Variant

Variant ID Consequence Effect Gene AC AN AF NS NHOM maxEAF
2-61404587-C-T c.-1224C>T 5_prime_UTR_premature_start_codon_gain AHSA2 2 42906 4.66135E-5 21453 0 3.23018E-5
2-61404599-C-T c.-1212C>T 5_prime_UTR_premature_start_codon_gain AHSA2 2 43380 4.61042E-5 21690 0 NA
2-61404621-C-T c.-1190C>T 5_prime_UTR_premature_start_codon_gain AHSA2 1 44196 2.26265E-5 22098 0 NA
2-61404667-C-T c.-1144C>T 5_prime_UTR_premature_start_codon_gain AHSA2 1 45784 2.18417E-5 22892 0 NA
2-61404710-G-C c.-1101G>C 5_prime_UTR_premature_start_codon_gain AHSA2 1 47082 2.12395E-5 23541 0 3.5529E-5
2-61404727-C-T c.-1084C>T 5_prime_UTR_premature_start_codon_gain AHSA2 2 46772 4.27606E-5 23386 0 NA
2-61404755-C-A n.147+2C>A splice_donor AHSA2 2 46214 4.32769E-5 23107 0 4.47708E-5
2-61404755-C-T n.147+2C>T splice_donor AHSA2 1 46214 2.16385E-5 23107 0 2.68817E-4
2-61404756-G-A n.147+3G>A splice_region AHSA2 5 46274 1.08052E-4 23137 0 NA
2-61404759-G-T n.147+6G>T splice_region AHSA2 1 46128 2.16788E-5 23064 0 NA
2-61404762-G-T c.-1049G>T 5_prime_UTR_premature_start_codon_gain AHSA2 19 46072 4.12398E-4 23036 0 5.95593E-4
2-61404778-C-T c.-1033C>T 5_prime_UTR_premature_start_codon_gain AHSA2 1 45532 2.19626E-5 22766 0 NA
2-61404784-C-T c.-1027C>T 5_prime_UTR_premature_start_codon_gain AHSA2 18 45480 3.95778E-4 22740 0 8.81834E-4
2-61404803-G-T c.-1008G>T 5_prime_UTR_premature_start_codon_gain AHSA2 2 44740 4.47027E-5 22370 0 NA
2-61404809-C-T c.-1002C>T 5_prime_UTR_premature_start_codon_gain AHSA2 11 44230 2.487E-4 22115 0 0.00197889
2-61404832-G-T c.-979G>T 5_prime_UTR_premature_start_codon_gain AHSA2 2 41656 4.80123E-5 20828 0 1.59795E-4
2-61404874-C-T c.-937C>T 5_prime_UTR_premature_start_codon_gain AHSA2 78 39742 0.00196266 19871 0 0.0026455
2-61404905-C-G c.-906C>G 5_prime_UTR_premature_start_codon_gain AHSA2 8878 33762 0.262958 16881 272 0.331361
2-61405062-C-T c.-749C>T 5_prime_UTR_premature_start_codon_gain AHSA2 1 5416 1.84638E-4 2708 0 3.18613E-5
2-61405225-C-G c.-586C>G 5_prime_UTR_premature_start_codon_gain AHSA2 1 3008 3.32447E-4 1504 0 0.00264432
2-61405260-C-T c.-551C>T 5_prime_UTR_premature_start_codon_gain AHSA2 2 2888 6.92521E-4 1444 0 NA
2-61405289-A-T c.-522A>T 5_prime_UTR_premature_start_codon_gain AHSA2 1 2884 3.46741E-4 1442 0 NA
2-61405586-G-A c.-821G>A 5_prime_UTR_premature_start_codon_gain AHSA2 2 2968 6.73854E-4 1484 0 7.00905E-4
2-61405778-T-G c.-629T>G 5_prime_UTR_premature_start_codon_gain AHSA2 1 6374 1.56887E-4 3187 0 3.1841E-5
2-61405882-G-T c.-525G>T 5_prime_UTR_premature_start_codon_gain AHSA2 1 25436 3.93144E-5 12718 0 NA
2-61405960-A-G c.-447A>G 5_prime_UTR_premature_start_codon_gain AHSA2 1 49368 2.0256E-5 24684 0 NA
2-61405996-G-T c.-411G>T 5_prime_UTR_premature_start_codon_gain AHSA2 2 52008 3.84556E-5 26004 0 NA
2-61406030-C-A c.-377C>A 5_prime_UTR_premature_start_codon_gain AHSA2 1 52940 1.88893E-5 26470 0 NA
2-61406046-C-T c.-361C>T 5_prime_UTR_premature_start_codon_gain AHSA2 7 53154 1.31693E-4 26577 0 NA
2-61406047-G-A c.-360G>A 5_prime_UTR_premature_start_codon_gain AHSA2 1 53164 1.88097E-5 26582 0 NA
2-61406070-G-T c.-337G>T 5_prime_UTR_premature_start_codon_gain AHSA2 2 53698 3.72453E-5 26849 0 7.52989E-6
2-61406079-C-T c.-328C>T 5_prime_UTR_premature_start_codon_gain AHSA2 1 53928 1.85432E-5 26964 0 6.61172E-5
2-61406176-C-T c.-231C>T 5_prime_UTR_premature_start_codon_gain AHSA2 11 55338 1.98778E-4 27669 0 1.2128E-4
2-61406212-C-T c.-195C>T 5_prime_UTR_premature_start_codon_gain AHSA2 4 55354 7.22622E-5 27677 0 7.73118E-4
2-61406220-A-T c.-187A>T 5_prime_UTR_premature_start_codon_gain AHSA2 1 55350 1.80668E-5 27675 0 7.15994E-6
2-61406242-G-T c.-165G>T 5_prime_UTR_premature_start_codon_gain AHSA2 1 55332 1.80727E-5 27666 0 7.16445E-6
2-61406252-C-T c.-155C>T 5_prime_UTR_premature_start_codon_gain AHSA2 5 55366 9.03081E-5 27683 0 4.29787E-5
2-61406294-C-A c.-113C>A 5_prime_UTR_premature_start_codon_gain AHSA2 1 55318 1.80773E-5 27659 0 NA
2-61406309-A-T c.-101+3A>T splice_region AHSA2 1 55244 1.81015E-5 27622 0 3.60933E-5
2-61406311-CAG-C c.-101+6_-101+7delAG splice_region AHSA2 2 55230 3.62122E-5 27615 0 2.17347E-5
2-61408446-TCATTTTAGG-T c.-100-8_-100delCATTTTAGG splice_acceptor AHSA2 9 78486 1.1467E-4 39243 0 0.00179326
2-61408460-G-C n.453G>C splice_region AHSA2 2 79156 2.52666E-5 39578 0 3.18471E-5
2-61408460-G-A n.453G>A splice_region AHSA2 1 79156 1.26333E-5 39578 0 NA
2-61408494-T-C c.-61T>C 5_prime_UTR_premature_start_codon_gain AHSA2 1 79854 1.25229E-5 39927 0 6.3325E-5
2-61408530-A-T c.-25A>T 5_prime_UTR_premature_start_codon_gain AHSA2 1 80080 1.24875E-5 40040 0 7.03888E-6
2-61408542-T-TCA c.-15+2_-15+3insCA splice_region AHSA2 1 80024 1.24963E-5 40012 0 NA
2-61410678-G-A n.56-4G>A splice_region AHSA2 1 76446 1.30811E-5 38223 0 NA
2-61410682-G-T n.56G>T splice_region AHSA2 1 76668 1.30433E-5 38334 0 NA
2-61410683-T-C n.57T>C splice_region AHSA2 3 76708 3.91093E-5 38354 0 9.68992E-5
2-61410795-C-T n.169C>T splice_region AHSA2 2 77312 2.58692E-5 38656 0 9.55353E-5
2-61410796-G-GGAATTTACAAC n.171_171+1insAATTTACAACG splice_donor AHSA2 1 77256 1.2944E-5 38628 0 NA
2-61410800-A-C n.171+3A>C splice_region AHSA2 2 77220 2.59E-5 38610 0 1.75202E-5
2-61410800-A-G n.171+3A>G splice_region AHSA2 1 77220 1.295E-5 38610 0 3.18471E-5
2-61410802-A-G n.171+5A>G splice_region AHSA2 7 77226 9.06431E-5 38613 0 6.25E-4
2-61410804-A-G n.171+7A>G splice_region AHSA2 1 77192 1.29547E-5 38596 0 NA
2-61411839-C-T c.-14-8C>T splice_region AHSA2 2 82408 2.42695E-5 41204 0 NA
2-61411842-T-TA c.-14-5_-14-4insA splice_region AHSA2 1 82498 1.21215E-5 41249 0 8.45437E-6
2-61411844-T-A c.-14-3T>A splice_region AHSA2 2 82472 2.42507E-5 41236 0 3.98264E-6
2-61411846-G-A c.-14-1G>A splice_acceptor AHSA2 1 82556 1.2113E-5 41278 0 NA
2-61411856-C-T c.-5C>T 5_prime_UTR_premature_start_codon_gain AHSA2 2 82714 2.41797E-5 41357 0 3.58198E-5
2-61411873-A-G p.Thr5Ala missense AHSA2 2 82860 2.41371E-5 41430 0 1.98883E-5
2-61411873-A-T p.Thr5Ser missense AHSA2 1 82860 1.20685E-5 41430 0 8.27664E-6
2-61411874-C-T p.Thr5Met missense AHSA2 1 82870 1.20671E-5 41435 0 8.27527E-6
2-61411875-G-A p.Thr5Thr synonymous AHSA2 83 82868 0.00100159 41434 2 0.00232469
2-61411876-A-G p.Lys6Glu missense AHSA2 2 82902 2.41249E-5 41451 0 8.26925E-6
2-61411877-A-C p.Lys6Thr missense AHSA2 1 82896 1.20633E-5 41448 0 NA
2-61411882-A-G p.Met8Val missense AHSA2 2 82858 2.41377E-5 41429 0 3.18431E-5
2-61411883-T-C p.Met8Thr missense AHSA2 1 82878 1.20659E-5 41439 0 1.98851E-5
2-61411886-C-T p.Ala9Val missense AHSA2 2 82920 2.41196E-5 41460 0 1.65213E-5
2-61411888-A-G p.Thr10Ala missense AHSA2 3 82906 3.61856E-5 41453 0 6.36862E-5
2-61411891-C-G p.Gln11Glu missense AHSA2 1 82914 1.20607E-5 41457 0 NA
2-61411901-C-T p.Thr14Ile missense AHSA2 1 82872 1.20668E-5 41436 0 NA
2-61411910-G-T p.Arg17Ile missense AHSA2 1 82836 1.2072E-5 41418 0 NA
2-61411919-G-A p.Ser20Asn missense AHSA2 1 82738 1.20863E-5 41369 0 NA
2-61411927-AC-A p.Leu24fs frameshift AHSA2 1 82594 1.21074E-5 41297 0 2.31773E-4
2-61411935-G-A p.Gln25Gln splice_region+synonymous AHSA2 2 82562 2.42242E-5 41281 0 8.29215E-6
2-61411938-A-G c.75+3A>G splice_region AHSA2 2 82202 2.43303E-5 41101 0 3.18291E-5
2-61411942-G-T c.75+7G>T splice_region AHSA2 1 82386 1.2138E-5 41193 0 NA
2-61412634-C-G c.76-3C>G splice_region AHSA2 2 83022 2.409E-5 41511 0 8.24402E-6
2-61412635-A-G c.76-2A>G splice_acceptor AHSA2 4 83050 4.81638E-5 41525 0 1.9926E-5
2-61412638-TTCAGGCC-T p.Gln27fs frameshift AHSA2 2 83072 2.40755E-5 41536 0 3.98029E-6
2-61412645-C-T p.Ala28Ala synonymous AHSA2 8 83124 9.62418E-5 41562 2 6.25E-4
2-61412647-C-G p.Ser29* stop_gained AHSA2 1 83136 1.20285E-5 41568 0 1.64804E-5
2-61412649-T-G p.Ser30Ala missense AHSA2 18 83130 2.16528E-4 41565 0 0.00353179
2-61412650-C-T p.Ser30Phe missense AHSA2 1 83134 1.20288E-5 41567 0 8.23913E-6
2-61412651-T-A p.Ser30Ser synonymous AHSA2 1 83144 1.20273E-5 41572 0 3.97814E-6
2-61412660-A-G p.Ala33Ala synonymous AHSA2 1 83180 1.20221E-5 41590 0 6.36943E-5
2-61412661-C-A p.Leu34Met missense AHSA2 16 83180 1.92354E-4 41590 0 3.50318E-4
2-61412666-TG-T p.Val36fs frameshift AHSA2 8 83208 9.61446E-5 41604 0 1.91058E-4
2-61412667-G-T p.Val36Leu missense AHSA2 11 83216 1.32186E-4 41608 0 2.22902E-4
2-61412671-G-A p.Arg37Lys missense AHSA2 11 83210 1.32196E-4 41605 0 2.22859E-4
2-61412676-C-G p.Pro39Ala missense AHSA2 4 83216 4.80677E-5 41608 0 7.95418E-6
2-61412677-C-G p.Pro39Arg missense AHSA2 415 83202 0.00498786 41601 13 0.00764819
2-61412677-C-A p.Pro39His missense AHSA2 2 83214 2.40344E-5 41607 0 4.11848E-5
2-61412678-C-T p.Pro39Pro synonymous AHSA2 1 83220 1.20163E-5 41610 0 NA
2-61412702-A-C p.Glu47Asp missense AHSA2 1 83248 1.20123E-5 41624 0 3.1839E-5
2-61412708-T-G p.Phe49Leu missense AHSA2 1 83238 1.20137E-5 41619 0 3.97709E-6
2-61412712-A-G p.Thr51Ala missense AHSA2 1 83214 1.20172E-5 41607 0 NA
2-61412713-C-A p.Thr51Lys missense AHSA2 2 83216 2.40338E-5 41608 0 NA
2-61412716-C-T p.Thr52Ile missense AHSA2 2 83204 2.40373E-5 41602 0 3.18309E-5
2-61412721-G-A p.Glu54Lys missense AHSA2 1 83206 1.20184E-5 41603 0 6.25E-4
2-61412723-G-C p.Glu54Asp missense AHSA2 1 83184 1.20215E-5 41592 0 3.97795E-6
2-61412724-C-T p.Gln55* stop_gained AHSA2 1 83178 1.20224E-5 41589 0 1.59124E-5
2-61412729-G-T p.Leu56Leu synonymous AHSA2 1 83142 1.20276E-5 41571 0 NA
2-61412735-C-CATCTTCACTGTAA p.Lys63fs frameshift AHSA2 1 83092 1.20349E-5 41546 0 NA
2-61412738-C-T p.Ile59Ile synonymous AHSA2 1 83074 1.20375E-5 41537 0 NA
2-61412738-C-A p.Ile59Ile synonymous AHSA2 1 83074 1.20375E-5 41537 0 NA
2-61412744-T-C p.Thr61Thr synonymous AHSA2 1 83024 1.20447E-5 41512 0 1.64856E-5
2-61412751-G-A p.Glu64Lys missense+splice_region AHSA2 1 82932 1.20581E-5 41466 0 NA
2-61412752-AG-A c.192+1delG splice_donor AHSA2 1 82906 1.20619E-5 41453 0 6.36699E-5
2-61412753-G-A p.Glu64Glu splice_region+synonymous AHSA2 2 82882 2.41307E-5 41441 0 8.24565E-6
2-61412758-GTA-CTC c.192+5_192+7delGTAinsCTC splice_region AHSA2 4 82796 4.83115E-5 41398 0 NA
2-61412758-G-GT c.192+6dupT splice_region AHSA2 7 82796 8.45452E-5 41398 0 8.25069E-5
2-61412880-T-C n.504T>C splice_region AHSA2 3 72236 4.15305E-5 36118 0 3.1839E-5
2-61412974-G-A p.Glu65Lys missense+splice_region AHSA2 1 61798 1.61818E-5 30899 0 NA
2-61412975-AAG-A p.Arg67fs frameshift AHSA2 8 61630 1.29807E-4 30815 0 9.52915E-4
2-61412979-G-A p.Glu66Glu synonymous AHSA2 2 61266 3.26445E-5 30633 0 NA
2-61412980-A-G p.Arg67Gly missense AHSA2 14 61164 2.28893E-4 30582 0 3.82141E-4
2-61412985-TTG-T p.Val70fs frameshift AHSA2 2 60570 3.30196E-5 30285 0 2.64943E-5
2-61412987-GTGTTT-G p.Val70fs frameshift AHSA2 1 60300 1.65837E-5 30150 0 6.62655E-6
2-61413000-T-C p.Ser73Ser splice_region+synonymous AHSA2 1 58552 1.70788E-5 29276 0 6.26566E-4
2-61413214-T-C n.846T>C splice_region AHSA2 4 57374 6.9718E-5 28687 0 0.00125
2-61413217-G-T n.848+1G>T splice_donor AHSA2 1 57098 1.75137E-5 28549 0 3.18471E-5
2-61413221-G-C n.848+5G>C splice_region AHSA2 1 57042 1.75309E-5 28521 0 NA
2-61413568-CCT-C c.193-8_193-7delCT splice_region AHSA2 14 82712 1.69262E-4 41356 0 1.91205E-4
2-61413575-T-TTTCAGTTAA p.Leu65_Thr66insIleGlnLeu disruptive_inframe_insertion AHSA2 1 82838 1.20718E-5 41419 0 NA
2-61413587-A-G p.Asn67Asp missense AHSA2 1 83024 1.20447E-5 41512 0 8.26337E-6
2-61413589-TAAG-T p.Lys69del disruptive_inframe_deletion AHSA2 1802 83012 0.0217077 41506 32 0.0458669
2-61413589-T-G p.Asn67Lys missense AHSA2 1 83040 1.20424E-5 41520 0 2.39038E-5
2-61413594-AG-TC p.Lys69Ile missense AHSA2 2 83088 2.40709E-5 41544 0 NA
2-61413594-A-T p.Lys69Met missense AHSA2 1 83088 1.20354E-5 41544 0 6.37105E-5
2-61413597-T-C p.Ile70Thr missense AHSA2 1 83092 1.20349E-5 41546 0 3.98267E-6
2-61413609-G-C p.Trp74Ser missense AHSA2 1 83156 1.20256E-5 41578 0 NA
2-61413612-G-A p.Arg75Lys missense AHSA2 13 83164 1.56318E-4 41582 0 3.50229E-4
2-61413617-G-A p.Gly77Arg missense AHSA2 1 83174 1.2023E-5 41587 0 1.6491E-5
2-61413623-T-C p.Trp79Arg missense AHSA2 1 83164 1.20244E-5 41582 0 NA
2-61413627-C-T p.Pro80Leu missense AHSA2 1 83164 1.20244E-5 41582 0 3.18512E-5
2-61413630-AAGGTATGTTACTAATTACTGCCCTTCATATTAAAGGTCCCAAAACACTAAGGCTAGGTTTTTCGTATGGATAAATTTTCCTTTTCATAATGCAGTAATAAGGTTCCTATTTTTTTTCTT-A c.244+1_245-1del splice_acceptor AHSA2 4 83166 4.80966E-5 41583 0 NA
2-61413637-G-A c.244+5G>A splice_region AHSA2 1 83180 1.20221E-5 41590 0 NA
2-61413640-A-C c.244+8A>C splice_region AHSA2 2 83204 2.40373E-5 41602 0 5.58824E-5
2-61413738-A-AT c.245-6dupT splice_region AHSA2 4 83192 4.80815E-5 41596 0 3.99439E-5
2-61413747-C-T c.245-5C>T splice_region AHSA2 3 83214 3.60516E-5 41607 0 3.26755E-5
2-61413758-A-G p.Tyr84Cys missense AHSA2 4 83236 4.80561E-5 41618 0 1.66939E-5
2-61413759-T-C p.Tyr84Tyr synonymous AHSA2 2 83230 2.40298E-5 41615 0 4.17199E-6
2-61413761-C-A p.Ala85Asp missense AHSA2 8 83226 9.61238E-5 41613 0 6.37674E-5
2-61413764-T-C p.Met86Thr missense AHSA2 1 83224 1.20158E-5 41612 0 8.26624E-6
2-61413767-T-C p.Val87Ala missense AHSA2 2 83226 2.4031E-5 41613 0 6.37024E-5
2-61413772-C-T p.Leu89Leu synonymous AHSA2 2 83230 2.40298E-5 41615 0 2.47893E-5
2-61413778-T-C p.Phe91Leu missense AHSA2 4 83226 4.80619E-5 41613 0 2.54696E-4
2-61413786-T-C p.Pro93Pro synonymous AHSA2 6 83212 7.2105E-5 41606 0 3.50229E-4
2-61413790-C-T p.Leu95Leu synonymous AHSA2 1 83228 1.20152E-5 41614 0 8.262E-6
2-61413796-C-CAA p.Thr98fs frameshift AHSA2 1 83216 1.20169E-5 41608 0 8.4296E-5
2-61413800-CAG-C p.Glu99fs frameshift AHSA2 5 83204 6.00933E-5 41602 0 3.6128E-5
2-61413802-G-T p.Glu99* stop_gained AHSA2 25 83204 3.00466E-4 41602 0 1.91083E-4
2-61413815-A-G p.Lys103Arg missense AHSA2 1 83196 1.20198E-5 41598 0 NA
2-61413816-G-T p.Lys103Asn missense AHSA2 18 83194 2.16362E-4 41597 0 9.17219E-4
2-61413819-G-A p.Glu104Glu synonymous AHSA2 28 83184 3.36603E-4 41592 1 0.00181806
2-61413822-C-CCTAT p.Cys109fs frameshift AHSA2 275 83186 0.00330584 41593 1 0.00654582
2-61413822-CCTAT-C p.Ile108fs frameshift AHSA2 11 83190 1.32227E-4 41595 0 1.27478E-4
2-61413828-T-TATC p.Ile108dup conservative_inframe_insertion AHSA2 18 83184 2.16388E-4 41592 0 5.73248E-4
2-61413835-AAAG-A p.Glu112del disruptive_inframe_deletion AHSA2 12 83182 1.44262E-4 41591 0 1.40621E-4
2-61413841-G-A p.Glu112Lys missense AHSA2 1 83176 1.20227E-5 41588 0 NA
2-61413846-C-A p.Asn113Lys missense AHSA2 1 83130 1.20294E-5 41565 0 NA
2-61413846-C-G p.Asn113Lys missense AHSA2 3 83126 3.60898E-5 41563 0 NA
2-61413850-A-G p.Lys115Glu missense AHSA2 1 83122 1.20305E-5 41561 0 NA
2-61413855-C-T p.Phe116Phe synonymous AHSA2 1 83096 1.20343E-5 41548 0 NA
2-61413855-C-A p.Phe116Leu missense AHSA2 1 83096 1.20343E-5 41548 0 4.1364E-5
2-61413872-A-G p.His122Arg missense AHSA2 4 83114 4.81267E-5 41557 0 NA
2-61413895-C-T p.Leu130Leu synonymous AHSA2 1 83048 1.20412E-5 41524 0 NA
2-61413898-C-T p.Gln131* stop_gained AHSA2 29 83096 3.48994E-4 41548 0 1.59236E-4
2-61413899-A-C p.Gln131Pro missense AHSA2 15 83076 1.80558E-4 41538 0 0.00165584
2-61413904-A-AC p.Leu135fs frameshift AHSA2 2 82982 2.41016E-5 41491 0 6.3743E-5
2-61413904-AC-A p.Leu135fs frameshift AHSA2 2 82982 2.41016E-5 41491 0 8.82761E-6
2-61413905-C-A p.Thr133Asn missense AHSA2 1 82964 1.20534E-5 41482 0 1.75888E-5
2-61413907-C-T p.Pro134Ser missense AHSA2 9 82944 1.08507E-4 41472 0 0.00125786
2-61413915-T-C p.Asn136Asn synonymous AHSA2 2 82964 2.41068E-5 41482 0 5.2443E-5
2-61413920-G-A p.Ter138Ter stop_retained AHSA2 8 82832 9.6581E-5 41416 0 5.91622E-4
2-61413942-A-T n.1741A>T splice_region AHSA2 1 82528 1.21171E-5 41264 0 NA
2-61414680-A-AT c.*764dupT splice_region AHSA2 1 69008 1.44911E-5 34504 0 3.18492E-5