Variant

Variant ID Consequence Effect Gene AC AN AF NS NHOM maxEAF
1-27861427-G-GCCAGGAACAAAAC c.*44-1_*44insGTTTTGTTCCTGG splice_acceptor AHDC1 2 37062 5.39636E-5 18531 0 NA
1-27873830-G-A p.Thr1599Thr synonymous AHDC1 18 82440 2.18341E-4 41220 0 1.36991E-4
1-27873836-T-C p.Thr1597Thr synonymous AHDC1 1 82476 1.21247E-5 41238 0 9.12675E-6
1-27873844-C-T p.Glu1595Lys missense AHDC1 3 82470 3.63769E-5 41235 0 1.00966E-5
1-27873845-G-A p.Pro1594Pro synonymous AHDC1 481 82468 0.00583257 41234 2 0.005625
1-27873847-G-A p.Pro1594Ser missense AHDC1 2 82502 2.42418E-5 41251 0 1.82266E-5
1-27873848-G-C p.His1593Gln missense AHDC1 3 82482 3.63716E-5 41241 0 NA
1-27873852-G-C p.Pro1592Arg missense AHDC1 1 82518 1.21186E-5 41259 0 NA
1-27873866-C-A p.Gly1587Gly synonymous AHDC1 4 82364 4.85649E-5 41182 0 4.98365E-6
1-27873878-G-A p.Ser1583Ser synonymous AHDC1 3 82378 3.64175E-5 41189 0 1.82896E-5
1-27873895-C-T p.Gly1578Ser missense AHDC1 3 82184 3.65035E-5 41092 0 6.37105E-5
1-27873908-C-T p.Ala1573Ala synonymous AHDC1 1 82042 1.21889E-5 41021 0 9.0962E-6
1-27873908-C-A p.Ala1573Ala synonymous AHDC1 1 82042 1.21889E-5 41021 0 2.72886E-5
1-27873909-G-A p.Ala1573Val missense AHDC1 3 82008 3.65818E-5 41004 0 4.995E-5
1-27873916-G-A p.Pro1571Ser missense AHDC1 1 82004 1.21945E-5 41002 0 3.18613E-5
1-27873918-A-G p.Met1570Thr missense AHDC1 4 82032 4.87615E-5 41016 0 9.0411E-6
1-27873940-C-T p.Ala1563Thr missense AHDC1 5 81636 6.12475E-5 40818 0 5.03525E-4
1-27873941-G-A p.Thr1562Thr synonymous AHDC1 1 81676 1.22435E-5 40838 0 2.11324E-5
1-27873950-C-G p.Leu1559Leu synonymous AHDC1 1 81492 1.22711E-5 40746 0 NA
1-27873960-A-T p.Leu1556Gln missense AHDC1 1 81416 1.22826E-5 40708 0 NA
1-27873963-G-A p.Ser1555Leu missense AHDC1 4 81298 4.92017E-5 40649 0 6.37227E-5
1-27873969-C-T p.Arg1553Lys missense AHDC1 1 81188 1.23171E-5 40594 0 NA
1-27873972-G-A p.Pro1552Leu missense AHDC1 1 81006 1.23448E-5 40503 0 7.97166E-5
1-27873973-G-A p.Pro1552Ser missense AHDC1 1 80948 1.23536E-5 40474 0 4.11557E-6
1-27873976-C-A p.Val1551Leu missense AHDC1 4 80802 4.95037E-5 40401 0 5.30955E-5
1-27873976-C-T p.Val1551Met missense AHDC1 3 80802 3.71278E-5 40401 0 3.18776E-5
1-27873977-G-C p.Pro1550Pro synonymous AHDC1 1 80858 1.23674E-5 40429 0 8.83392E-6
1-27873981-G-T p.Ser1549Tyr missense AHDC1 5 80822 6.18643E-5 40411 0 1.76252E-4
1-27873981-G-C p.Ser1549Cys missense AHDC1 2 80822 2.47457E-5 40411 0 8.81259E-6
1-27874012-C-T p.Gly1539Ser missense AHDC1 1 79934 1.25103E-5 39967 0 3.18552E-5
1-27874017-C-A p.Gly1537Val missense AHDC1 1 79692 1.25483E-5 39846 0 NA
1-27874020-G-A p.Ala1536Val missense AHDC1 1 79490 1.25802E-5 39745 0 NA
1-27874024-C-T p.Ala1535Thr missense AHDC1 7 79070 8.85292E-5 39535 0 2.54175E-4
1-27874025-G-A p.Ala1534Ala synonymous AHDC1 2 79050 2.53004E-5 39525 0 2.46009E-5
1-27874032-G-A p.Ala1532Val missense AHDC1 1 78490 1.27405E-5 39245 0 NA
1-27874037-G-T p.Gly1530Gly synonymous AHDC1 1 78048 1.28126E-5 39024 0 NA
1-27874041-C-T p.Arg1529His missense AHDC1 3 77434 3.87427E-5 38717 0 3.18715E-5
1-27874042-G-A p.Arg1529Cys missense AHDC1 26 77482 3.35562E-4 38741 0 5.05561E-4
1-27874042-G-C p.Arg1529Gly missense AHDC1 1 77482 1.29062E-5 38741 0 3.18715E-5
1-27874051-CAGGGGGCCGGGCCATTTCCAGTGGCTCCTTGTCGGCCTTGGGCGTGGCTGGTGGGCT-C p.Ser1507_Pro1525del conservative_inframe_deletion AHDC1 2 76840 2.60281E-5 38420 0 NA
1-27874059-C-T p.Arg1523Gln missense AHDC1 2 75898 2.63512E-5 37949 0 4.06636E-5
1-27874080-T-A p.Lys1516Met missense AHDC1 1 74280 1.34626E-5 37140 0 NA
1-27874081-TGTC-T p.Asp1515del conservative_inframe_deletion AHDC1 1 74200 1.34771E-5 37100 0 1.27423E-5
1-27874081-T-G p.Lys1516Gln missense AHDC1 1 74200 1.34771E-5 37100 0 NA
1-27874088-C-T p.Lys1513Lys synonymous AHDC1 1 73258 1.36504E-5 36629 0 7.94479E-5
1-27874094-C-T p.Thr1511Thr synonymous AHDC1 18 72418 2.48557E-4 36209 0 0.00151822
1-27874130-G-A p.Cys1499Cys synonymous AHDC1 3 70514 4.25447E-5 35257 0 6.25782E-4
1-27874133-C-T p.Ala1498Ala synonymous AHDC1 2 70184 2.84965E-5 35092 0 2.91877E-4
1-27874134-G-A p.Ala1498Val missense AHDC1 2 70010 2.85673E-5 35005 0 3.18857E-5
1-27874135-C-T p.Ala1498Thr missense AHDC1 24 69898 3.43357E-4 34949 1 7.0081E-5
1-27874136-G-A p.Ala1497Ala synonymous AHDC1 6 69926 8.5805E-5 34963 0 1.5355E-4
1-27874143-G-A p.Thr1495Met missense AHDC1 2 69606 2.87332E-5 34803 0 3.18837E-5
1-27874148-G-A p.Gly1493Gly synonymous AHDC1 1 69754 1.43361E-5 34877 0 4.63207E-6
1-27874153-G-A p.Leu1492Leu synonymous AHDC1 2 69866 2.86262E-5 34933 0 NA
1-27874157-G-A p.Asp1490Asp synonymous AHDC1 2 69610 2.87315E-5 34805 0 NA
1-27874172-T-C p.Thr1485Thr synonymous AHDC1 1 69068 1.44785E-5 34534 0 9.20556E-6
1-27874175-A-C p.Gly1484Gly synonymous AHDC1 2 68736 2.90968E-5 34368 0 NA
1-27874198-G-A p.Pro1477Ser missense AHDC1 2 67118 2.97983E-5 33559 0 6.94001E-5
1-27874203-C-T p.Arg1475His missense AHDC1 2 66262 3.01832E-5 33131 0 1.78489E-5
1-27874204-G-A p.Arg1475Cys missense AHDC1 2 66480 3.00842E-5 33240 0 4.12462E-5
1-27874214-G-A p.Gly1471Gly synonymous AHDC1 4 66476 6.01721E-5 33238 0 3.18613E-5
1-27874215-C-T p.Gly1471Asp missense AHDC1 1 66402 1.50598E-5 33201 0 NA
1-27874227-C-G p.Trp1467Ser missense AHDC1 1 66446 1.50498E-5 33223 0 NA
1-27874235-T-A p.Thr1464Thr synonymous AHDC1 4 66542 6.01124E-5 33271 0 NA
1-27874243-T-G p.Lys1462Gln missense AHDC1 85 66526 0.0012777 33263 2 7.53795E-4
1-27874255-A-G p.Ser1458Pro missense AHDC1 1 66206 1.51044E-5 33103 0 1.23928E-5
1-27874258-C-T p.Asp1457Asn missense AHDC1 1 66616 1.50114E-5 33308 0 1.24264E-5
1-27874259-G-A p.Tyr1456Tyr synonymous AHDC1 24 66782 3.59378E-4 33391 0 0.00144305
1-27874260-T-C p.Tyr1456Cys missense AHDC1 1 67048 1.49147E-5 33524 0 NA
1-27874266-G-C p.Pro1454Arg missense AHDC1 3 67316 4.45659E-5 33658 0 1.34999E-5
1-27874274-C-T p.Leu1451Leu synonymous AHDC1 2 67724 2.95316E-5 33862 0 NA
1-27874288-G-A p.Arg1447Trp missense AHDC1 2 66626 3.00183E-5 33313 0 9.75438E-6
1-27874292-G-A p.Ser1445Ser synonymous AHDC1 1 68296 1.46421E-5 34148 0 7.54072E-5
1-27874298-G-C p.His1443Gln missense AHDC1 10 69220 1.44467E-4 34610 0 4.46286E-4
1-27874303-C-T p.Ala1442Thr missense AHDC1 2 69004 2.89838E-5 34502 0 4.98211E-6
1-27874319-G-A p.His1436His synonymous AHDC1 5 71564 6.98675E-5 35782 0 4.68834E-5
1-27874327-G-C p.Leu1434Val missense AHDC1 1 73012 1.36964E-5 36506 0 3.18898E-5
1-27874329-C-T p.Ser1433Asn missense AHDC1 2 73098 2.73605E-5 36549 0 NA
1-27874334-C-G p.Gly1431Gly synonymous AHDC1 5 73984 6.75822E-5 36992 0 1.27527E-4
1-27874347-T-C p.His1427Arg missense AHDC1 3 75826 3.95643E-5 37913 0 9.56145E-5
1-27874351-T-G p.Lys1426Gln missense AHDC1 1 76356 1.30965E-5 38178 0 NA
1-27874361-G-A p.Cys1422Cys synonymous AHDC1 21 76992 2.72756E-4 38496 0 0.0010101
1-27874371-A-T p.Leu1419Gln missense AHDC1 1 78668 1.27116E-5 39334 0 NA
1-27874373-C-T p.Lys1418Lys synonymous AHDC1 31 78832 3.93241E-4 39416 0 0.005625
1-27874378-T-C p.Thr1417Ala missense AHDC1 1 79212 1.26243E-5 39606 0 NA
1-27874383-G-A p.Pro1415Leu missense AHDC1 2 79518 2.51515E-5 39759 0 4.94716E-5
1-27874386-G-A p.Pro1414Leu missense AHDC1 1 79716 1.25445E-5 39858 0 NA
1-27874389-C-T p.Arg1413Gln missense AHDC1 1 79948 1.25081E-5 39974 0 2.93887E-5
1-27874390-G-A p.Arg1413Trp missense AHDC1 3 80014 3.74934E-5 40007 0 6.84449E-5
1-27874406-G-A p.Gly1407Gly synonymous AHDC1 1 81002 1.23454E-5 40501 0 9.59932E-6
1-27874409-C-T p.Leu1406Leu synonymous AHDC1 7 81176 8.62324E-5 40588 0 7.66078E-5
1-27874424-G-A p.Thr1401Thr synonymous AHDC1 1 81774 1.22288E-5 40887 0 1.59439E-4
1-27874427-G-A p.Pro1400Pro synonymous AHDC1 33 81850 4.03177E-4 40925 0 0.00121158
1-27874430-C-T p.Ser1399Ser synonymous AHDC1 3 81902 3.66291E-5 40951 0 1.86947E-5
1-27874444-G-T p.Gln1395Lys missense AHDC1 3 82334 3.6437E-5 41167 0 1.83756E-5
1-27874448-G-A p.Gly1393Gly synonymous AHDC1 3 82402 3.64069E-5 41201 0 9.1386E-6
1-27874449-C-T p.Gly1393Asp missense AHDC1 20 82400 2.42718E-4 41200 0 0.004375
1-27874450-C-T p.Gly1393Ser missense AHDC1 3 82432 3.63936E-5 41216 0 3.18796E-5
1-27874451-G-A p.Ala1392Ala synonymous AHDC1 1 82462 1.21268E-5 41231 0 1.81712E-5
1-27874454-G-A p.Asp1391Asp synonymous AHDC1 2 82524 2.42354E-5 41262 0 6.37592E-5
1-27874464-G-A p.Thr1388Met missense AHDC1 1 82632 1.21018E-5 41316 0 2.8912E-5
1-27874467-G-C p.Pro1387Arg missense AHDC1 1 82662 1.20975E-5 41331 0 3.18735E-5
1-27874481-C-T p.Pro1382Pro synonymous AHDC1 3 82696 3.62775E-5 41348 0 3.18817E-5
1-27874481-C-A p.Pro1382Pro synonymous AHDC1 2 82696 2.4185E-5 41348 0 1.22158E-5
1-27874482-G-A p.Pro1382Leu missense AHDC1 17 82740 2.05463E-4 41370 0 3.24559E-5
1-27874487-G-A p.Phe1380Phe synonymous AHDC1 1 82796 1.20779E-5 41398 0 8.7225E-6
1-27874488-A-T p.Phe1380Tyr missense AHDC1 1 82806 1.20764E-5 41403 0 NA
1-27874489-A-T p.Phe1380Ile missense AHDC1 1 82834 1.20723E-5 41417 0 NA
1-27874499-A-T p.Asp1376Glu missense AHDC1 2 82868 2.41348E-5 41434 0 NA
1-27874508-G-A p.Pro1373Pro synonymous AHDC1 1 82880 1.20656E-5 41440 0 8.01622E-6
1-27874510-G-C p.Pro1373Ala missense AHDC1 5 82886 6.03238E-5 41443 0 6.37308E-5
1-27874530-T-A p.Asp1366Val missense AHDC1 1 82894 1.20636E-5 41447 0 NA
1-27874531-C-T p.Asp1366Asn missense AHDC1 2 82918 2.41202E-5 41459 0 3.18654E-5
1-27874532-G-A p.Cys1365Cys synonymous AHDC1 1 82916 1.20604E-5 41458 0 3.18573E-5
1-27874538-G-C p.Phe1363Leu missense AHDC1 1 82982 1.20508E-5 41491 0 3.18512E-5
1-27874541-G-C p.Gly1362Gly synonymous AHDC1 1 82974 1.2052E-5 41487 0 NA
1-27874554-G-A p.Thr1358Ile missense AHDC1 1 83028 1.20441E-5 41514 0 NA
1-27874562-G-A p.Ser1355Ser synonymous AHDC1 6 83036 7.22578E-5 41518 0 1.59351E-5
1-27874568-C-T p.Thr1353Thr synonymous AHDC1 2 82990 2.40993E-5 41495 0 1.59337E-4
1-27874574-C-T p.Pro1351Pro synonymous AHDC1 1 83022 1.2045E-5 41511 0 6.37308E-5
1-27874577-G-A p.Asn1350Asn synonymous AHDC1 9 83042 1.08379E-4 41521 0 1.15727E-4
1-27874584-G-C p.Ser1348Cys missense AHDC1 1 83030 1.20438E-5 41515 0 NA
1-27874590-G-A p.Pro1346Leu missense AHDC1 1 83042 1.20421E-5 41521 0 NA
1-27874596-A-G p.Ile1344Thr missense AHDC1 1 83058 1.20398E-5 41529 0 NA
1-27874597-T-A p.Ile1344Leu missense AHDC1 1 83064 1.20389E-5 41532 0 8.26078E-6
1-27874605-C-G p.Cys1341Ser missense AHDC1 1 83064 1.20389E-5 41532 0 NA
1-27874606-A-C p.Cys1341Gly missense AHDC1 76 83066 9.14935E-4 41533 1 0.00251762
1-27874610-G-C p.Asp1339Glu missense AHDC1 1 83036 1.2043E-5 41518 0 NA
1-27874624-C-T p.Val1335Met missense AHDC1 3 83036 3.61289E-5 41518 0 4.37616E-5
1-27874625-G-A p.Gly1334Gly synonymous AHDC1 7 83020 8.4317E-5 41510 0 9.55475E-5
1-27874627-C-T p.Gly1334Ser missense AHDC1 55 83016 6.62523E-4 41508 0 0.00151057
1-27874631-G-A p.Ala1332Ala synonymous AHDC1 3 83014 3.61385E-5 41507 0 NA
1-27874633-C-T p.Ala1332Thr missense AHDC1 1 82996 1.20488E-5 41498 0 NA
1-27874637-C-A p.Ser1330Ser synonymous AHDC1 3 82988 3.61498E-5 41494 0 6.37308E-5
1-27874637-C-T p.Ser1330Ser synonymous AHDC1 2 82988 2.40999E-5 41494 0 1.19355E-5
1-27874638-G-A p.Ser1330Leu missense AHDC1 1 82992 1.20494E-5 41496 0 NA
1-27874646-G-A p.Pro1327Pro synonymous AHDC1 1 83012 1.20465E-5 41506 0 NA
1-27874649-C-T p.Leu1326Leu synonymous AHDC1 1 83004 1.20476E-5 41502 0 3.97883E-6
1-27874673-G-A p.Ser1318Ser synonymous AHDC1 3 82960 3.6162E-5 41480 0 1.48773E-4
1-27874687-G-A p.Leu1314Leu synonymous AHDC1 1 82946 1.2056E-5 41473 0 6.36943E-5
1-27874690-C-T p.Gly1313Ser missense AHDC1 1 82910 1.20613E-5 41455 0 6.25E-4
1-27874702-T-C p.Ser1309Gly missense AHDC1 1 82880 1.20656E-5 41440 0 7.95982E-6
1-27874757-C-T p.Ala1290Ala synonymous AHDC1 1 82562 1.21121E-5 41281 0 3.18695E-5
1-27874762-C-T p.Ala1289Thr missense AHDC1 1 82502 1.21209E-5 41251 0 5.03525E-4
1-27874763-G-A p.Gly1288Gly synonymous AHDC1 2 82490 2.42454E-5 41245 0 4.0076E-6
1-27874767-C-T p.Gly1287Asp missense AHDC1 1 82624 1.2103E-5 41312 0 8.34725E-6
1-27874772-C-G p.Glu1285Asp missense AHDC1 4 82674 4.83828E-5 41337 0 0.00151057
1-27874798-C-T p.Gly1277Ser missense AHDC1 16 82688 1.93498E-4 41344 0 1.00998E-4
1-27874799-G-A p.Gly1276Gly synonymous AHDC1 4 82670 4.83851E-5 41335 0 1.68364E-5
1-27874811-T-C p.Arg1272Arg synonymous AHDC1 6 82658 7.25883E-5 41329 0 1.26873E-4
1-27874814-C-T p.Pro1271Pro synonymous AHDC1 10 82684 1.20942E-4 41342 0 1.05226E-4
1-27874817-C-T p.Gln1270Gln synonymous AHDC1 1 82716 1.20896E-5 41358 0 8.46153E-6
1-27874822-G-A p.Arg1269Trp missense AHDC1 2 82744 2.41709E-5 41372 0 NA
1-27874825-G-A p.Pro1268Ser missense AHDC1 1 82772 1.20814E-5 41386 0 8.46196E-6
1-27874826-C-G p.Gly1267Gly synonymous AHDC1 2 82786 2.41587E-5 41393 0 8.46554E-6
1-27874832-G-A p.Ser1265Ser synonymous AHDC1 1 82840 1.20715E-5 41420 0 8.46181E-6
1-27874836-C-T p.Arg1264Gln missense AHDC1 1 82878 1.20659E-5 41439 0 NA
1-27874837-G-A p.Arg1264Trp missense AHDC1 1 82890 1.20642E-5 41445 0 1.69231E-5
1-27874844-T-C p.Pro1261Pro synonymous AHDC1 13 82928 1.56762E-4 41464 0 0.0025
1-27874861-C-A p.Ala1256Ser missense AHDC1 3 82990 3.61489E-5 41495 0 3.1841E-5
1-27874861-C-T p.Ala1256Thr missense AHDC1 2 82990 2.40993E-5 41495 0 1.69027E-5
1-27874862-G-A p.Ala1255Ala synonymous AHDC1 2 83000 2.40964E-5 41500 0 8.4364E-6
1-27874870-C-T p.Ala1253Thr missense AHDC1 1 82998 1.20485E-5 41499 0 1.60896E-5
1-27874871-G-A p.Ser1252Ser synonymous AHDC1 4 83016 4.81835E-5 41508 0 2.81446E-5
1-27874877-C-T p.Pro1250Pro synonymous AHDC1 1 82970 1.20525E-5 41485 0 3.18613E-5
1-27874889-A-C p.His1246Gln missense AHDC1 2 83004 2.40952E-5 41502 0 NA
1-27874894-A-G p.Ser1245Pro missense AHDC1 1 83036 1.2043E-5 41518 0 3.18532E-5
1-27874900-C-T p.Glu1243Lys missense AHDC1 2 83040 2.40848E-5 41520 0 NA
1-27874901-G-A p.Phe1242Phe synonymous AHDC1 1 83018 1.20456E-5 41509 0 3.18471E-5
1-27874903-A-G p.Phe1242Leu missense AHDC1 1 83042 1.20421E-5 41521 0 NA
1-27874910-C-T p.Val1239Val synonymous AHDC1 3 83058 3.61193E-5 41529 0 2.50405E-5
1-27874912-C-T p.Val1239Met missense AHDC1 1 83046 1.20415E-5 41523 0 NA
1-27874924-G-T p.Arg1235Arg synonymous AHDC1 1 83010 1.20467E-5 41505 0 NA
1-27874944-C-T p.Ser1228Asn missense AHDC1 4 82984 4.82021E-5 41492 0 2.78782E-5
1-27874958-G-C p.Val1223Val synonymous AHDC1 3 82964 3.61603E-5 41482 0 8.28185E-6
1-27874981-C-T p.Gly1216Ser missense AHDC1 1 82938 1.20572E-5 41469 0 6.36983E-5
1-27874982-G-A p.Pro1215Pro synonymous AHDC1 1 82924 1.20592E-5 41462 0 3.18585E-5
1-27874997-C-A p.Glu1210Asp missense AHDC1 5 82968 6.02642E-5 41484 0 6.76665E-5
1-27874999-C-T p.Glu1210Lys missense AHDC1 1 82934 1.20578E-5 41467 0 3.98051E-6
1-27875000-G-A p.Asn1209Asn synonymous AHDC1 1 82956 1.20546E-5 41478 0 1.1941E-5
1-27875017-G-A p.Leu1204Leu synonymous AHDC1 1 82944 1.20563E-5 41472 0 6.25E-4
1-27875021-C-T p.Glu1202Glu synonymous AHDC1 5 82936 6.02874E-5 41468 0 7.95874E-6
1-27875048-C-T p.Glu1193Glu synonymous AHDC1 4 82664 4.83887E-5 41332 0 4.77844E-5
1-27875054-A-G p.Ser1191Ser synonymous AHDC1 1 82588 1.21083E-5 41294 0 NA
1-27875055-C-T p.Ser1191Asn missense AHDC1 49 82652 5.92847E-4 41326 0 5.71552E-4
1-27875061-G-A p.Ala1189Val missense AHDC1 1 82638 1.2101E-5 41319 0 NA
1-27875066-G-A p.Ser1187Ser synonymous AHDC1 1 82568 1.21112E-5 41284 0 7.96331E-6
1-27875080-G-C p.Arg1183Gly missense AHDC1 1 82540 1.21153E-5 41270 0 NA
1-27875083-A-C p.Phe1182Val missense AHDC1 6 82390 7.28244E-5 41195 0 0.00453172
1-27875085-C-T p.Gly1181Glu missense AHDC1 1 82628 1.21024E-5 41314 0 8.28514E-6
1-27875088-C-A p.Gly1180Val missense AHDC1 1 82616 1.21042E-5 41308 0 NA
1-27875089-C-T p.Gly1180Arg missense AHDC1 2 82590 2.4216E-5 41295 0 3.18492E-5
1-27875090-G-A p.Gly1179Gly synonymous AHDC1 2 82500 2.42424E-5 41250 0 1.1947E-5
1-27875099-C-T p.Pro1176Pro synonymous AHDC1 1 82606 1.21057E-5 41303 0 6.37227E-5
1-27875123-G-A p.Ser1168Ser synonymous AHDC1 7 82414 8.4937E-5 41207 0 4.14759E-5
1-27875134-C-T p.Glu1165Lys missense AHDC1 1 82268 1.21554E-5 41134 0 NA
1-27875136-GAGA-G p.Phe1163del disruptive_inframe_deletion AHDC1 2 82238 2.43197E-5 41119 0 NA
1-27875144-C-T p.Glu1161Glu synonymous AHDC1 3 82106 3.65381E-5 41053 0 NA
1-27875156-C-T p.Thr1157Thr synonymous AHDC1 1 81952 1.22023E-5 40976 0 6.37227E-5
1-27875157-G-A p.Thr1157Met missense AHDC1 3 81926 3.66184E-5 40963 0 2.49688E-5
1-27875158-T-A p.Thr1157Ser missense AHDC1 3 81912 3.66247E-5 40956 0 3.18451E-5
1-27875175-T-C p.Gln1151Arg missense AHDC1 1 81938 1.22043E-5 40969 0 NA
1-27875177-C-T p.Pro1150Pro synonymous AHDC1 1 81904 1.22094E-5 40952 0 2.50204E-4
1-27875207-G-A p.Asn1140Asn synonymous AHDC1 3 82108 3.65372E-5 41054 0 7.97868E-6
1-27875208-T-C p.Asn1140Ser missense AHDC1 2 82122 2.4354E-5 41061 0 8.3661E-6
1-27875216-G-A p.Ser1137Ser synonymous AHDC1 2 82150 2.43457E-5 41075 0 6.25E-4
1-27875221-C-T p.Val1136Ile missense AHDC1 4 82206 4.86583E-5 41103 0 0.00125
1-27875221-C-A p.Val1136Phe missense AHDC1 3 82206 3.64937E-5 41103 0 3.9901E-6
1-27875222-G-A p.His1135His synonymous AHDC1 4 82198 4.8663E-5 41099 0 4.18887E-5
1-27875222-G-C p.His1135Gln missense AHDC1 1 82198 1.21657E-5 41099 0 3.18451E-5
1-27875247-A-G p.Leu1127Pro missense AHDC1 1 82200 1.21655E-5 41100 0 NA
1-27875260-C-T p.Ala1123Thr missense AHDC1 12 82114 1.46138E-4 41057 0 6.25E-4
1-27875278-G-A p.Leu1117Leu synonymous AHDC1 1 82130 1.21758E-5 41065 0 NA
1-27875286-T-A p.Tyr1114Phe missense AHDC1 1 82116 1.21779E-5 41058 0 5.62023E-5
1-27875286-T-C p.Tyr1114Cys missense AHDC1 4 82116 4.87116E-5 41058 0 1.04376E-4
1-27875287-A-G p.Tyr1114His missense AHDC1 1 82118 1.21776E-5 41059 0 NA
1-27875301-G-A p.Pro1109Leu missense AHDC1 20 82028 2.43819E-4 41014 0 1.1039E-4
1-27875312-A-G p.Ala1105Ala synonymous AHDC1 16 81936 1.95274E-4 40968 0 1.45147E-4
1-27875319-G-A p.Ala1103Val missense AHDC1 12 81850 1.4661E-4 40925 0 6.84428E-5
1-27875326-G-C p.Gln1101Glu missense AHDC1 1 81846 1.22181E-5 40923 0 8.07996E-6
1-27875328-C-T p.Arg1100Gln missense AHDC1 2 81836 2.44391E-5 40918 0 4.28905E-5
1-27875329-G-A p.Arg1100Trp missense AHDC1 4 81856 4.88663E-5 40928 0 3.18532E-5
1-27875339-G-A p.Pro1096Pro synonymous AHDC1 3 81690 3.67242E-5 40845 0 3.18532E-5
1-27875343-G-A p.Ser1095Leu missense AHDC1 1 81628 1.22507E-5 40814 0 4.0457E-6
1-27875347-G-A p.Pro1094Ser missense AHDC1 1 81582 1.22576E-5 40791 0 NA
1-27875352-AAGG-A p.Ser1091del disruptive_inframe_deletion AHDC1 78 80286 9.71527E-4 40143 1 0.0227043
1-27875352-A-AAGGAGG p.Ser1090_Ser1091dup conservative_inframe_insertion AHDC1 2 81606 2.4508E-5 40803 0 1.78881E-5
1-27875352-AAGGAGG-A p.Ser1090_Ser1091del disruptive_inframe_deletion AHDC1 2 81602 2.45092E-5 40801 0 1.59693E-4
1-27875352-A-AAGG p.Ser1091dup conservative_inframe_insertion AHDC1 7 81606 8.5778E-5 40803 0 1.91632E-4
1-27875352-A-AAGGAGGAGG p.Ser1089_Ser1091dup conservative_inframe_insertion AHDC1 1 81606 1.2254E-5 40803 0 4.20844E-6
1-27875363-G-A p.Ser1088Ser synonymous AHDC1 940 81560 0.0115253 40780 6 0.0100705
1-27875371-A-C p.Ser1086Ala missense AHDC1 7 81550 8.58369E-5 40775 0 5.61903E-5
1-27875372-G-C p.Ala1085Ala synonymous AHDC1 1 81588 1.22567E-5 40794 0 NA
1-27875374-C-T p.Ala1085Thr missense AHDC1 1 81510 1.22684E-5 40755 0 3.18756E-5
1-27875374-CGGCAGAGGCTGCAGAGGT-C p.Thr1079_Ala1084del conservative_inframe_deletion AHDC1 1 81512 1.22681E-5 40756 0 8.13398E-6
1-27875377-C-T p.Ala1084Thr missense AHDC1 13 81548 1.59415E-4 40774 0 2.04571E-5
1-27875380-A-G p.Ser1083Pro missense AHDC1 2 81592 2.45122E-5 40796 0 NA
1-27875382-G-C p.Ala1082Gly missense AHDC1 1 81566 1.226E-5 40783 0 NA
1-27875382-G-A p.Ala1082Val missense AHDC1 1 81566 1.226E-5 40783 0 NA
1-27875383-CTGCAGAGGT-C p.Thr1079_Ala1081del conservative_inframe_deletion AHDC1 2 81588 2.45134E-5 40794 0 1.96259E-5
1-27875384-TGCAGAGGTG-T p.Thr1079_Ala1081del disruptive_inframe_deletion AHDC1 51 81578 6.25169E-4 40789 0 6.62501E-4
1-27875387-A-G p.Ser1080Ser synonymous AHDC1 58 81530 7.11395E-4 40765 0 8.60805E-4
1-27875392-TGGCAGAGGC-T p.Ala1076_Ala1078del conservative_inframe_deletion AHDC1 1 81418 1.22823E-5 40709 0 8.29579E-6
1-27875393-G-A p.Ala1078Ala synonymous AHDC1 1 81482 1.22726E-5 40741 0 NA
1-27875430-C-A p.Gly1066Val missense AHDC1 5 81298 6.15021E-5 40649 0 3.18634E-5
1-27875431-C-T p.Gly1066Ser missense AHDC1 1 81274 1.23041E-5 40637 0 1.35797E-5
1-27875435-C-T p.Ser1064Ser synonymous AHDC1 1 81218 1.23125E-5 40609 0 2.75718E-5
1-27875445-C-T p.Ser1061Asn missense AHDC1 2 81338 2.45888E-5 40669 0 NA
1-27875450-C-A p.Arg1059Arg synonymous AHDC1 1 81254 1.23071E-5 40627 0 6.37308E-5
1-27875462-G-A p.Arg1055Arg synonymous AHDC1 2 81284 2.46051E-5 40642 0 NA
1-27875463-C-T p.Arg1055His missense AHDC1 1 81238 1.23095E-5 40619 0 1.53229E-5
1-27875471-C-T p.Thr1052Thr synonymous AHDC1 4 81198 4.92623E-5 40599 0 7.77194E-5
1-27875472-G-A p.Thr1052Met missense AHDC1 1 81246 1.23083E-5 40623 0 3.18715E-5
1-27875484-C-T p.Gly1048Asp missense AHDC1 1 81330 1.22956E-5 40665 0 NA
1-27875489-G-A p.Phe1046Phe synonymous AHDC1 1 81380 1.2288E-5 40690 0 3.18918E-5
1-27875501-C-T p.Glu1042Glu synonymous AHDC1 2 81482 2.45453E-5 40741 0 NA
1-27875512-TGAA-T p.Phe1038del conservative_inframe_deletion AHDC1 2 81568 2.45194E-5 40784 0 3.19714E-5
1-27875517-AAGG-A p.Ser1036del disruptive_inframe_deletion AHDC1 965 81606 0.0118251 40803 31 0.0231839
1-27875519-G-A p.Ser1036Ser synonymous AHDC1 1 81468 1.22748E-5 40734 0 1.2792E-5
1-27875524-C-T p.Ala1035Thr missense AHDC1 1 81612 1.22531E-5 40806 0 8.45268E-5
1-27875547-C-T p.Gly1027Asp missense AHDC1 1 81628 1.22507E-5 40814 0 3.18939E-5
1-27875553-G-C p.Thr1025Ser missense AHDC1 1 81682 1.22426E-5 40841 0 4.9981E-5
1-27875558-C-T p.Pro1023Pro synonymous AHDC1 1 81666 1.2245E-5 40833 0 1.37839E-5
1-27875564-G-A p.Ala1021Ala synonymous AHDC1 1 81766 1.223E-5 40883 0 2.3162E-4
1-27875572-C-T p.Gly1019Ser missense AHDC1 1 81768 1.22297E-5 40884 0 0.00100908
1-27875573-G-A p.Ala1018Ala synonymous AHDC1 96 81798 0.00117362 40899 0 0.0027399
1-27875575-C-T p.Ala1018Thr missense AHDC1 2 81762 2.44612E-5 40881 0 9.50842E-6
1-27875576-G-A p.Ser1017Ser synonymous AHDC1 7 81814 8.55599E-5 40907 0 6.63256E-5
1-27875581-GGGCG-TGCCA p.SerAlaHis1014SerGlyAsn missense AHDC1 1 81916 1.22076E-5 40958 0 NA
1-27875583-G-A p.Ala1015Val missense AHDC1 1 81884 1.22124E-5 40942 0 3.18634E-5
1-27875585-G-A p.Ser1014Ser synonymous AHDC1 3 81884 3.66372E-5 40942 0 3.18552E-5
1-27875587-T-C p.Ser1014Gly missense AHDC1 1 81898 1.22103E-5 40949 0 4.75466E-6
1-27875590-T-C p.Ser1013Gly missense AHDC1 1 81980 1.21981E-5 40990 0 NA
1-27875603-G-A p.Leu1008Leu synonymous AHDC1 3 82150 3.65186E-5 41075 0 NA
1-27875608-T-C p.Ser1007Gly missense AHDC1 1 82134 1.21752E-5 41067 0 9.31064E-6
1-27875612-G-A p.Gly1005Gly synonymous AHDC1 1 82186 1.21675E-5 41093 0 NA
1-27875616-C-T p.Ser1004Asn missense AHDC1 4 82238 4.86393E-5 41119 0 6.37024E-5
1-27875627-G-A p.Phe1000Phe synonymous AHDC1 3 82342 3.64334E-5 41171 0 1.84563E-5
1-27875651-G-A p.Cys992Cys synonymous AHDC1 200 82410 0.00242689 41205 0 0.0175
1-27875665-T-C p.Thr988Ala missense AHDC1 2 82424 2.42648E-5 41212 0 9.19794E-6
1-27875669-G-A p.Pro986Pro synonymous AHDC1 1 82462 1.21268E-5 41231 0 4.5754E-6
1-27875681-G-A p.Ala982Ala synonymous AHDC1 2 82332 2.42919E-5 41166 0 NA
1-27875683-C-T p.Ala982Thr missense AHDC1 3 82184 3.65035E-5 41092 0 5.04541E-4
1-27875684-G-A p.Phe981Phe synonymous AHDC1 7 82288 8.50671E-5 41144 0 0.00100806
1-27875685-A-G p.Phe981Ser missense AHDC1 1 82268 1.21554E-5 41134 0 NA
1-27875687-T-C p.Val980Val synonymous AHDC1 1 82272 1.21548E-5 41136 0 9.05978E-6
1-27875690-G-A p.Ser979Ser synonymous AHDC1 2 82156 2.43439E-5 41078 0 3.18532E-5
1-27875698-C-T p.Gly977Arg missense AHDC1 2 82084 2.43653E-5 41042 0 6.37146E-5
1-27875699-G-A p.Ala976Ala synonymous AHDC1 2 82114 2.43564E-5 41057 0 5.52782E-5
1-27875706-T-A p.Tyr974Phe missense AHDC1 2 82146 2.43469E-5 41073 0 4.20826E-6
1-27875711-G-A p.Gly972Gly synonymous AHDC1 1 82296 1.21513E-5 41148 0 1.24735E-5
1-27875713-C-T p.Gly972Ser missense AHDC1 2 82332 2.42919E-5 41166 0 3.57207E-5
1-27875713-C-A p.Gly972Cys missense AHDC1 1 82332 1.21459E-5 41166 0 NA
1-27875731-T-C p.Thr966Ala missense AHDC1 2 82344 2.42884E-5 41172 0 NA
1-27875735-G-A p.Ala964Ala synonymous AHDC1 2 82410 2.42689E-5 41205 0 NA
1-27875737-C-A p.Ala964Ser missense AHDC1 2 82372 2.42801E-5 41186 0 1.76103E-5
1-27875742-G-A p.Pro962Leu missense AHDC1 10 82278 1.21539E-4 41139 0 7.75213E-5
1-27875750-G-A p.Thr959Thr synonymous AHDC1 1 82180 1.21684E-5 41090 0 NA
1-27875759-G-A p.Arg956Arg synonymous AHDC1 1 82234 1.21604E-5 41117 0 NA
1-27875760-C-T p.Arg956His missense AHDC1 2 82192 2.43333E-5 41096 0 5.23013E-5
1-27875777-C-T p.Pro950Pro synonymous AHDC1 18 82358 2.18558E-4 41179 0 2.08041E-4
1-27875777-C-A p.Pro950Pro synonymous AHDC1 6 82358 7.28527E-5 41179 0 3.29398E-4
1-27875779-G-C p.Pro950Ala missense AHDC1 1 82488 1.2123E-5 41244 0 8.64379E-6
1-27875785-C-G p.Val948Leu missense AHDC1 2 82474 2.42501E-5 41237 0 NA
1-27875800-T-G p.Thr943Pro missense AHDC1 110 82406 0.00133485 41203 2 0.00625
1-27875803-C-T p.Glu942Lys missense AHDC1 1 82338 1.21451E-5 41169 0 NA
1-27875804-G-A p.Ala941Ala synonymous AHDC1 10 82352 1.2143E-4 41176 0 2.99606E-4
1-27875812-G-A p.Arg939Trp missense AHDC1 1 82200 1.21655E-5 41100 0 1.20887E-5
1-27875824-C-T p.Ala935Thr missense AHDC1 67856 68364 0.992569 34182 33678 0.999496
1-27875837-C-A p.Gly930Gly synonymous AHDC1 1 81622 1.22516E-5 40811 0 NA
1-27875853-C-T p.Arg925Gln missense AHDC1 1 81348 1.22929E-5 40674 0 NA
1-27875863-G-C p.Pro922Ala missense AHDC1 2 81266 2.46105E-5 40633 0 NA
1-27875875-G-A p.Arg918Cys missense AHDC1 3 81004 3.70352E-5 40502 0 2.50845E-5
1-27875876-C-T p.Ala917Ala synonymous AHDC1 1 81002 1.23454E-5 40501 0 3.34443E-5
1-27875877-G-A p.Ala917Val missense AHDC1 3 81022 3.7027E-5 40511 0 6.38447E-5
1-27875878-C-T p.Ala917Thr missense AHDC1 2 81014 2.46871E-5 40507 0 4.18137E-5
1-27875879-G-A p.Ser916Ser synonymous AHDC1 2 81060 2.46731E-5 40530 0 6.25E-4
1-27875882-C-T p.Leu915Leu synonymous AHDC1 153 81106 0.00188642 40553 2 0.00654582
1-27875886-A-G p.Val914Ala missense AHDC1 1 81114 1.23283E-5 40557 0 8.37549E-6
1-27875887-C-A p.Val914Phe missense AHDC1 1 81116 1.2328E-5 40558 0 NA
1-27875901-G-C p.Pro909Arg missense AHDC1 3 81200 3.69458E-5 40600 0 4.65744E-4
1-27875906-C-T p.Ala907Ala synonymous AHDC1 1 81114 1.23283E-5 40557 0 2.81931E-5
1-27875907-G-A p.Ala907Val missense AHDC1 4 81122 4.93084E-5 40561 0 2.42275E-5
1-27875917-C-T p.Gly904Arg missense AHDC1 2 81486 2.45441E-5 40743 0 6.38203E-5
1-27875918-G-A p.Ser903Ser synonymous AHDC1 3 81518 3.68017E-5 40759 0 6.25E-4
1-27875926-C-T p.Gly901Ser missense AHDC1 1 81802 1.22246E-5 40901 0 NA
1-27875937-G-A p.Pro897Leu missense AHDC1 1 81940 1.22041E-5 40970 0 NA
1-27875939-G-A p.Ser896Ser synonymous AHDC1 1 81912 1.22082E-5 40956 0 1.70602E-5
1-27875955-C-T p.Arg891Gln missense AHDC1 8 82044 9.75087E-5 41022 0 1.71259E-5
1-27875958-C-A p.Ser890Ile missense AHDC1 1 82046 1.21883E-5 41023 0 NA
1-27875962-G-C p.Pro889Ala missense AHDC1 1 82120 1.21773E-5 41060 0 4.04194E-6
1-27875963-G-A p.Phe888Phe synonymous AHDC1 2 82106 2.43588E-5 41053 0 4.04259E-6
1-27875969-G-A p.Ala886Ala synonymous AHDC1 2 82112 2.4357E-5 41056 0 NA
1-27875978-C-A p.Arg883Arg synonymous AHDC1 1 82210 1.2164E-5 41105 0 NA
1-27875978-C-T p.Arg883Arg synonymous AHDC1 1 82210 1.2164E-5 41105 0 2.42383E-5
1-27875979-C-T p.Arg883Gln missense AHDC1 1 82208 1.21643E-5 41104 0 2.82792E-5
1-27875990-C-T p.Leu879Leu synonymous AHDC1 1 82234 1.21604E-5 41117 0 8.54613E-6
1-27875993-G-A p.Ala878Ala synonymous AHDC1 405 82248 0.00492413 41124 2 0.0110268
1-27876000-G-C p.Thr876Ser missense AHDC1 1 82170 1.21699E-5 41085 0 NA
1-27876007-G-C p.Pro874Ala missense AHDC1 1 82200 1.21655E-5 41100 0 4.02191E-6
1-27876014-A-G p.Tyr871Tyr synonymous AHDC1 1 82314 1.21486E-5 41157 0 NA
1-27876017-G-A p.Thr870Thr synonymous AHDC1 1 82364 1.21412E-5 41182 0 4.01104E-6
1-27876023-C-T p.Ser868Ser synonymous AHDC1 1 82370 1.21403E-5 41185 0 2.54604E-5
1-27876029-C-T p.Lys866Lys synonymous AHDC1 6 82516 7.27132E-5 41258 0 1.91205E-4
1-27876033-C-T p.Arg865Gln missense AHDC1 3 82546 3.63434E-5 41273 0 1.20093E-5
1-27876034-G-A p.Arg865Trp missense AHDC1 1 82560 1.21124E-5 41280 0 4.00362E-6
1-27876045-C-T p.Arg861His missense AHDC1 1 82610 1.21051E-5 41305 0 4.00182E-6
1-27876046-G-A p.Arg861Cys missense AHDC1 1 82662 1.20975E-5 41331 0 4.00327E-6
1-27876054-G-A p.Ser858Leu missense AHDC1 1 82714 1.20899E-5 41357 0 4.00051E-6
1-27876059-G-T p.Ala856Ala synonymous AHDC1 6 82692 7.25584E-5 41346 0 3.20018E-5
1-27876061-C-T p.Ala856Thr missense AHDC1 1 82672 1.2096E-5 41336 0 NA
1-27876065-G-A p.Asp854Asp synonymous AHDC1 14 82666 1.69356E-4 41333 0 6.80169E-5
1-27876067-C-T p.Asp854Asn missense AHDC1 1 82626 1.21027E-5 41313 0 NA
1-27876074-A-G p.Asp851Asp synonymous AHDC1 3 82580 3.63284E-5 41290 0 6.40769E-5
1-27876077-G-A p.Ser850Ser synonymous AHDC1 1 82534 1.21162E-5 41267 0 1.52184E-4
1-27876077-G-C p.Ser850Ser synonymous AHDC1 1 82534 1.21162E-5 41267 0 NA
1-27876079-A-T p.Ser850Thr missense AHDC1 1 82478 1.21244E-5 41239 0 NA
1-27876089-C-T p.Ser846Ser synonymous AHDC1 18 82338 2.18611E-4 41169 0 4.46372E-4
1-27876095-G-A p.Leu844Leu synonymous AHDC1 12 82162 1.46053E-4 41081 0 3.18674E-4
1-27876101-C-T p.Ser842Ser synonymous AHDC1 1 81982 1.21978E-5 40991 0 9.34103E-5
1-27876116-G-A p.Thr837Thr synonymous AHDC1 1 81786 1.2227E-5 40893 0 2.41313E-5
1-27876117-G-C p.Thr837Ser missense AHDC1 1 81752 1.22321E-5 40876 0 3.18593E-5
1-27876132-C-T p.Arg832His missense AHDC1 2 81612 2.45062E-5 40806 0 3.18796E-5
1-27876149-G-A p.Thr826Thr synonymous AHDC1 2 81516 2.45351E-5 40758 0 4.02538E-5
1-27876152-C-G p.Gln825His missense AHDC1 2 81488 2.45435E-5 40744 0 1.44893E-4
1-27876170-C-T p.Thr819Thr synonymous AHDC1 1 81382 1.22877E-5 40691 0 2.56038E-5
1-27876171-G-A p.Thr819Met missense AHDC1 2 81364 2.45809E-5 40682 0 1.61216E-5
1-27876173-G-A p.Ser818Ser synonymous AHDC1 14 81346 1.72104E-4 40673 0 9.5645E-5
1-27876186-C-T p.Gly814Asp missense AHDC1 1 81222 1.23119E-5 40611 0 4.03457E-6
1-27876189-C-T p.Arg813His missense AHDC1 12 81182 1.47816E-4 40591 0 0.0040282
1-27876190-G-A p.Arg813Cys missense AHDC1 5 81148 6.16158E-5 40574 0 3.63161E-5
1-27876194-T-A p.Ser811Ser synonymous AHDC1 1 81120 1.23274E-5 40560 0 NA
1-27876215-A-C p.Thr804Thr synonymous AHDC1 2 80756 2.4766E-5 40378 0 6.3804E-5
1-27876222-G-A p.Ala802Val missense AHDC1 1 80596 1.24076E-5 40298 0 NA
1-27876231-C-T p.Arg799Gln missense AHDC1 6 80516 7.45194E-5 40258 0 4.04914E-6
1-27876232-G-T p.Arg799Arg synonymous AHDC1 2 80496 2.4846E-5 40248 0 1.21417E-5
1-27876239-G-A p.Thr796Thr synonymous AHDC1 2 80428 2.4867E-5 40214 0 2.56393E-5
1-27876242-C-A p.Gly795Gly synonymous AHDC1 2 80458 2.48577E-5 40229 0 NA
1-27876261-C-T p.Arg789Gln missense AHDC1 1 80458 1.24288E-5 40229 0 2.41953E-5
1-27876263-G-A p.Gly788Gly synonymous AHDC1 1 80444 1.2431E-5 40222 0 3.19489E-5
1-27876264-C-A p.Gly788Val missense AHDC1 1 80436 1.24322E-5 40218 0 2.55063E-5
1-27876268-C-T p.Ala787Thr missense AHDC1 2 80574 2.48219E-5 40287 0 2.41546E-5
1-27876272-T-A p.Gly785Gly synonymous AHDC1 1 80540 1.24162E-5 40270 0 NA
1-27876275-G-A p.Gly784Gly synonymous AHDC1 1 80522 1.2419E-5 40261 0 5.03525E-4
1-27876280-G-T p.Pro783Thr missense AHDC1 1 80682 1.23943E-5 40341 0 NA
1-27876284-C-A p.Gly781Gly synonymous AHDC1 1 80798 1.23765E-5 40399 0 NA
1-27876286-C-T p.Gly781Arg missense AHDC1 3 80934 3.70672E-5 40467 0 8.44752E-6
1-27876287-A-G p.His780His synonymous AHDC1 1 80982 1.23484E-5 40491 0 1.20525E-5
1-27876290-G-T p.His779Gln missense AHDC1 1 81036 1.23402E-5 40518 0 3.19448E-5
1-27876298-C-T p.Ala777Thr missense AHDC1 1 81152 1.23226E-5 40576 0 3.19428E-5
1-27876305-A-G p.Gly774Gly synonymous AHDC1 1 81436 1.22796E-5 40718 0 NA
1-27876306-C-T p.Gly774Asp missense AHDC1 1 81508 1.22687E-5 40754 0 NA
1-27876307-C-T p.Gly774Ser missense AHDC1 3 81520 3.68008E-5 40760 0 NA
1-27876313-T-C p.Lys772Glu missense AHDC1 2 81820 2.44439E-5 40910 0 8.37507E-6
1-27876319-C-T p.Gly770Arg missense AHDC1 3 81958 3.66041E-5 40979 0 5.85764E-5
1-27876320-G-A p.Ala769Ala synonymous AHDC1 6 81942 7.32225E-5 40971 0 8.36666E-5
1-27876321-G-A p.Ala769Val missense AHDC1 2 81960 2.44021E-5 40980 0 3.19264E-5
1-27876326-C-T p.Glu767Glu synonymous AHDC1 1 82152 1.21726E-5 41076 0 1.66995E-5
1-27876358-T-C p.Ser757Gly missense AHDC1 1 82676 1.20954E-5 41338 0 8.32737E-6
1-27876369-T-C p.Glu753Gly missense AHDC1 1 82726 1.20881E-5 41363 0 NA
1-27876381-G-A p.Thr749Ile missense AHDC1 2 82764 2.41651E-5 41382 0 NA
1-27876386-A-G p.Asn747Asn synonymous AHDC1 1 82794 1.20782E-5 41397 0 8.32709E-6
1-27876392-C-T p.Arg745Arg synonymous AHDC1 4 82724 4.83536E-5 41362 0 8.33319E-6
1-27876395-G-C p.Ser744Ser synonymous AHDC1 11 82702 1.33008E-4 41351 0 4.78889E-5
1-27876399-C-T p.Arg743Gln missense AHDC1 1 82708 1.20907E-5 41354 0 NA
1-27876409-G-A p.Arg740Cys missense AHDC1 1 82640 1.21007E-5 41320 0 1.19747E-5
1-27876423-G-C p.Thr735Ser missense AHDC1 1 82530 1.21168E-5 41265 0 3.99326E-6
1-27876430-C-T p.Ala733Thr missense AHDC1 6 82416 7.28014E-5 41208 0 1.99815E-5
1-27876430-C-A p.Ala733Ser missense AHDC1 2 82416 2.42671E-5 41208 0 5.03525E-4
1-27876431-G-A p.Asp732Asp synonymous AHDC1 2 82410 2.42689E-5 41205 0 1.67417E-5
1-27876439-C-T p.Glu730Lys missense AHDC1 2 82360 2.42836E-5 41180 0 NA
1-27876440-C-G p.Gly729Gly synonymous AHDC1 2 82396 2.4273E-5 41198 0 3.20379E-5
1-27876442-C-T p.Gly729Arg missense AHDC1 1 82346 1.21439E-5 41173 0 NA
1-27876444-C-T p.Arg728Gln missense AHDC1 8 82292 9.72148E-5 41146 0 1.9118E-4
1-27876445-G-A p.Arg728Trp missense AHDC1 4 82154 4.8689E-5 41077 0 1.27665E-4
1-27876460-G-A p.Pro723Ser missense AHDC1 7 82010 8.53554E-5 41005 0 4.81769E-5
1-27876461-G-A p.His722His synonymous AHDC1 2 82000 2.43902E-5 41000 0 NA
1-27876480-C-T p.Gly716Asp missense AHDC1 2 81746 2.4466E-5 40873 0 8.49502E-6
1-27876482-C-A p.Pro715Pro synonymous AHDC1 53436 80384 0.664759 40192 18093 0.707391
1-27876482-C-T p.Pro715Pro synonymous AHDC1 2 81628 2.45014E-5 40814 0 NA
1-27876485-G-A p.Gly714Gly synonymous AHDC1 3 81370 3.68686E-5 40685 0 3.19142E-5
1-27876486-C-G p.Gly714Ala missense AHDC1 2 81410 2.4567E-5 40705 0 3.46284E-5
1-27876490-C-T p.Gly713Arg missense AHDC1 4 81354 4.91678E-5 40677 0 1.23277E-5
1-27876491-G-A p.Val712Val synonymous AHDC1 1 81244 1.23086E-5 40622 0 1.04168E-4
1-27876498-G-A p.Ala710Val missense AHDC1 1 81120 1.23274E-5 40560 0 NA
1-27876500-G-A p.Ala709Ala synonymous AHDC1 7 81092 8.63217E-5 40546 0 9.58405E-5
1-27876508-C-T p.Val707Met missense AHDC1 8 80848 9.89511E-5 40424 0 9.55475E-5
1-27876509-G-A p.Ala706Ala synonymous AHDC1 1 80690 1.23931E-5 40345 0 1.75867E-5
1-27876510-GCCA-G p.Val705del disruptive_inframe_deletion AHDC1 2 80718 2.47776E-5 40359 0 3.18613E-5
1-27876521-C-T p.Lys702Lys synonymous AHDC1 10 80840 1.23701E-4 40420 0 0.00403633
1-27876521-CTTT-C p.Lys702del disruptive_inframe_deletion AHDC1 1 80840 1.23701E-5 40420 0 8.2927E-6
1-27876533-G-A p.Ile698Ile synonymous AHDC1 1 80616 1.24045E-5 40308 0 3.18674E-5
1-27876538-C-T p.Gly697Ser missense AHDC1 1 80664 1.23971E-5 40332 0 NA
1-27876545-G-T p.Phe694Leu missense AHDC1 4 80824 4.94902E-5 40412 0 5.36374E-5
1-27876564-C-T p.Arg688Gln missense AHDC1 2 80850 2.47372E-5 40425 0 7.95714E-5
1-27876574-T-G p.Lys685Gln missense AHDC1 1 80958 1.23521E-5 40479 0 NA
1-27876577-C-T p.Ala684Thr missense AHDC1 1 80956 1.23524E-5 40478 0 NA
1-27876578-C-T p.Ala683Ala synonymous AHDC1 7 80932 8.64924E-5 40466 0 6.17742E-5
1-27876579-G-A p.Ala683Val missense AHDC1 1 80894 1.23619E-5 40447 0 3.18695E-5
1-27876584-G-A p.Gly681Gly synonymous AHDC1 1 80848 1.23689E-5 40424 0 NA
1-27876587-C-T p.Gly680Gly synonymous AHDC1 1 81006 1.23448E-5 40503 0 NA
1-27876607-C-T p.Gly674Ser missense AHDC1 1 81270 1.23047E-5 40635 0 9.55475E-5
1-27876608-G-A p.Gly673Gly synonymous AHDC1 12 81222 1.47743E-4 40611 0 3.18593E-5
1-27876622-C-A p.Gly669Trp missense AHDC1 1 81306 1.22992E-5 40653 0 NA
1-27876625-G-A p.Arg668Cys missense AHDC1 1 81284 1.23025E-5 40642 0 3.18634E-5
1-27876630-C-T p.Arg666Gln missense AHDC1 1 81340 1.22941E-5 40670 0 3.45322E-5
1-27876631-G-C p.Arg666Gly missense AHDC1 2 81354 2.45839E-5 40677 0 3.25799E-5
1-27876643-C-T p.Val662Met missense AHDC1 2 81358 2.45827E-5 40679 0 8.57456E-6
1-27876645-C-T p.Arg661His missense AHDC1 2 81330 2.45912E-5 40665 0 1.714E-5
1-27876654-A-C p.Phe658Cys missense AHDC1 1 81266 1.23053E-5 40633 0 4.03956E-6
1-27876675-T-C p.Asp651Gly missense AHDC1 1 81224 1.23116E-5 40612 0 NA
1-27876677-G-A p.Pro650Pro synonymous AHDC1 1 81338 1.22944E-5 40669 0 5.03525E-4
1-27876680-G-A p.Ala649Ala synonymous AHDC1 1 81326 1.22962E-5 40663 0 8.40958E-6
1-27876692-C-T p.Ser645Ser synonymous AHDC1 1 81374 1.22889E-5 40687 0 2.00452E-5
1-27876699-G-A p.Pro643Leu missense AHDC1 1 81546 1.2263E-5 40773 0 NA
1-27876742-C-T p.Ala629Thr missense AHDC1 4 82250 4.86322E-5 41125 0 3.18532E-5
1-27876756-C-T p.Arg624His missense AHDC1 1 82378 1.21392E-5 41189 0 8.25873E-6
1-27876757-G-A p.Arg624Cys missense AHDC1 3 82408 3.64042E-5 41204 0 1.99232E-5
1-27876776-G-A p.Ala617Ala synonymous AHDC1 3 82664 3.62915E-5 41332 0 NA
1-27876778-C-A p.Ala617Ser missense AHDC1 1 82670 1.20963E-5 41335 0 NA
1-27876779-C-T p.Leu616Leu synonymous AHDC1 1 82700 1.20919E-5 41350 0 1.98999E-5
1-27876785-G-A p.Asp614Asp synonymous AHDC1 11 82778 1.32886E-4 41389 0 3.8219E-4
1-27876788-T-C p.Ser613Ser synonymous AHDC1 1 82864 1.2068E-5 41432 0 NA
1-27876797-G-A p.Ala610Ala synonymous AHDC1 1 82930 1.20584E-5 41465 0 8.24633E-6
1-27876815-G-A p.Asp604Asp synonymous AHDC1 8 83018 9.63646E-5 41509 0 4.94666E-5
1-27876823-C-T p.Ala602Thr missense AHDC1 2 83060 2.4079E-5 41530 0 NA
1-27876830-T-C p.Pro599Pro synonymous AHDC1 1 83068 1.20383E-5 41534 0 NA
1-27876840-G-A p.Ser596Phe missense AHDC1 2 83066 2.40772E-5 41533 0 1.64897E-5
1-27876854-C-T p.Lys591Lys synonymous AHDC1 6 83026 7.22665E-5 41513 0 7.95577E-6
1-27876855-T-G p.Lys591Thr missense AHDC1 2 83022 2.409E-5 41511 0 3.97788E-6
1-27876859-G-A p.Arg590Trp missense AHDC1 1 82992 1.20494E-5 41496 0 NA
1-27876861-C-T p.Arg589Gln missense AHDC1 1 82994 1.20491E-5 41497 0 5.04032E-4
1-27876865-G-A p.Arg588Trp missense AHDC1 1 82974 1.2052E-5 41487 0 NA
1-27876870-T-C p.Lys586Arg missense AHDC1 1 83000 1.20482E-5 41500 0 1.59144E-5
1-27876883-G-A p.Pro582Ser missense AHDC1 1 82870 1.20671E-5 41435 0 8.27773E-6
1-27876884-C-T p.Met581Ile missense AHDC1 1 82882 1.20653E-5 41441 0 3.18593E-5
1-27876885-A-G p.Met581Thr missense AHDC1 1 82874 1.20665E-5 41437 0 NA
1-27876894-G-A p.Thr578Ile missense AHDC1 1 82742 1.20858E-5 41371 0 NA
1-27876895-T-TGGCCGCTGCCACAGTGGCTGCCTCGGC p.Ala577_Thr578insAlaGluAlaAlaThrValAlaAlaAla conservative_inframe_insertion AHDC1 1 82722 1.20887E-5 41361 0 NA
1-27876899-C-T p.Ala576Ala synonymous AHDC1 20 82680 2.41896E-4 41340 0 0.0015121
1-27876899-CGCTGCCACAGTGGCT-C p.Ala572_Ala576del disruptive_inframe_deletion AHDC1 1 82680 1.20948E-5 41340 0 NA
1-27876900-G-A p.Ala576Val missense AHDC1 4 82586 4.84344E-5 41293 0 3.18674E-5
1-27876907-C-A p.Val574Leu missense AHDC1 4 82674 4.83828E-5 41337 1 0.00100806
1-27876907-C-G p.Val574Leu missense AHDC1 1 82674 1.20957E-5 41337 0 8.40025E-6
1-27876916-C-T p.Ala571Thr missense AHDC1 2 82512 2.42389E-5 41256 0 3.18634E-5
1-27876919-C-T p.Glu570Lys missense AHDC1 4 82428 4.85272E-5 41214 0 8.53373E-6
1-27876920-G-A p.Ala569Ala synonymous AHDC1 3 82386 3.6414E-5 41193 0 8.47429E-6
1-27876922-C-T p.Ala569Thr missense AHDC1 1 82428 1.21318E-5 41214 0 NA
1-27876923-C-T p.Ala568Ala synonymous AHDC1 4 82458 4.85095E-5 41229 0 8.44866E-6
1-27876924-G-A p.Ala568Val missense AHDC1 6 82406 7.28102E-5 41203 0 3.21554E-5
1-27876938-C-T p.Glu563Glu synonymous AHDC1 1 82390 1.21374E-5 41195 0 NA
1-27876952-C-T p.Gly559Ser missense AHDC1 3 82212 3.6491E-5 41106 0 6.37227E-5
1-27876953-G-A p.Pro558Pro synonymous AHDC1 3 82222 3.64866E-5 41111 0 6.25E-4
1-27876956-A-G p.Gly557Gly synonymous AHDC1 1 82208 1.21643E-5 41104 0 3.18715E-5
1-27876965-C-T p.Leu554Leu synonymous AHDC1 2 82090 2.43635E-5 41045 0 NA
1-27877007-G-A p.Pro540Pro synonymous AHDC1 10 81044 1.2339E-4 40522 0 0.0025
1-27877019-G-A p.Pro536Pro synonymous AHDC1 65 80856 8.03898E-4 40428 0 0.00352467
1-27877049-A-G p.Asn526Asn synonymous AHDC1 1 81576 1.22585E-5 40788 0 6.79294E-5
1-27877061-C-T p.Lys522Lys synonymous AHDC1 2 81816 2.44451E-5 40908 0 2.49542E-5
1-27877070-C-T p.Pro519Pro synonymous AHDC1 1 81774 1.22288E-5 40887 0 6.36862E-5
1-27877071-G-C p.Pro519Arg missense AHDC1 1 81872 1.22142E-5 40936 0 3.99422E-6
1-27877071-G-A p.Pro519Leu missense AHDC1 1 81872 1.22142E-5 40936 0 8.31753E-6
1-27877073-G-C p.Thr518Thr synonymous AHDC1 2 81874 2.44278E-5 40937 0 NA
1-27877076-G-A p.Pro517Pro synonymous AHDC1 1 81938 1.22043E-5 40969 0 NA
1-27877086-G-A p.Ser514Leu missense AHDC1 2 82044 2.43772E-5 41022 0 6.25E-4
1-27877090-C-T p.Val513Met missense AHDC1 2 82114 2.43564E-5 41057 0 4.16625E-5
1-27877090-C-A p.Val513Leu missense AHDC1 3 82114 3.65346E-5 41057 0 3.1841E-5
1-27877091-G-A p.Arg512Arg synonymous AHDC1 8 82098 9.74445E-5 41049 0 1.59205E-4
1-27877092-C-T p.Arg512His missense AHDC1 2 82092 2.43629E-5 41046 0 NA
1-27877104-T-C p.Glu508Gly missense AHDC1 1 82128 1.21761E-5 41064 0 8.35785E-6
1-27877106-C-T p.Lys507Lys synonymous AHDC1 1 82148 1.21732E-5 41074 0 3.9901E-6
1-27877112-C-A p.Glu505Asp missense AHDC1 2 82134 2.43505E-5 41067 0 NA
1-27877115-C-T p.Val504Val synonymous AHDC1 1 82096 1.21809E-5 41048 0 6.36862E-5
1-27877117-C-T p.Val504Met missense AHDC1 151 82066 0.00183998 41033 0 0.00181287
1-27877118-G-A p.Ser503Ser synonymous AHDC1 1 82052 1.21874E-5 41026 0 1.19796E-5
1-27877142-C-T p.Val495Val synonymous AHDC1 3 81938 3.6613E-5 40969 0 2.55471E-5
1-27877168-G-T p.Arg487Arg synonymous AHDC1 2 81300 2.46002E-5 40650 0 8.99572E-6
1-27877175-C-T p.Ser484Ser synonymous AHDC1 1 81234 1.23101E-5 40617 0 9.21931E-6
1-27877180-C-T p.Val483Ile missense AHDC1 6 81112 7.39718E-5 40556 0 2.2293E-4
1-27877181-G-A p.Pro482Pro synonymous AHDC1 6 81066 7.40138E-5 40533 0 0.00151515
1-27877184-G-T p.Ile481Ile synonymous AHDC1 2 80956 2.47048E-5 40478 0 1.91022E-5
1-27877209-C-T p.Arg473His missense AHDC1 1 80144 1.24775E-5 40072 0 4.80573E-5
1-27877210-G-A p.Arg473Cys missense AHDC1 2 80064 2.498E-5 40032 0 1.20453E-5
1-27877216-C-T p.Val471Met missense AHDC1 509 79838 0.00637541 39919 3 0.00806686
1-27877216-C-A p.Val471Leu missense AHDC1 1 79870 1.25203E-5 39935 0 NA
1-27877217-G-A p.Gly470Gly synonymous AHDC1 290 79736 0.003637 39868 2 0.0070086
1-27877221-C-T p.Arg469Gln missense AHDC1 2 79616 2.51206E-5 39808 0 3.18634E-5
1-27877221-C-A p.Arg469Leu missense AHDC1 1 79616 1.25603E-5 39808 0 NA
1-27877230-C-G p.Gly466Ala missense AHDC1 1 79142 1.26355E-5 39571 0 4.42149E-6
1-27877236-C-A p.Arg464Leu missense AHDC1 3 78610 3.81631E-5 39305 0 1.8311E-5
1-27877237-G-A p.Arg464Cys missense AHDC1 1 78600 1.27226E-5 39300 0 1.83466E-5
1-27877252-G-C p.Pro459Ala missense AHDC1 1 77458 1.29102E-5 38729 0 5.09424E-6
1-27877253-G-A p.Thr458Thr synonymous AHDC1 2 77342 2.58592E-5 38671 0 7.26568E-5
1-27877254-G-C p.Thr458Ser missense AHDC1 1 77226 1.2949E-5 38613 0 5.14118E-6
1-27877268-C-T p.Pro453Pro synonymous AHDC1 3 75372 3.98026E-5 37686 0 1.27159E-4
1-27877269-G-A p.Pro453Leu missense AHDC1 3 74992 4.00043E-5 37496 0 2.42101E-4
1-27877271-C-T p.Lys452Lys synonymous AHDC1 2 74620 2.68025E-5 37310 0 9.19907E-5
1-27877280-T-C p.Pro449Pro synonymous AHDC1 1 73192 1.36627E-5 36596 0 5.64481E-6
1-27877291-C-A p.Val446Phe missense AHDC1 1 70744 1.41355E-5 35372 0 5.8288E-6
1-27877291-C-T p.Val446Ile missense AHDC1 2 70744 2.82709E-5 35372 0 3.67999E-5
1-27877292-C-T p.Pro445Pro synonymous AHDC1 1 70318 1.42211E-5 35159 0 3.18735E-5
1-27877293-G-C p.Pro445Arg missense AHDC1 1 70192 1.42466E-5 35096 0 NA
1-27877293-G-A p.Pro445Leu missense AHDC1 1 70192 1.42466E-5 35096 0 7.76096E-5
1-27877301-G-A p.Gly442Gly synonymous AHDC1 666 68328 0.0097471 34164 6 0.0101833
1-27877312-C-T p.Ala439Thr missense AHDC1 1 65870 1.51814E-5 32935 0 2.38775E-5
1-27877317-G-A p.Pro437Leu missense AHDC1 1 65662 1.52295E-5 32831 0 NA
1-27877319-T-A p.Pro436Pro synonymous AHDC1 1 64712 1.54531E-5 32356 0 3.20164E-5
1-27877320-G-A p.Pro436Leu missense AHDC1 2 64970 3.07834E-5 32485 0 NA
1-27877321-G-A p.Pro436Ser missense AHDC1 1 64918 1.5404E-5 32459 0 NA
1-27877328-C-T p.Pro433Pro synonymous AHDC1 1 62620 1.59693E-5 31310 0 3.19489E-5
1-27877339-G-A p.Pro430Ser missense AHDC1 2 61628 3.24528E-5 30814 0 NA
1-27877346-G-C p.Ala427Ala synonymous AHDC1 4 60544 6.60677E-5 30272 0 8.65127E-5
1-27877346-G-A p.Ala427Ala synonymous AHDC1 1 60544 1.65169E-5 30272 0 2.16282E-4
1-27877354-C-A p.Ala425Ser missense AHDC1 1 60226 1.66041E-5 30113 0 4.05022E-5
1-27877354-C-T p.Ala425Thr missense AHDC1 1 60226 1.66041E-5 30113 0 1.14899E-5
1-27877361-C-T p.Leu422Leu synonymous AHDC1 2 60692 3.29533E-5 30346 0 3.76591E-5
1-27877363-GCCC-G p.Gly421del conservative_inframe_deletion AHDC1 1 60434 1.6547E-5 30217 0 3.69604E-5
1-27877367-C-T p.Thr420Thr synonymous AHDC1 4 60474 6.61441E-5 30237 0 3.53207E-5
1-27877368-G-A p.Thr420Met missense AHDC1 1 60628 1.6494E-5 30314 0 6.25E-4
1-27877392-C-T p.Arg412His missense AHDC1 399 60454 0.00660006 30227 3 0.0113617
1-27877393-G-A p.Arg412Cys missense AHDC1 1 60478 1.65349E-5 30239 0 1.0698E-4
1-27877404-C-T p.Gly408Glu missense AHDC1 1 60452 1.6542E-5 30226 0 NA
1-27877406-G-A p.Ala407Ala synonymous AHDC1 2 59836 3.34247E-5 29918 0 6.25E-4
1-27877418-G-A p.Arg403Arg synonymous AHDC1 4605 59480 0.077421 29740 213 0.119779
1-27877420-G-A p.Arg403Cys missense AHDC1 1 59614 1.67746E-5 29807 0 1.64301E-5
1-27877422-C-A p.Gly402Val missense AHDC1 1 59904 1.66934E-5 29952 0 NA
1-27877425-C-T p.Arg401Gln missense AHDC1 1 59506 1.6805E-5 29753 0 1.56838E-5
1-27877437-C-T p.Arg397Gln missense AHDC1 4 58620 6.82361E-5 29310 0 3.20026E-5
1-27877440-C-T p.Arg396Gln missense AHDC1 1 58116 1.7207E-5 29058 0 7.14082E-5
1-27877443-C-T p.Arg395His missense AHDC1 1 57538 1.73798E-5 28769 0 3.18959E-5
1-27877451-G-C p.Ile392Met missense AHDC1 1 57370 1.74307E-5 28685 0 NA
1-27877455-T-C p.Lys391Arg missense AHDC1 2 57040 3.50631E-5 28520 0 8.1281E-5
1-27877468-T-C p.Thr387Ala missense AHDC1 1 55972 1.78661E-5 27986 0 3.18796E-5
1-27877470-C-T p.Arg386His missense AHDC1 2 55378 3.61154E-5 27689 0 NA
1-27877471-G-T p.Arg386Ser missense AHDC1 8 55088 1.45222E-4 27544 0 1.59378E-4
1-27877473-C-T p.Arg385Gln missense AHDC1 1 54992 1.81845E-5 27496 0 4.22167E-5
1-27877480-C-T p.Ala383Thr missense AHDC1 1 54750 1.82648E-5 27375 0 7.16025E-5
1-27877481-G-A p.Tyr382Tyr synonymous AHDC1 3 54766 5.47785E-5 27383 0 4.03005E-4
1-27877485-T-C p.Lys381Arg missense AHDC1 3 54748 5.47965E-5 27374 0 NA
1-27877496-C-T p.Glu377Glu synonymous AHDC1 1 54230 1.844E-5 27115 0 4.91618E-6
1-27877497-T-C p.Glu377Gly missense AHDC1 1 54112 1.84802E-5 27056 0 NA
1-27877504-C-T p.Gly375Arg missense AHDC1 1 53446 1.87105E-5 26723 0 8.53971E-5
1-27877504-C-CG p.Gly375fs frameshift AHDC1 1 53446 1.87105E-5 26723 0 8.59762E-5
1-27877505-G-A p.Pro374Pro synonymous AHDC1 2 53372 3.74728E-5 26686 0 6.91754E-5
1-27877511-G-A p.Gly372Gly synonymous AHDC1 1 53232 1.87857E-5 26616 0 3.331E-5
1-27877512-C-G p.Gly372Ala missense AHDC1 1 53174 1.88062E-5 26587 0 1.66561E-5
1-27877513-C-T p.Gly372Ser missense AHDC1 2 53192 3.75996E-5 26596 0 0.00151668
1-27877517-C-T p.Pro370Pro synonymous AHDC1 3 53270 5.63169E-5 26635 0 6.85025E-5
1-27877522-A-G p.Ser369Pro missense AHDC1 1 53714 1.86171E-5 26857 0 NA
1-27877536-C-T p.Arg364His missense AHDC1 2 53214 3.75841E-5 26607 0 1.80982E-5
1-27877537-G-A p.Arg364Cys missense AHDC1 1 53538 1.86783E-5 26769 0 6.25782E-4
1-27877543-G-A p.Pro362Ser missense AHDC1 1 54088 1.84884E-5 27044 0 NA
1-27877546-C-T p.Glu361Lys missense AHDC1 4 54028 7.40357E-5 27014 0 1.29803E-4
1-27877547-G-A p.Ala360Ala synonymous AHDC1 2 54072 3.69877E-5 27036 0 0.00101523
1-27877554-G-A p.Pro358Leu missense AHDC1 1 55004 1.81805E-5 27502 0 1.13549E-5
1-27877555-G-A p.Pro358Ser missense AHDC1 7 55008 1.27254E-4 27504 0 1.13357E-4
1-27877587-C-T p.Arg347His missense AHDC1 1 56620 1.76616E-5 28310 0 2.25553E-5
1-27877588-G-A p.Arg347Cys missense AHDC1 1 56632 1.76579E-5 28316 0 2.06313E-5
1-27877590-C-T p.Arg346His missense AHDC1 2 56570 3.53544E-5 28285 0 0.0015213
1-27877591-G-A p.Arg346Cys missense AHDC1 1 57216 1.74776E-5 28608 0 2.05719E-5
1-27877601-G-C p.Asp342Glu missense AHDC1 12 58748 2.04262E-4 29374 0 8.5482E-5
1-27877601-G-A p.Asp342Asp synonymous AHDC1 2 58748 3.40437E-5 29374 0 3.19693E-5
1-27877614-G-C p.Pro338Arg missense AHDC1 2 60768 3.29121E-5 30384 0 5.04566E-6
1-27877615-G-A p.Pro338Ser missense AHDC1 2 60766 3.29131E-5 30383 0 NA
1-27877616-C-T p.Leu337Leu synonymous AHDC1 2 60682 3.29587E-5 30341 0 3.19611E-5
1-27877619-G-T p.Pro336Pro synonymous AHDC1 8 61424 1.30242E-4 30712 0 6.0699E-4
1-27877620-G-C p.Pro336Arg missense AHDC1 1 61492 1.62623E-5 30746 0 NA
1-27877625-G-A p.Leu334Leu synonymous AHDC1 2 62454 3.20236E-5 31227 0 6.25782E-4
1-27877639-C-G p.Asp330His missense AHDC1 2 65850 3.03721E-5 32925 0 NA
1-27877643-C-A p.Leu328Leu synonymous AHDC1 2 66786 2.99464E-5 33393 0 1.95656E-4
1-27877646-C-T p.Gln327Gln synonymous AHDC1 1 67758 1.47584E-5 33879 0 NA
1-27877649-C-T p.Ser326Ser synonymous AHDC1 2 68544 2.91783E-5 34272 0 6.28773E-5
1-27877661-G-A p.Asp322Asp synonymous AHDC1 1 72476 1.37977E-5 36238 0 1.43345E-5
1-27877697-C-T p.Pro310Pro synonymous AHDC1 5 76798 6.51059E-5 38399 0 5.70438E-5
1-27877753-C-T p.Gly292Arg missense AHDC1 1 79388 1.25964E-5 39694 0 5.05561E-4
1-27877757-C-T p.Pro290Pro synonymous AHDC1 38 79382 4.78698E-4 39691 0 5.10454E-4
1-27877766-T-C p.Ala287Ala synonymous AHDC1 2 79768 2.50727E-5 39884 0 4.13538E-6
1-27877772-C-T p.Pro285Pro synonymous AHDC1 1 79826 1.25272E-5 39913 0 4.13445E-6
1-27877792-G-C p.Gln279Glu missense AHDC1 1 80212 1.2467E-5 40106 0 4.10324E-6
1-27877794-G-C p.Pro278Arg missense AHDC1 1 80186 1.2471E-5 40093 0 NA
1-27877795-G-A p.Pro278Ser missense AHDC1 404 80156 0.00504017 40078 4 0.0110339
1-27877801-G-A p.Leu276Leu synonymous AHDC1 1 80392 1.2439E-5 40196 0 NA
1-27877811-C-T p.Glu272Glu synonymous AHDC1 14 80656 1.73577E-4 40328 0 1.91412E-4
1-27877815-G-A p.Pro271Leu missense AHDC1 1 80676 1.23953E-5 40338 0 2.85523E-5
1-27877816-G-C p.Pro271Ala missense AHDC1 95 80734 0.0011767 40367 0 0.00280648
1-27877820-G-A p.Pro269Pro synonymous AHDC1 2 80822 2.47457E-5 40411 0 1.13179E-4
1-27877824-G-A p.Ser268Leu missense AHDC1 5 80904 6.18016E-5 40452 0 6.25E-4
1-27877834-C-G p.Glu265Gln missense AHDC1 1 81088 1.23323E-5 40544 0 1.72372E-5
1-27877840-C-T p.Ala263Thr missense AHDC1 5 81192 6.15824E-5 40596 0 5.13224E-5
1-27877845-G-A p.Ala261Val missense AHDC1 32 81446 3.92898E-4 40723 0 1.9129E-4
1-27877850-T-C p.Leu259Leu synonymous AHDC1 2 81542 2.45272E-5 40771 0 NA
1-27877856-C-T p.Gln257Gln synonymous AHDC1 7 81624 8.57591E-5 40812 0 3.64018E-4
1-27877856-C-G p.Gln257His missense AHDC1 1 81626 1.2251E-5 40813 0 NA
1-27877870-A-C p.Cys253Gly missense AHDC1 1 81802 1.22246E-5 40901 0 NA
1-27877876-G-C p.Leu251Val missense AHDC1 1 81928 1.22058E-5 40964 0 NA
1-27877901-G-A p.Ala242Ala synonymous AHDC1 34 81962 4.14826E-4 40981 0 7.97499E-4
1-27877903-C-T p.Ala242Thr missense AHDC1 1 81926 1.22061E-5 40963 0 NA
1-27877904-G-A p.Asp241Asp synonymous AHDC1 2 81952 2.44045E-5 40976 0 3.18918E-5
1-27877916-T-G p.Ser237Ser synonymous AHDC1 1 81980 1.21981E-5 40990 0 3.99147E-6
1-27877927-T-C p.Thr234Ala missense AHDC1 1 81872 1.22142E-5 40936 0 8.30868E-6
1-27877929-C-T p.Ser233Asn missense AHDC1 3 81852 3.66515E-5 40926 0 3.18857E-5
1-27877932-T-C p.Asp232Gly missense AHDC1 1 81830 1.22205E-5 40915 0 NA
1-27877947-G-A p.Pro227Leu missense AHDC1 1 81450 1.22775E-5 40725 0 8.32071E-6
1-27877958-C-T p.Thr223Thr synonymous AHDC1 4 81048 4.93535E-5 40524 0 9.56572E-5
1-27877964-C-T p.Ala221Ala synonymous AHDC1 1 80900 1.23609E-5 40450 0 4.42193E-5
1-27877966-C-A p.Ala221Ser missense AHDC1 1 80866 1.23661E-5 40433 0 NA
1-27877970-C-T p.Thr219Thr synonymous AHDC1 58 80778 7.18017E-4 40389 0 7.64624E-4
1-27877974-G-A p.Ala218Val missense AHDC1 1 80694 1.23925E-5 40347 0 NA
1-27877978-C-T p.Gly217Arg missense AHDC1 2 80632 2.4804E-5 40316 0 3.34778E-5
1-27877987-G-A p.His214Tyr missense AHDC1 4 80518 4.96783E-5 40259 1 5.04032E-4
1-27877989-C-T p.Gly213Asp missense AHDC1 1 80466 1.24276E-5 40233 0 4.04132E-6
1-27877994-G-A p.Gly211Gly synonymous AHDC1 6 80324 7.46975E-5 40162 0 5.66765E-5
1-27878001-T-G p.Gln209Pro missense AHDC1 1 80236 1.24632E-5 40118 0 8.39335E-6
1-27878004-G-T p.Pro208His missense AHDC1 1 80196 1.24694E-5 40098 0 3.18837E-5
1-27878025-TCAGGC-T p.Pro200fs frameshift AHDC1 1 79732 1.2542E-5 39866 0 NA
1-27878031-TC-T p.Glu199fs frameshift AHDC1 1 79368 1.25995E-5 39684 0 NA
1-27878038-G-A p.Leu197Phe missense AHDC1 3 78874 3.80353E-5 39437 0 3.18776E-5
1-27878039-G-A p.Pro196Pro synonymous AHDC1 1 78806 1.26894E-5 39403 0 NA
1-27878043-T-C p.His195Arg missense AHDC1 1 78616 1.27201E-5 39308 0 NA
1-27878053-G-A p.Arg192Trp missense AHDC1 1 77308 1.29353E-5 38654 0 6.37877E-5
1-27878063-G-C p.Ala188Ala synonymous AHDC1 1 76650 1.30463E-5 38325 0 4.03779E-6
1-27878065-C-T p.Ala188Thr missense AHDC1 1 76272 1.3111E-5 38136 0 1.61688E-5
1-27878066-G-A p.His187His synonymous AHDC1 78 76290 0.00102241 38145 2 0.00191363
1-27878069-T-C p.Pro186Pro synonymous AHDC1 1 76106 1.31396E-5 38053 0 NA
1-27878072-G-A p.Thr185Thr synonymous AHDC1 1 75988 1.316E-5 37994 0 4.02946E-6
1-27878113-T-G p.Ser172Arg missense AHDC1 1 73740 1.35612E-5 36870 0 8.29463E-6
1-27878132-G-A p.Tyr165Tyr synonymous AHDC1 1 73206 1.36601E-5 36603 0 NA
1-27878138-T-C p.Leu163Leu synonymous AHDC1 62 72848 8.51087E-4 36424 0 0.00352467
1-27878141-G-A p.Asp162Asp synonymous AHDC1 1 72572 1.37794E-5 36286 0 NA
1-27878143-C-T p.Asp162Asn missense AHDC1 2 72068 2.77516E-5 36034 0 1.20575E-5
1-27878144-G-A p.Gly161Gly synonymous AHDC1 1011 71788 0.0140831 35894 102 0.0358541
1-27878146-C-T p.Gly161Ser missense AHDC1 5 71812 6.96262E-5 35906 0 1.27641E-4
1-27878147-G-A p.Pro160Pro synonymous AHDC1 94 71958 0.00130632 35979 0 0.00125
1-27878154-G-A p.Pro158Leu missense AHDC1 1 71446 1.39966E-5 35723 0 NA
1-27878157-G-A p.Ala157Val missense AHDC1 73 71300 0.00102384 35650 1 0.00252154
1-27878162-C-T p.Pro155Pro synonymous AHDC1 5293 70118 0.075487 35059 215 0.100201
1-27878163-G-A p.Pro155Leu missense AHDC1 1 70514 1.41816E-5 35257 0 NA
1-27878166-C-T p.Arg154His missense AHDC1 2 68808 2.90664E-5 34404 0 3.1957E-5
1-27878167-G-A p.Arg154Cys missense AHDC1 2 68984 2.89922E-5 34492 0 5.04032E-4
1-27878183-A-G p.Gly148Gly synonymous AHDC1 1 67922 1.47228E-5 33961 0 NA
1-27878185-C-T p.Gly148Ser missense AHDC1 1 67850 1.47384E-5 33925 0 NA
1-27878189-G-C p.Asp146Glu missense AHDC1 2 67652 2.95631E-5 33826 0 NA
1-27878199-A-G p.Val143Ala missense AHDC1 2 67098 2.98071E-5 33549 0 NA
1-27878206-T-C p.Ser141Gly missense AHDC1 1 66556 1.50249E-5 33278 0 NA
1-27878213-C-T p.Leu138Leu synonymous AHDC1 1 65812 1.51948E-5 32906 0 1.2107E-5
1-27878230-G-A p.Arg133Cys missense AHDC1 1 63596 1.57243E-5 31798 0 1.65972E-5
1-27878258-C-A p.Gln123His missense AHDC1 6 62310 9.62927E-5 31155 0 4.04816E-5
1-27878271-C-T p.Arg119Gln missense AHDC1 4 61580 6.49562E-5 30790 0 6.25E-4
1-27878279-C-T p.Val116Val synonymous AHDC1 1 61552 1.62464E-5 30776 0 8.3203E-6
1-27878283-C-T p.Arg115Gln missense AHDC1 1 61706 1.62059E-5 30853 0 6.39304E-5
1-27878287-C-T p.Gly114Arg missense AHDC1 5 61996 8.06504E-5 30998 0 8.11438E-6
1-27878304-C-T p.Arg108Gln missense AHDC1 3 61304 4.89364E-5 30652 0 0.00100705
1-27878317-C-T p.Gly104Ser missense AHDC1 3 61602 4.86997E-5 30801 0 8.46138E-6
1-27878323-C-T p.Gly102Arg missense AHDC1 4 61610 6.49245E-5 30805 0 2.46609E-5
1-27878324-G-A p.Val101Val synonymous AHDC1 10 61458 1.62713E-4 30729 0 5.09563E-5
1-27878334-G-C p.Pro98Arg missense AHDC1 1 62518 1.59954E-5 31259 0 NA
1-27878340-C-T p.Arg96His missense AHDC1 5 62156 8.04428E-5 31078 0 0.00100705
1-27878341-G-A p.Arg96Cys missense AHDC1 77 62596 0.00123011 31298 1 0.00249648
1-27878341-G-C p.Arg96Gly missense AHDC1 1 62598 1.5975E-5 31299 0 NA
1-27878342-G-A p.Ala95Ala synonymous AHDC1 3 62918 4.76811E-5 31459 0 4.11096E-6
1-27878367-C-T p.Arg87Gln missense AHDC1 1 62614 1.59709E-5 31307 0 1.7438E-5
1-27878378-C-T p.Pro83Pro synonymous AHDC1 3 63028 4.75979E-5 31514 0 9.20988E-5
1-27878378-C-A p.Pro83Pro synonymous AHDC1 1 63028 1.5866E-5 31514 0 6.25782E-4
1-27878379-G-C p.Pro83Arg missense AHDC1 3 63408 4.73126E-5 31704 0 3.84714E-4
1-27878386-C-G p.Asp81His missense AHDC1 1 64472 1.55106E-5 32236 0 4.18715E-6
1-27878402-T-C p.Pro75Pro synonymous AHDC1 3 64712 4.63593E-5 32356 0 3.25415E-4
1-27878403-G-A p.Pro75Leu missense AHDC1 1 64806 1.54307E-5 32403 0 NA
1-27878409-C-T p.Arg73His missense AHDC1 5 60524 8.26119E-5 30262 0 3.57932E-5
1-27878412-C-T p.Arg72Gln missense AHDC1 1 61848 1.61687E-5 30924 0 8.93017E-6
1-27878415-G-A p.Thr71Ile missense AHDC1 188 62682 0.00299927 31341 1 0.00419877
1-27878427-CGGCGTGGGGGTG-C p.Pro63_Arg66del disruptive_inframe_deletion AHDC1 1 62674 1.59556E-5 31337 0 3.33489E-5
1-27878428-G-C p.Arg67Gly missense AHDC1 1 62032 1.61207E-5 31016 0 NA
1-27878440-G-A p.Pro63Ser missense AHDC1 1 63994 1.56265E-5 31997 0 4.76826E-6
1-27878447-G-A p.Asn60Asn synonymous AHDC1 1 65862 1.51833E-5 32931 0 4.94555E-6
1-27878448-T-C p.Asn60Ser missense AHDC1 4 65146 6.14005E-5 32573 1 1.04518E-5
1-27878453-G-A p.Ser58Ser synonymous AHDC1 5 66220 7.55059E-5 33110 0 1.52204E-5
1-27878465-G-A p.Thr54Thr synonymous AHDC1 1 68272 1.46473E-5 34136 0 NA
1-27878477-C-T p.Lys50Lys synonymous AHDC1 2 68366 2.92543E-5 34183 0 3.70563E-5
1-27878481-T-C p.Asp49Gly missense AHDC1 1 68268 1.46482E-5 34134 0 NA
1-27878492-G-A p.Ala45Ala synonymous AHDC1 1 66658 1.5002E-5 33329 0 NA
1-27878497-G-A p.Pro44Ser missense AHDC1 1 66054 1.51391E-5 33027 0 NA
1-27878502-C-T p.Arg42Gln missense AHDC1 8 64540 1.23954E-4 32270 0 0.0012703
1-27878503-G-A p.Arg42Trp missense AHDC1 1 65472 1.52737E-5 32736 0 4.46239E-5
1-27878506-T-G p.Thr41Pro missense AHDC1 1 65020 1.53799E-5 32510 0 0.0113883
1-27878509-G-A p.Pro40Ser missense AHDC1 1 63610 1.57208E-5 31805 0 3.06373E-4
1-27878520-C-T p.Arg36Gln missense AHDC1 1 64484 1.55077E-5 32242 0 NA
1-27878523-G-C p.Pro35Arg missense AHDC1 1 71382 1.40091E-5 35691 0 NA
1-27878527-T-G p.Thr34Pro missense AHDC1 26 69272 3.75332E-4 34636 0 0.423077
1-27878528-G-C p.Pro33Pro synonymous AHDC1 3 71768 4.18014E-5 35884 0 NA
1-27878528-G-A p.Pro33Pro synonymous AHDC1 20 71764 2.78691E-4 35882 0 4.58716E-4
1-27878528-G-T p.Pro33Pro synonymous AHDC1 5 71766 6.96709E-5 35883 0 2.38789E-5
1-27878529-G-A p.Pro33Leu missense AHDC1 2 71866 2.78296E-5 35933 0 NA
1-27878530-G-A p.Pro33Ser missense AHDC1 1 71948 1.38989E-5 35974 0 NA
1-27878533-G-C p.Pro32Ala missense AHDC1 2 72016 2.77716E-5 36008 0 1.14098E-5
1-27878533-G-T p.Pro32Thr missense AHDC1 2 72016 2.77716E-5 36008 0 NA
1-27878536-C-T p.Gly31Ser missense AHDC1 1 72350 1.38217E-5 36175 0 NA
1-27878537-G-A p.Gly30Gly synonymous AHDC1 7 73050 9.58248E-5 36525 0 1.12798E-5
1-27878540-G-A p.Pro29Pro synonymous AHDC1 1 74152 1.34858E-5 37076 0 3.2352E-5
1-27878542-G-T p.Pro29Thr missense AHDC1 5 74508 6.71069E-5 37254 0 NA
1-27878559-C-T p.Arg23Gln missense AHDC1 7 75220 9.30604E-5 37610 0 5.48069E-4
1-27878569-C-T p.Asp20Asn missense AHDC1 2 75470 2.65006E-5 37735 0 3.83583E-5
1-27878584-C-T p.Val15Met missense AHDC1 2 75388 2.65294E-5 37694 0 NA
1-27878585-G-T p.Ala14Ala synonymous AHDC1 3 75446 3.97635E-5 37723 0 6.40861E-5
1-27878585-G-A p.Ala14Ala synonymous AHDC1 2 75446 2.6509E-5 37723 0 3.20431E-5
1-27878588-A-G p.Ser13Ser synonymous AHDC1 1 75466 1.3251E-5 37733 0 1.08263E-5
1-27878604-A-G p.Leu8Pro missense AHDC1 1 75414 1.32601E-5 37707 0 NA
1-27878611-G-T p.Gln6Lys missense AHDC1 1 75328 1.32753E-5 37664 0 NA
1-27878622-C-T p.Arg2His missense AHDC1 1 75144 1.33078E-5 37572 0 0.00116279
1-27878653-G-A c.-27C>T 5_prime_UTR_premature_start_codon_gain AHDC1 3 74452 4.02944E-5 37226 0 3.19632E-5
1-27878663-G-A c.-37C>T 5_prime_UTR_premature_start_codon_gain AHDC1 1 74100 1.34953E-5 37050 0 1.61488E-5
1-27878682-G-A c.-56C>T 5_prime_UTR_premature_start_codon_gain AHDC1 3 72812 4.1202E-5 36406 0 3.19734E-5
1-27878700-C-CCCTCGGCT c.-74-1_-74insAGCCGAGG splice_acceptor AHDC1 1 70882 1.4108E-5 35441 0 NA
1-27879401-A-G c.-75+2T>C splice_donor AHDC1 1 44720 2.23614E-5 22360 0 NA
1-27879440-TCTGTGGGCAACAAGACGGGCAATAGATCTGAATTCCCCAAATGGTCTGGTGGCCACAGCTCAACCCCTGCCCACCGGCCCAGCCTCCTCCAGGTACCACCCCCGGCTCCCTCAGCGCTCTGTCCAGCGCAGACACCCGGCTGAC-T c.-113+1_-112-1del splice_acceptor AHDC1 1 44748 2.23474E-5 22374 0 NA
1-27879578-G-A c.-113+7C>T splice_region AHDC1 2 44608 4.4835E-5 22304 0 NA
1-27879578-G-C c.-113+7C>G splice_region AHDC1 1 44608 2.24175E-5 22304 0 1.59297E-4
1-27879686-G-A c.-214C>T 5_prime_UTR_premature_start_codon_gain AHDC1 1 44356 2.25449E-5 22178 0 3.18573E-5
1-27879695-G-A c.-223C>T splice_region AHDC1 1 44308 2.25693E-5 22154 0 NA
1-27879697-C-CT c.-224-2dupA splice_acceptor AHDC1 1 44310 2.25683E-5 22155 0 NA
1-27879698-T-TTGGCCTCCCAGTTCTCTGCTTCCACAGACTCC c.-224-3_-224-2insGGAGTCTGTGGAAGCAGAGAACTGGGAGGCCA splice_region AHDC1 2 44318 4.51284E-5 22159 0 NA
1-27879700-G-A c.-224-4C>T splice_region AHDC1 9 44300 2.0316E-4 22150 0 4.14092E-4
1-27879776-G-A c.-304C>T 5_prime_UTR_premature_start_codon_gain AHDC1 3 40642 7.38153E-5 20321 0 NA
1-27879804-G-A c.-329-3C>T splice_region AHDC1 6 34494 1.73943E-4 17247 0 3.18431E-5
1-27885044-G-GAGCAGGCTGCGAAGATAGGCTGGGCTCAGCA c.-555-4_-555-3insTGCTGAGCCCAGCCTATCTTCGCAGCCTGCT splice_region AHDC1 1 2968 3.36927E-4 1484 0 NA
1-27885230-G-C c.-238C>G 5_prime_UTR_premature_start_codon_gain AHDC1 1 2970 3.367E-4 1485 0 NA
1-27885305-G-A c.-313C>T 5_prime_UTR_premature_start_codon_gain AHDC1 63 3042 0.0207101 1521 0 0.00946644
1-27885395-C-CGGAGTGCTGGGCTGCCGGCTCCGTGGGTCCGAGCCAGGCGAGGGGTTT c.-402-2_-402-1insAAACCCCTCGCCTGGCTCGGACCCACGGAGCCGGCAGCCCAGCACTCC splice_acceptor AHDC1 3 2954 0.00101557 1477 1 NA
1-27885395-C-CGGAG c.-402-2_-402-1insCTCC splice_acceptor AHDC1 3 2954 0.00101557 1477 0 NA
1-27929908-C-T c.-403G>A splice_region AHDC1 1 8476 1.1798E-4 4238 0 6.39427E-5
1-27929910-G-A c.-405C>T splice_region AHDC1 2 8748 2.28624E-4 4374 0 NA
1-27929939-G-C c.-434C>G 5_prime_UTR_premature_start_codon_gain AHDC1 1 12376 8.08016E-5 6188 0 NA