83032 1.20435E-5 41516 0 1.13955E-5
X-129264022-T-C p.Ile565Val missense AIFM1 1 83074 1.20375E-5 41537 0 5.45013E-6
X-129264035-G-A p.Tyr560Tyr synonymous AIFM1 2 83034 2.40865E-5 41517 0 3.41845E-5
X-129264052-C-T p.Val555Ile missense AIFM1 2 83036 2.40859E-5 41518 1 2.27918E-5
X-129264071-C-T p.Pro548Pro synonymous AIFM1 25 82984 3.01263E-4 41492 8 2.28666E-4
X-129264072-G-A p.Pro548Leu missense AIFM1 3 82958 3.61629E-5 41479 1 4.57854E-5
X-129264082-G-A p.Pro545Ser missense AIFM1 2 82898 2.4126E-5 41449 1 5.69885E-5
X-129264084-G-A p.Pro544Leu missense AIFM1 1 82884 1.20651E-5 41442 0 5.45152E-6
X-129264088-T-C p.Ile543Val missense AIFM1 1 82852 1.20697E-5 41426 0 0.00137646
X-129264099-G-A p.Ser539Leu missense AIFM1 2 82730 2.4175E-5 41365 0 NA
X-129264106-C-T p.Glu537Lys missense AIFM1 8 82684 9.67539E-5 41342 1 1.30879E-4
X-129264113-T-G p.Thr534Thr synonymous AIFM1 2 82636 2.42025E-5 41318 1 NA
X-129264121-T-C p.Ser532Gly missense AIFM1 2 82548 2.42283E-5 41274 1 NA
X-129264133-T-C p.Ile528Val missense AIFM1 2 82434 2.42618E-5 41217 1 NA
X-129265661-G-A p.Thr521Ile missense AIFM1 2 81118 2.46554E-5 40559 1 NA
X-129265680-C-T p.Asp515Asn missense AIFM1 35 81358 4.30197E-4 40679 8 4.99977E-4
X-129265689-T-C p.Thr512Ala missense AIFM1 1 81436 1.22796E-5 40718 0 4.56329E-5
X-129265717-C-A p.Leu502Phe missense AIFM1 2 81624 2.45026E-5 40812 1 NA
X-129265740-T-C p.Ile495Val missense AIFM1 2 81680 2.44858E-5 40840 0 NA
X-129265759-G-A p.Pro488Pro synonymous AIFM1 8 81584 9.80584E-5 40792 3 3.41892E-5
X-129265765-C-T p.Leu486Leu synonymous AIFM1 2 81610 2.45068E-5 40805 0 4.33118E-4
X-129265776-TAAG-T c.1449-5_1449-3delCTT splice_region AIFM1 5 81404 6.1422E-5 40702 2 9.16045E-5
X-129267280-A-G c.1448+8T>C splice_region AIFM1 6 81858 7.32977E-5 40929 1 3.41908E-5
X-129267311-C-T p.Pro475Pro synonymous AIFM1 4 82640 4.84027E-5 41320 0 4.70788E-5
X-129267311-C-A p.Pro475Pro synonymous AIFM1 2 82640 2.42014E-5 41320 1 NA
X-129267320-A-G p.Ala472Ala synonymous AIFM1 122 82796 0.0014735 41398 34 0.00155462
X-129267348-C-A p.Arg463Ile missense AIFM1 21 83042 2.52884E-4 41521 7 2.36911E-4
X-129267365-G-A p.His457His synonymous AIFM1 3 83092 3.61046E-5 41546 1 1.0901E-5
X-129267402-A-G p.Ile445Thr missense AIFM1 7 83054 8.42825E-5 41527 3 9.63855E-5
X-129267407-G-A p.Tyr443Tyr synonymous AIFM1 99 82998 0.0011928 41499 24 0.001875
X-129270035-G-C p.Arg430Arg synonymous AIFM1 2 82992 2.40987E-5 41496 1 NA
X-129270037-G-A p.Arg430Cys missense AIFM1 1 82998 1.20485E-5 41499 0 4.57938E-5
X-129270093-C-G p.Gly411Ala missense AIFM1 2 83004 2.40952E-5 41502 1 5.44971E-6
X-129270098-A-C p.Thr409Thr synonymous AIFM1 62 83020 7.46808E-4 41510 12 0.00146252
X-129270161-C-CTTCCTGCCGTCTTTCAGCT c.1165-2_1165-1insAGCTGAAAGACGGCAGGAA splice_acceptor AIFM1 1 81898 1.22103E-5 40949 0 NA
X-129270625-C-T p.Gly386Asp missense AIFM1 4 82562 4.84484E-5 41281 0 NA
X-129270626-C-T p.Gly386Ser missense AIFM1 6 82556 7.26779E-5 41278 2 3.43371E-5
X-129270655-C-G p.Ser376Thr missense AIFM1 1 82460 1.21271E-5 41230 0 NA
X-129270669-G-A p.Ser371Ser synonymous AIFM1 2 82180 2.43368E-5 41090 1 6.25E-4
X-129270685-T-C p.Asn366Ser missense AIFM1 1 81706 1.2239E-5 40853 0 3.82445E-5
X-129270701-C-T p.Val361Ile missense AIFM1 2 80768 2.47623E-5 40384 1 NA
X-129270708-T-TCGTCTGACTTTTTCCATGGTCCAGTTGCTGAG c.1076-3_1076-2insCTCAGCAACTGGACCATGGAAAAAGTCAGACG splice_region AIFM1 2 80224 2.49302E-5 40112 1 NA
X-129270708-T-TCGTCTGACTTTTTCCATGGTCCAGTTGCTGAGGTATTCGG c.1076-3_1076-2insCCGAATACCTCAGCAACTGGACCATGGAAAAAGTCAGACG splice_region AIFM1 1 80222 1.24654E-5 40111 0 NA
X-129270708-T-TCGTCTGACTTTTTCCATGGTCCAGTTGCTGAGGTATTCGGG c.1076-3_1076-2insCCCGAATACCTCAGCAACTGGACCATGGAAAAAGTCAGACG splice_region AIFM1 3 80224 3.73953E-5 40112 1 NA
X-129271049-C-G c.1075+4G>C splice_region AIFM1 3 81656 3.67395E-5 40828 1 4.57624E-5
X-129271055-C-T p.Arg358Gln missense+splice_region AIFM1 2 81892 2.44224E-5 40946 1 2.18401E-5
X-129271071-T-C p.Met1? start_lost AIFM1 1 82296 1.21513E-5 41148 0 1.13998E-5
X-129271081-G-A p.Ser349Ser synonymous AIFM1 17 82510 2.06036E-4 41255 8 2.27625E-4
X-129271092-C-T p.Glu346Lys missense AIFM1 1 82612 1.21048E-5 41306 0 4.90795E-5
X-129271093-G-A c.-22C>T 5_prime_UTR_premature_start_codon_gain AIFM1 2 82636 2.42025E-5 41318 1 1.13985E-5
X-129271098-G-A p.Leu344Phe missense AIFM1 3 82694 3.62783E-5 41347 1 2.05173E-4
X-129271101-T-A p.Ile343Phe missense AIFM1 1 82716 1.20896E-5 41358 0 NA
X-129271102-C-T p.Lys342Lys synonymous AIFM1 3 82720 3.62669E-5 41360 1 1.13987E-5
X-129271109-A-G p.Met1? start_lost AIFM1 3 82782 3.62398E-5 41391 1 NA
X-129271120-C-T p.Glu336Glu synonymous AIFM1 1 82812 1.20755E-5 41406 0 NA
X-129271123-G-A c.-52C>T 5_prime_UTR_premature_start_codon_gain AIFM1 2 82792 2.41569E-5 41396 1 1.63663E-5
X-129271128-A-C p.Phe334Val missense AIFM1 1 82822 1.20741E-5 41411 0 NA
X-129271132-T-C p.Gln332Gln synonymous AIFM1 1188 82780 0.0143513 41390 279 0.0252978
X-129271144-T-G p.Thr328Thr synonymous AIFM1 2 82720 2.41779E-5 41360 1 NA
X-129271146-T-A p.Thr328Ser missense AIFM1 2 82708 2.41815E-5 41354 1 NA
X-129271155-C-T p.Ala325Thr missense AIFM1 1 82606 1.21057E-5 41303 0 NA
X-129271168-G-A c.968-8C>T splice_region AIFM1 1 82314 1.21486E-5 41157 0 NA
X-129271198-A-G c.-127T>C 5_prime_UTR_premature_start_codon_gain AIFM1 2 81168 2.46403E-5 40584 1 NA
X-129271284-G-A c.-213C>T 5_prime_UTR_premature_start_codon_gain AIFM1 1 76068 1.31461E-5 38034 0 NA
X-129271284-G-C c.-213C>G 5_prime_UTR_premature_start_codon_gain AIFM1 1 76068 1.31461E-5 38034 0 NA
X-129271299-G-A c.-228C>T 5_prime_UTR_premature_start_codon_gain AIFM1 2 76524 2.61356E-5 38262 0 NA
X-129271300-G-A c.*193C>T splice_region AIFM1 2 76538 2.61308E-5 38269 1 NA
X-129271321-G-A c.-250C>T 5_prime_UTR_premature_start_codon_gain AIFM1 34 76850 4.4242E-4 38425 5 0.00571771
X-129271385-T-A c.-314A>T 5_prime_UTR_premature_start_codon_gain AIFM1 9 80900 1.11248E-4 40450 2 2.27946E-4
X-129271489-G-C c.-418C>G 5_prime_UTR_premature_start_codon_gain AIFM1 2 81248 2.4616E-5 40624 1 NA
X-129271500-T-C p.Asp323Gly missense+splice_region AIFM1 2 81034 2.4681E-5 40517 1 NA
X-129271509-G-C c.-438C>G 5_prime_UTR_premature_start_codon_gain AIFM1 12 80826 1.48467E-4 40413 4 2.19732E-4
X-129271679-C-T c.-608G>A 5_prime_UTR_premature_start_codon_gain AIFM1 1 66082 1.51327E-5 33041 0 NA
X-129271700-T-C c.-629A>G 5_prime_UTR_premature_start_codon_gain AIFM1 36 61932 5.81283E-4 30966 2 0.00133456
X-129271804-G-A c.-733C>T 5_prime_UTR_premature_start_codon_gain AIFM1 2 30162 6.63086E-5 15081 0 1.86846E-4
X-129271986-G-A c.-915C>T 5_prime_UTR_premature_start_codon_gain AIFM1 1 4076 2.45339E-4 2038 0 NA
X-129272583-C-T p.Ala318Thr missense AIFM1 2 82336 2.42907E-5 41168 1 3.42509E-5
X-129272587-G-T p.Ala316Ala synonymous AIFM1 55 82458 6.67006E-4 41229 10 0.00119535
X-129272596-G-A p.Ser313Ser synonymous AIFM1 1 82578 1.21098E-5 41289 0 5.70652E-5
X-129272617-G-A p.Ile306Ile synonymous AIFM1 1334 82728 0.0161251 41364 312 0.0272156
X-129272624-G-A p.Thr304Met missense AIFM1 5 82778 6.04025E-5 41389 2 1.14071E-5
X-129272675-A-ATCTT p.Ile287fs frameshift AIFM1 2 82220 2.4325E-5 41110 0 NA
X-129272678-T-TTTCTGAAAAGCGTTGTTCTACTCTTCACCTCTGCTCCAGCCCTATCAATG c.859-3_859-2insCATTGATAGGGCTGGAGCAGAGGTGAAGAGTAGAACAACGCTTTTCAGAA splice_region AIFM1 2 82128 2.43522E-5 41064 1 NA
X-129272678-T-TTTCTGAAAAGCGTTGTTCTACTCTTCACCTCTGCTCCA c.859-3_859-2insTGGAGCAGAGGTGAAGAGTAGAACAACGCTTTTCAGAA splice_region AIFM1 1 82130 1.21758E-5 41065 0 NA
X-129273782-C-T p.Thr282Thr synonymous AIFM1 2 82834 2.41447E-5 41417 1 1.14209E-5
X-129273783-G-A p.Thr282Met missense AIFM1 1 82852 1.20697E-5 41426 0 2.18472E-5
X-129273797-C-T p.Val277Val synonymous AIFM1 2 82886 2.41295E-5 41443 0 NA
X-129273820-T-C p.Ile270Val missense AIFM1 2 82738 2.41727E-5 41369 1 NA
X-129273840-G-A p.Thr263Ile missense AIFM1 1 82510 1.21197E-5 41255 0 1.14481E-5
X-129274512-T-G p.Ala259Ala synonymous AIFM1 1 82726 1.20881E-5 41363 0 NA
X-129274553-T-G p.Asn246His missense AIFM1 2 82888 2.41289E-5 41444 0 NA
X-129274579-T-G p.Asp237Ala missense AIFM1 1 82698 1.20922E-5 41349 0 NA
X-129279448-G-A c.696+6C>T splice_region AIFM1 1 82310 1.21492E-5 41155 0 NA
X-129279462-C-T p.Gly230Arg missense AIFM1 1 82554 1.21133E-5 41277 0 NA
X-129279491-A-G p.Ile220Thr missense AIFM1 1 82722 1.20887E-5 41361 0 1.14321E-5
X-129279545-C-T c.606-1G>A splice_acceptor AIFM1 1 82272 1.21548E-5 41136 0 NA
X-129281471-C-T p.Arg201Lys missense AIFM1 2 82884 2.41301E-5 41442 1 NA
X-129281476-T-G p.Lys199Asn missense AIFM1 8 82954 9.6439E-5 41477 2 9.0843E-5
X-129281476-T-C p.Lys199Lys synonymous AIFM1 6 82954 7.23292E-5 41477 2 2.72576E-4
X-129281498-C-T p.Arg192Gln missense AIFM1 1 83118 1.20311E-5 41559 0 2.27907E-5
X-129281517-T-C p.Asn186Asp missense AIFM1 1 83166 1.20241E-5 41583 0 3.81494E-5
X-129281566-C-T p.Pro169Pro synonymous AIFM1 2 83112 2.40639E-5 41556 0 2.27907E-5
X-129281590-A-G p.Ile161Ile synonymous AIFM1 2 83088 2.40709E-5 41544 1 NA
X-129281595-GTACCTTCAGACATAAAAATCATGACGCTTATCAGAGCCAAGTCATTTAAGGGGCAAATGTCAAAGCATTCACATTAGCTAAATGCTTGCAGACTGTACCCTCTGTGCCAAGCAAAAAAACATGCACCT-G p.Val159_Leu160del splice_acceptor AIFM1 3 83050 3.61228E-5 41525 1 NA
X-129281596-T-G p.Val159Val splice_region+synonymous AIFM1 2 83060 2.4079E-5 41530 1 5.4509E-6
X-129281604-G-C c.475-6C>G splice_region AIFM1 1 83050 1.20409E-5 41525 0 5.45134E-6
X-129281606-C-T c.475-8G>A splice_region AIFM1 3 83044 3.61254E-5 41522 1 1.63542E-5
X-129281719-C-T c.474+8G>A splice_region AIFM1 1 82990 1.20496E-5 41495 0 1.63584E-5
X-129281730-G-A p.Ala157Ala synonymous AIFM1 1 82996 1.20488E-5 41498 0 NA
X-129281817-C-T p.Ala128Ala synonymous AIFM1 2 81110 2.46579E-5 40555 0 6.25E-4
X-129281818-G-A p.Ala128Val missense AIFM1 1 80992 1.23469E-5 40496 0 9.13451E-5
X-129281835-T-C p.Glu122Glu synonymous AIFM1 26 79408 3.27423E-4 39704 4 1.26295E-4
X-129283436-A-C c.349+8T>G splice_region AIFM1 1 82464 1.21265E-5 41232 0 4.56059E-5
X-129283451-C-T p.Ala114Ala synonymous AIFM1 2 82710 2.41809E-5 41355 0 9.15332E-5
X-129283451-C-A p.Ala114Ala synonymous AIFM1 2 82710 2.41809E-5 41355 0 NA
X-129283452-G-A p.Ala114Val missense AIFM1 13 82716 1.57164E-4 41358 4 1.83419E-4
X-129283453-C-T p.Ala114Thr missense AIFM1 11 82734 1.32956E-4 41367 3 6.87758E-4
X-129283454-G-A p.Ala113Ala synonymous AIFM1 5 82756 6.04186E-5 41378 2 0.00125
X-129283465-G-T p.Gln110Lys missense AIFM1 2 82854 2.41388E-5 41427 1 6.25E-4
X-129283483-G-A p.Leu104Leu synonymous AIFM1 3 82930 3.61751E-5 41465 1 4.54752E-5
X-129283492-C-T p.Gly101Arg missense AIFM1 1 82940 1.20569E-5 41470 0 NA
X-129283506-T-C p.Asn96Ser missense AIFM1 3 82898 3.61891E-5 41449 0 1.25368E-4
X-129283519-CA-TG p.Ter44Glnext*? stop_lost AIFM1 34 82736 4.10946E-4 41368 11 NA
X-129283519-C-T p.Glu92Lys missense AIFM1 40 82734 4.83477E-4 41367 7 0.0014689
X-129283520-A-G p.Ter44Argext*? stop_lost AIFM1 37390 81992 0.45602 40996 13871 0.645816
X-129283531-T-C p.Met1? start_lost AIFM1 4 82446 4.85166E-5 41223 0 2.85186E-4
X-129289123-C-T c.237+8G>A splice_region AIFM1 3 83136 3.60855E-5 41568 1 2.18018E-5
X-129289150-G-C p.Thr73Ser missense AIFM1 2 83198 2.4039E-5 41599 1 NA
X-129289155-T-C p.Thr71Thr synonymous AIFM1 2 83204 2.40373E-5 41602 0 NA
X-129289180-A-C p.Val63Gly missense AIFM1 1 83178 1.20224E-5 41589 0 1.13952E-5
X-129289188-G-A p.Ser60Ser synonymous AIFM1 1 83174 1.2023E-5 41587 0 NA
X-129289196-C-A p.Asp58Tyr missense AIFM1 2 83174 2.4046E-5 41587 1 1.13952E-5
X-129289210-C-G p.Gly53Ala missense AIFM1 7 83170 8.4165E-5 41585 2 NA
X-129289231-G-A p.Ser46Phe missense AIFM1 1 83128 1.20296E-5 41564 0 NA
X-129289234-G-T p.Pro45His missense AIFM1 1 83122 1.20305E-5 41561 0 NA
X-129289249-T-A p.His40Leu missense AIFM1 1 83078 1.20369E-5 41539 0 NA
X-129290462-G-A p.Gly74Gly synonymous AIFM1 3 83170 3.60707E-5 41585 1 NA
X-129290464-C-T p.Gly74Ser missense AIFM1 1 83168 1.20239E-5 41584 0 NA
X-129290478-A-G p.Leu69Ser missense AIFM1 1 83214 1.20172E-5 41607 0 NA
X-129290479-A-C p.Leu69Val missense AIFM1 3 83212 3.60525E-5 41606 1 2.27879E-5
X-129290491-C-G p.Asp65His missense AIFM1 2 83212 2.4035E-5 41606 0 NA
X-129290497-T-C p.Lys63Glu missense AIFM1 2 83224 2.40315E-5 41612 0 4.55539E-5
X-129290514-G-C p.Ser57Cys missense AIFM1 8 83218 9.61331E-5 41609 0 1.36519E-4
X-129290537-C-G p.Gln49His missense AIFM1 4 83204 4.80746E-5 41602 2 NA
X-129290543-T-G p.Glu47Asp missense AIFM1 4 83200 4.80769E-5 41600 1 3.41845E-5
X-129290550-G-C p.Pro45Arg missense AIFM1 3 83184 3.60646E-5 41592 1 3.41853E-5
X-129290579-T-TGGGAGCCGGTTCCTCTGCCTCGGGCTTCGGACGCACACGGTCCGCACC c.107-3_107-2insGGTGCGGACCGTGTGCGTCCGAAGCCCGAGGCAGAGGAACCGGCTCCC splice_region AIFM1 2 83072 2.40755E-5 41536 1 NA
X-129290580-AAGAAAC-A c.107-9_107-4delGTTTCT splice_region AIFM1 1 83050 1.20409E-5 41525 0 NA
X-129299528-G-A p.Pro35Ser missense AIFM1 178 79566 0.00223714 39783 41 0.00479364
X-129299528-G-C p.Pro35Ala missense AIFM1 2 79572 2.51345E-5 39786 1 NA
X-129299556-G-A p.Val25Val synonymous AIFM1 1 80076 1.24881E-5 40038 0 6.74263E-5
X-129299559-G-A p.Cys24Cys synonymous AIFM1 27 80056 3.37264E-4 40028 7 6.20064E-4
X-129299568-C-T p.Arg21Arg synonymous AIFM1 3 80262 3.73776E-5 40131 1 3.76452E-5
X-129299577-G-C p.Pro18Pro synonymous AIFM1 39 80502 4.8446E-4 40251 8 6.88705E-4
X-129299612-G-A c.-100C>T 5_prime_UTR_premature_start_codon_gain AIFM1 1 80948 1.23536E-5 40474 0 4.57247E-5
X-129299613-G-A p.Gly6Gly synonymous AIFM1 1 80906 1.236E-5 40453 0 NA
X-129299623-C-T p.Arg3Gln missense AIFM1 3 80922 3.70727E-5 40461 1 3.15378E-5
X-129299731-C-G c.-101G>C 5_prime_UTR_premature_start_codon_gain AIFM1 1 71484 1.39891E-5 35742 0 NA
X-129299737-C-T c.-107G>A 5_prime_UTR_premature_start_codon_gain AIFM1 1 70828 1.41187E-5 35414 0 NA
X-129299758-C-A c.-128G>T 5_prime_UTR_premature_start_codon_gain AIFM1 2 66238 3.01941E-5 33119 0 NA
X-129299803-G-A c.-173C>T 5_prime_UTR_premature_start_codon_gain AIFM1 4 56288 7.10631E-5 28144 0 6.81199E-4
X-129299819-G-A c.-189C>T 5_prime_UTR_premature_start_codon_gain AIFM1 1 51670 1.93536E-5 25835 0 NA