Variant

Variant ID Consequence Effect Gene AC AN AF NS NHOM maxEAF
7-128864877-A-T c.-41A>T 5_prime_UTR_premature_start_codon_gain AHCYL2 2 76882 2.60139E-5 38441 0 2.02648E-4
7-128864895-C-T c.-23C>T 5_prime_UTR_premature_start_codon_gain AHCYL2 8 77154 1.03689E-4 38577 0 6.25782E-4
7-128864924-G-C p.Val3Leu missense AHCYL2 1 77258 1.29436E-5 38629 0 NA
7-128864928-A-G p.Gln4Arg missense AHCYL2 1 77282 1.29396E-5 38641 0 2.38243E-5
7-128864929-G-A p.Gln4Gln synonymous AHCYL2 1 77332 1.29313E-5 38666 0 NA
7-128864931-T-C p.Val5Ala missense AHCYL2 1 77294 1.29376E-5 38647 0 1.84412E-5
7-128864937-C-T p.Ser7Leu missense AHCYL2 1 77260 1.29433E-5 38630 0 4.61335E-6
7-128864940-C-G p.Ala8Gly missense AHCYL2 10 77282 1.29396E-4 38641 0 0.00102354
7-128864941-C-T p.Ala8Ala synonymous AHCYL2 1 77258 1.29436E-5 38629 0 NA
7-128864944-G-A p.Ala9Ala synonymous AHCYL2 1 77258 1.29436E-5 38629 0 9.13476E-6
7-128864961-C-G p.Pro15Arg missense AHCYL2 1 77226 1.2949E-5 38613 0 NA
7-128864974-G-A p.Leu19Leu synonymous AHCYL2 9 77136 1.16677E-4 38568 0 NA
7-128864997-C-A p.Ala27Glu missense AHCYL2 3 76734 3.90961E-5 38367 0 NA
7-128864997-C-T p.Ala27Val missense AHCYL2 1 76734 1.3032E-5 38367 0 1.8761E-5
7-128864998-G-A p.Ala27Ala synonymous AHCYL2 1 76764 1.30269E-5 38382 0 0.00255102
7-128865007-A-G p.Gln30Gln synonymous AHCYL2 1 76652 1.3046E-5 38326 0 1.95274E-5
7-128865010-A-G p.Leu31Leu synonymous AHCYL2 1 76594 1.30559E-5 38297 0 NA
7-128865015-T-A p.Leu33Gln missense AHCYL2 11 76460 1.43866E-4 38230 0 5.1282E-4
7-128865027-C-T p.Ala37Val missense AHCYL2 1 76124 1.31365E-5 38062 0 NA
7-128865033-G-A p.Gly39Asp missense AHCYL2 1 76098 1.31409E-5 38049 0 NA
7-128865041-G-GC p.Ala45fs frameshift AHCYL2 2 75830 2.63748E-5 37915 0 6.1654E-5
7-128865042-C-T p.Ala42Val missense AHCYL2 1 75848 1.31843E-5 37924 0 4.09679E-5
7-128865047-C-G p.Pro44Ala missense AHCYL2 1 75686 1.32125E-5 37843 0 3.25288E-5
7-128865047-C-A p.Pro44Thr missense AHCYL2 1 75686 1.32125E-5 37843 0 NA
7-128865048-C-A p.Pro44Gln missense AHCYL2 1 75570 1.32328E-5 37785 0 NA
7-128865050-G-A p.Ala45Thr missense AHCYL2 2 75434 2.65132E-5 37717 0 7.30034E-6
7-128865064-C-T p.Asp49Asp synonymous AHCYL2 1 74738 1.33801E-5 37369 0 NA
7-128865066-C-G p.Pro50Arg missense AHCYL2 2 74578 2.68176E-5 37289 0 1.91685E-5
7-128865080-C-G p.Pro55Ala missense AHCYL2 5 72840 6.86436E-5 36420 0 3.25945E-5
7-128865084-C-A p.Ala56Asp missense AHCYL2 1 72164 1.38573E-5 36082 0 6.93481E-4
7-128865085-C-T p.Ala56Ala synonymous AHCYL2 2 72020 2.77701E-5 36010 0 1.42183E-5
7-128865086-G-T p.Ala57Ser missense AHCYL2 4 71864 5.56607E-5 35932 0 6.93481E-4
7-128865089-G-C p.Glu58Gln missense AHCYL2 2 71614 2.79275E-5 35807 0 6.90608E-4
7-128865095-C-T p.Pro60Ser missense AHCYL2 3 70834 4.23525E-5 35417 0 0.0011139
7-128865098-C-T p.Pro61Ser missense AHCYL2 1 70632 1.41579E-5 35316 0 1.56755E-5
7-128865099-C-T p.Pro61Leu missense AHCYL2 1 70322 1.42203E-5 35161 0 NA
7-128865100-G-A p.Pro61Pro synonymous AHCYL2 4 70330 5.68747E-5 35165 0 NA
7-128865107-G-T p.Gly64Cys missense AHCYL2 1 69632 1.43612E-5 34816 0 NA
7-128865110-C-T p.Pro65Ser missense AHCYL2 5 69332 7.21168E-5 34666 0 6.53509E-5
7-128865112-G-T p.Pro65Pro synonymous AHCYL2 1 69250 1.44404E-5 34625 0 NA
7-128865123-C-T p.Pro69Leu missense AHCYL2 1 69238 1.44429E-5 34619 0 3.25119E-5
7-128865130-C-T p.Ala71Ala synonymous AHCYL2 19574 67916 0.288209 33958 2754 0.34273
7-128865140-C-G p.Pro75Ala missense AHCYL2 8 69634 1.14886E-4 34817 0 6.45494E-5
7-128865147-C-T p.Ala77Val missense AHCYL2 40 69498 5.75556E-4 34749 0 0.00154819
7-128865154-G-A p.Lys79Lys synonymous AHCYL2 1 69878 1.43107E-5 34939 0 9.6637E-5
7-128865162-A-C p.Gln82Pro missense AHCYL2 1 70342 1.42163E-5 35171 0 4.56955E-5
7-128865164-G-A p.Ala83Thr missense AHCYL2 30 70344 4.26476E-4 35172 0 3.21792E-4
7-128865172-C-T p.Ala85Ala synonymous AHCYL2 3 71106 4.21905E-5 35553 0 9.74089E-5
7-128865212-C-T p.Arg99Cys missense AHCYL2 3 74034 4.05219E-5 37017 0 6.40943E-5
7-128865227-G-T p.Ala104Ser missense AHCYL2 1 74832 1.33633E-5 37416 0 NA
7-128865234-T-G p.Val106Gly missense AHCYL2 1 75042 1.33259E-5 37521 0 8.67799E-6
7-128865244-C-T p.Asp109Asp synonymous AHCYL2 2 75306 2.65583E-5 37653 0 2.62794E-5
7-128865245-G-A p.Gly110Ser missense AHCYL2 1 75324 1.3276E-5 37662 0 3.19877E-5
7-128865250-C-G p.Thr111Thr synonymous AHCYL2 1 75376 1.32668E-5 37688 0 NA
7-128865251-G-A p.Val112Ile missense AHCYL2 14 75396 1.85686E-4 37698 0 0.00593972
7-128865259-G-A p.Glu114Glu synonymous AHCYL2 2 75502 2.64894E-5 37751 0 8.02568E-4
7-128923236-C-G p.Leu4Leu synonymous AHCYL2 1 8048 1.24254E-4 4024 0 3.18573E-5
7-128923254-T-A p.Phe10Leu missense AHCYL2 1 8046 1.24285E-4 4023 0 NA
7-129008095-C-T c.-241C>T 5_prime_UTR_premature_start_codon_gain AHCYL2 1 65472 1.52737E-5 32736 0 NA
7-129008130-C-T c.-206C>T 5_prime_UTR_premature_start_codon_gain AHCYL2 6 70314 8.53315E-5 35157 0 3.18532E-5
7-129008155-T-C c.-181T>C 5_prime_UTR_premature_start_codon_gain AHCYL2 1 75844 1.3185E-5 37922 0 NA
7-129008161-A-G c.-175A>G 5_prime_UTR_premature_start_codon_gain AHCYL2 2 76926 2.5999E-5 38463 0 NA
7-129008174-T-G c.-162T>G 5_prime_UTR_premature_start_codon_gain AHCYL2 1 78384 1.27577E-5 39192 0 NA
7-129008179-C-T c.-157C>T 5_prime_UTR_premature_start_codon_gain AHCYL2 2 78926 2.53402E-5 39463 0 1.59307E-4
7-129008229-C-T c.-107C>T 5_prime_UTR_premature_start_codon_gain AHCYL2 1 81434 1.22799E-5 40717 0 NA
7-129008302-T-C c.-34T>C 5_prime_UTR_premature_start_codon_gain AHCYL2 1 82586 1.21086E-5 41293 0 NA
7-129008350-C-T p.Asp5Asp synonymous AHCYL2 5 82596 6.05356E-5 41298 0 6.83071E-5
7-129008350-C-A p.Asp5Glu missense AHCYL2 1 82596 1.21071E-5 41298 0 NA
7-129008351-G-A p.Gly6Ser missense AHCYL2 5 82596 6.05356E-5 41298 0 6.25E-4
7-129008369-G-C p.Ala12Pro missense AHCYL2 8 82594 9.68593E-5 41297 0 5.03525E-4
7-129008370-C-G p.Ala12Gly missense AHCYL2 1 82592 1.21077E-5 41296 0 8.03568E-6
7-129008375-C-G p.His14Asp missense AHCYL2 1 82592 1.21077E-5 41296 0 8.31421E-6
7-129008380-G-A p.Met15Ile missense AHCYL2 1 82590 1.2108E-5 41295 0 8.31449E-6
7-129008387-T-G p.Trp18Gly missense AHCYL2 1 82582 1.21092E-5 41291 0 8.31463E-6
7-129008388-G-A p.Trp18* stop_gained AHCYL2 1 82582 1.21092E-5 41291 0 6.36943E-5
7-129015519-A-G c.-192A>G 5_prime_UTR_premature_start_codon_gain AHCYL2 1 59326 1.6856E-5 29663 0 3.18451E-5
7-129015691-G-A c.-20G>A 5_prime_UTR_premature_start_codon_gain AHCYL2 25 76314 3.27594E-4 38157 0 2.86606E-4
7-129015716-G-A p.Leu2Leu synonymous AHCYL2 1 76420 1.30856E-5 38210 0 3.18471E-5
7-129015720-A-C p.Ser4Arg missense AHCYL2 3 76420 3.92567E-5 38210 0 5.20191E-5
7-129015724-A-G p.Lys5Arg missense AHCYL2 1 76430 1.30839E-5 38215 0 3.18471E-5
7-129015724-A-C p.Lys5Thr missense AHCYL2 1 76430 1.30839E-5 38215 0 3.18471E-5
7-129015731-A-G p.Lys7Lys synonymous AHCYL2 3 76462 3.92352E-5 38231 0 3.18471E-5
7-129015734-C-A p.Tyr8* stop_gained AHCYL2 1 76450 1.30804E-5 38225 0 NA
7-129015743-TG-T p.Gly12fs frameshift AHCYL2 1 76430 1.30839E-5 38215 0 NA
7-129015745-G-A p.Gly12Asp missense AHCYL2 2 76420 2.61712E-5 38210 0 0.00132626
7-129015749-C-T p.Asn13Asn synonymous AHCYL2 1 76428 1.30842E-5 38214 0 NA
7-129015750-T-G p.Ser14Ala missense AHCYL2 9 76416 1.17776E-4 38208 0 5.94628E-5
7-129017385-A-G p.Lys15Arg missense+splice_region AHCYL2 1 52918 1.88972E-5 26459 0 NA
7-129017410-A-G p.Ser10Ser synonymous AHCYL2 15 53030 2.82859E-4 26515 0 0.00261535
7-129017423-G-A p.Val15Ile missense AHCYL2 2 53052 3.76989E-5 26526 0 7.03334E-5
7-129017436-A-G p.His19Arg missense AHCYL2 9 53074 1.69575E-4 26537 0 1.27413E-4
7-129017440-A-G p.Gln20Gln synonymous AHCYL2 5 53074 9.42081E-5 26537 0 7.30418E-6
7-129017448-T-A p.Ile23Asn missense AHCYL2 1 53058 1.88473E-5 26529 0 7.03829E-5
7-129017451-T-C p.Phe24Ser missense AHCYL2 2 53066 3.76889E-5 26533 0 NA
7-129017455-A-T p.Leu25Phe missense AHCYL2 1 53072 1.88423E-5 26536 0 7.30396E-6
7-129019476-T-C c.364-3T>C splice_region AHCYL2 1 82748 1.20849E-5 41374 0 NA
7-129019478-G-A c.364-1G>A splice_acceptor AHCYL2 1 82758 1.20834E-5 41379 0 1.24267E-4
7-129019492-C-T p.Ala126Val missense AHCYL2 1 82866 1.20677E-5 41433 0 NA
7-129019496-C-G p.Asp127Glu missense AHCYL2 2 82886 2.41295E-5 41443 0 6.37389E-5
7-129019499-G-A p.Gln128Gln synonymous AHCYL2 2 82906 2.41237E-5 41453 0 8.31628E-6
7-129019505-A-G p.Gln130Gln synonymous AHCYL2 2 82918 2.41202E-5 41459 0 3.98181E-6
7-129019523-C-T p.Pro136Pro synonymous AHCYL2 1 82904 1.20621E-5 41452 0 3.18715E-5
7-129019530-A-G p.Ile139Val missense AHCYL2 2 82898 2.4126E-5 41449 0 4.13887E-5
7-129019539-C-T p.Arg142Cys missense AHCYL2 1 82894 1.20636E-5 41447 0 7.9628E-6
7-129019552-G-A p.Arg146His missense AHCYL2 1 82818 1.20747E-5 41409 0 8.29807E-6
7-129019558-T-A p.Ile148Asn missense AHCYL2 1 82752 1.20843E-5 41376 0 3.98311E-6
7-129019577-C-A p.Asp154Glu missense AHCYL2 2 82616 2.42084E-5 41308 0 NA
7-129019584-A-T p.Ser157Cys missense AHCYL2 4 82502 4.84837E-5 41251 0 NA
7-129019589-A-G p.Ser158Ser splice_region+synonymous AHCYL2 1 82422 1.21327E-5 41211 0 1.68626E-5
7-129019590-G-GCGGCTTCATATACAGATAGCTCTGATGATGAGACATCGCCCA c.475_475+1insCGGCTTCATATACAGATAGCTCTGATGATGAGACATCGCCCA splice_donor AHCYL2 2 82424 2.42648E-5 41212 1 NA
7-129019594-A-C c.475+4A>C splice_region AHCYL2 2 82352 2.4286E-5 41176 0 8.01912E-6
7-129028897-C-T p.Ala159Val missense+splice_region AHCYL2 1 82988 1.20499E-5 41494 0 9.60123E-5
7-129028898-G-T p.Ala159Ala splice_region+synonymous AHCYL2 3 82982 3.61524E-5 41491 0 8.25832E-6
7-129028898-G-A p.Ala159Ala splice_region+synonymous AHCYL2 2 82982 2.41016E-5 41491 0 2.09291E-5
7-129028910-A-G p.Thr163Thr synonymous AHCYL2 2 83000 2.40964E-5 41500 0 1.59775E-5
7-129028913-T-C p.Asp164Asp synonymous AHCYL2 1 83008 1.2047E-5 41504 0 3.98886E-6
7-129028931-A-G p.Thr170Thr synonymous AHCYL2 2 83088 2.40709E-5 41544 0 NA
7-129028934-G-A p.Ser171Ser synonymous AHCYL2 2 83078 2.40738E-5 41539 0 5.77053E-5
7-129028943-C-G p.Asp174Glu missense AHCYL2 6 83146 7.21622E-5 41573 0 4.37982E-5
7-129028963-A-G p.Lys181Arg missense AHCYL2 2 83216 2.40338E-5 41608 0 3.18532E-5
7-129028969-G-A p.Ser183Asn missense AHCYL2 2 83228 2.40304E-5 41614 0 8.24212E-6
7-129028988-G-A p.Lys189Lys synonymous AHCYL2 1 83238 1.20137E-5 41619 0 8.24239E-6
7-129028992-A-G p.Ile191Val missense AHCYL2 1 83248 1.20123E-5 41624 0 3.18512E-5
7-129028995-A-G p.Lys192Glu missense AHCYL2 1 83248 1.20123E-5 41624 0 3.97912E-6
7-129029027-A-T p.Glu202Asp missense AHCYL2 2 83262 2.40206E-5 41631 0 NA
7-129029040-G-GAAATGCCT c.619_619+1insAAATGCCT splice_donor AHCYL2 1 83222 1.20161E-5 41611 0 NA
7-129029040-G-GAAATGCCTGCATTGATGGCTTTGA c.619_619+1insAAATGCCTGCATTGATGGCTTTGA splice_donor AHCYL2 2 83222 2.40321E-5 41611 1 NA
7-129029040-G-GAAATGCCTGCATTGATGGCTTTGAGGAAGAGA c.619_619+1insAAATGCCTGCATTGATGGCTTTGAGGAAGAGA splice_donor AHCYL2 2 83222 2.40321E-5 41611 1 NA
7-129029042-T-G c.619+2T>G splice_donor AHCYL2 1 83202 1.20189E-5 41601 0 NA
7-129029500-G-A p.Arg215Arg synonymous AHCYL2 1 82828 1.20732E-5 41414 0 8.33194E-6
7-129029504-A-C p.Arg217Arg synonymous AHCYL2 1 82848 1.20703E-5 41424 0 NA
7-129029542-C-T p.Ile229Ile synonymous AHCYL2 9 82892 1.08575E-4 41446 0 6.37227E-5
7-129029543-G-A p.Val230Met missense AHCYL2 2 82888 2.41289E-5 41444 0 3.98572E-6
7-129029566-T-C p.Ala237Ala synonymous AHCYL2 4 82802 4.8308E-5 41401 0 2.40612E-4
7-129029578-G-GCTTATGGAAACTCTGGGTGCTCTGGGGGCCCAGTGCCGATGGGCTGCC c.720+3_720+4insCTTATGGAAACTCTGGGTGCTCTGGGGGCCCAGTGCCGATGGGCTGCC splice_region AHCYL2 2 82660 2.41955E-5 41330 1 NA
7-129029578-G-GCTTATGGAAACTCTGGGTGCTCTGGGGGCCC c.720+3_720+4insCTTATGGAAACTCTGGGTGCTCTGGGGGCCC splice_region AHCYL2 2 82660 2.41955E-5 41330 1 NA
7-129029583-C-A c.720+8C>A splice_region AHCYL2 2 82568 2.42225E-5 41284 0 8.60237E-6
7-129037056-A-C c.721-7A>C splice_region AHCYL2 2 83138 2.40564E-5 41569 0 8.25955E-6
7-129037102-C-T p.Arg254* stop_gained AHCYL2 1 83076 1.20372E-5 41538 0 NA
7-129037103-G-A p.Arg254Gln missense AHCYL2 1 83076 1.20372E-5 41538 0 0.00151057
7-129037104-A-C p.Arg254Arg synonymous AHCYL2 11 83084 1.32396E-4 41542 0 0.00125
7-129037105-T-C p.Trp255Arg missense AHCYL2 1 83080 1.20366E-5 41540 0 NA
7-129037119-C-T p.Asn259Asn synonymous AHCYL2 1 83006 1.20473E-5 41503 0 3.1841E-5
7-129037146-T-A p.Ala268Ala synonymous AHCYL2 1 82850 1.207E-5 41425 0 NA
7-129037150-G-A p.Ala270Thr missense AHCYL2 1 82814 1.20753E-5 41407 0 NA
7-129037165-G-GGATTTCCTGTTTTTGCCTGGAAGGGAGA c.823_823+1insGATTTCCTGTTTTTGCCTGGAAGGGAGA splice_donor AHCYL2 2 82702 2.41832E-5 41351 1 NA
7-129037166-G-GA c.823+1_823+2insA splice_donor AHCYL2 4 82672 4.8384E-5 41336 2 NA
7-129040126-C-T c.824-5C>T splice_region AHCYL2 1 83254 1.20114E-5 41627 0 9.78218E-5
7-129040153-G-A p.Lys282Lys synonymous AHCYL2 472 83328 0.00566436 41664 5 0.00479423
7-129040159-G-A p.Glu182Glu splice_region+synonymous AHCYL2 2 83338 2.39987E-5 41669 0 3.29489E-5
7-129040186-C-T p.Ile293Ile synonymous AHCYL2 1 83356 1.19967E-5 41678 0 3.18939E-5
7-129040189-T-C p.Asp294Asp synonymous AHCYL2 1 83362 1.19959E-5 41681 0 2.47101E-5
7-129040195-T-C p.Cys296Cys synonymous AHCYL2 2 83358 2.39929E-5 41679 0 NA
7-129040225-G-GATCTTGGATGATGGAGGGGATCTTACCCACT c.918_918+1insATCTTGGATGATGGAGGGGATCTTACCCACT splice_donor AHCYL2 2 83292 2.40119E-5 41646 1 NA
7-129040225-G-GATCTT c.918_918+1insATCTT splice_donor AHCYL2 2 83292 2.40119E-5 41646 1 NA
7-129040225-G-GATCTTGGATGATGGAGGGGATCTTACCCACTGGATTTATAAAAA c.918_918+1insATCTTGGATGATGGAGGGGATCTTACCCACTGGATTTATAAAAA splice_donor AHCYL2 2 83292 2.40119E-5 41646 1 NA
7-129040232-C-G c.918+7C>G splice_region AHCYL2 1 83228 1.20152E-5 41614 0 NA
7-129043213-A-G c.919-7A>G splice_region AHCYL2 4 82702 4.83664E-5 41351 0 3.18512E-5
7-129043249-C-T p.His316His synonymous AHCYL2 1 83142 1.20276E-5 41571 0 NA
7-129043254-T-C p.Ile318Thr missense AHCYL2 2 83146 2.40541E-5 41573 0 4.808E-5
7-129043274-A-G p.Met325Val missense AHCYL2 1 83184 1.20215E-5 41592 0 8.27061E-6
7-129043282-G-A p.Lys327Lys synonymous AHCYL2 1 83192 1.20204E-5 41596 0 NA
7-129043295-A-G p.Ile332Val missense AHCYL2 1 83176 1.20227E-5 41588 0 4.00753E-6
7-129043295-A-T p.Ile332Leu missense AHCYL2 1 83176 1.20227E-5 41588 0 4.00753E-6
7-129043298-G-A p.Val333Ile missense AHCYL2 2 83166 2.40483E-5 41583 0 2.23862E-4
7-129043315-T-G p.Thr338Thr synonymous AHCYL2 3 83074 3.61124E-5 41537 0 8.33875E-6
7-129043327-G-GC c.1025+1_1025+2insC splice_donor AHCYL2 6 82900 7.23764E-5 41450 2 NA
7-129045019-C-A p.Asp369Glu missense AHCYL2 1 83048 1.20412E-5 41524 0 NA
7-129045042-C-A p.Ser377* stop_gained AHCYL2 1 82914 1.20607E-5 41457 0 NA
7-129045044-A-G p.Ile378Val missense AHCYL2 1 82870 1.20671E-5 41435 0 4.1448E-6
7-129045054-G-GACTTAAAAGGACAACAGACATGATGTTTGGTGGAAAGCAA c.1142_1142+1insACTTAAAAGGACAACAGACATGATGTTTGGTGGAAAGCAA splice_donor AHCYL2 4 82696 4.83699E-5 41348 1 NA
7-129045054-G-GACTTAAAAGGACAACAGACATGAT c.1142_1142+1insACTTAAAAGGACAACAGACATGAT splice_donor AHCYL2 2 82696 2.4185E-5 41348 1 NA
7-129045054-G-GACTTAAAAGGACAACAGACATGATGTTTGGTGGAAAGCAAGT c.1142_1142+1insACTTAAAAGGACAACAGACATGATGTTTGGTGGAAAGCAAGT splice_donor AHCYL2 1 82696 1.20925E-5 41348 0 NA
7-129045058-A-G c.1142+4A>G splice_region AHCYL2 10 82604 1.2106E-4 41302 0 6.80627E-4
7-129045669-T-C c.1143-8T>C splice_region AHCYL2 1 82622 1.21033E-5 41311 0 2.14221E-4
7-129045695-C-T p.Asp387Asp synonymous AHCYL2 1 83106 1.20328E-5 41553 0 NA
7-129045700-T-C p.Met389Thr missense AHCYL2 1 83124 1.20302E-5 41562 0 NA
7-129045742-T-A c.1206+2T>A splice_donor AHCYL2 1 83088 1.20354E-5 41544 0 NA
7-129045746-GTTTAACC-G c.1206+7_1206+13delTTTAACC splice_region AHCYL2 1 83040 1.20424E-5 41520 0 NA
7-129046233-C-T p.Cys407Cys synonymous AHCYL2 1 82872 1.20668E-5 41436 0 3.18573E-5
7-129046259-C-T p.Ser416Phe missense AHCYL2 1 83050 1.20409E-5 41525 0 NA
7-129046261-A-G p.Ile417Val missense AHCYL2 1 83028 1.20441E-5 41514 0 NA
7-129046266-G-A p.Val418Val synonymous AHCYL2 2 83044 2.40836E-5 41522 0 NA
7-129046268-A-G p.Tyr419Cys missense AHCYL2 5 83044 6.0209E-5 41522 0 NA
7-129046284-C-T p.Asp424Asp synonymous AHCYL2 2 83020 2.40906E-5 41510 0 NA
7-129046295-C-T p.Ala428Val missense AHCYL2 1 82960 1.2054E-5 41480 0 NA
7-129046296-C-T p.Ala428Ala synonymous AHCYL2 2 82956 2.41092E-5 41478 0 3.29478E-5
7-129046304-C-CCTGTATGGATGGATTTCGA p.Ile423fs frameshift AHCYL2 2 82902 2.41249E-5 41451 1 NA
7-129049311-C-T c.1296-6C>T splice_region AHCYL2 1 82934 1.20578E-5 41467 0 3.59152E-5
7-129049333-C-G p.Leu438Val missense AHCYL2 1 83032 1.20435E-5 41516 0 NA
7-129049334-T-C p.Leu438Pro missense AHCYL2 2 83044 2.40836E-5 41522 0 3.18451E-5
7-129049358-G-A p.Arg446Gln missense AHCYL2 2 83050 2.40819E-5 41525 0 NA
7-129049360-C-A p.Gln447Lys missense AHCYL2 2 83054 2.40807E-5 41527 0 NA
7-129049364-T-G p.Val448Gly missense AHCYL2 1 83038 1.20427E-5 41519 0 NA
7-129053441-A-G p.Lys458Arg missense AHCYL2 1 83090 1.20351E-5 41545 0 8.24103E-6
7-129053444-A-G p.Asn459Ser missense AHCYL2 1 83084 1.2036E-5 41542 0 3.97826E-6
7-129053450-T-C p.Val461Ala missense AHCYL2 3 83136 3.60855E-5 41568 0 8.23995E-6
7-129053470-C-T p.Arg468Cys missense AHCYL2 1 83178 1.20224E-5 41589 0 NA
7-129053471-G-A p.Arg468His missense AHCYL2 1 83178 1.20224E-5 41589 0 1.64772E-5
7-129053475-G-T p.Met469Ile missense AHCYL2 2 83212 2.4035E-5 41606 0 NA
7-129053483-G-A p.Ser472Asn missense AHCYL2 1 83194 1.20201E-5 41597 0 3.9781E-6
7-129053490-C-T p.Ile474Ile synonymous AHCYL2 3 83184 3.60646E-5 41592 0 6.36862E-5
7-129053491-G-A p.Val475Ile missense AHCYL2 2 83172 2.40466E-5 41586 0 3.2956E-5
7-129053505-A-C p.Gly479Gly synonymous AHCYL2 8 83134 9.62302E-5 41567 0 9.06379E-5
7-129053522-T-C p.Ile485Thr missense AHCYL2 1 82996 1.20488E-5 41498 0 8.24375E-6
7-129053526-C-T p.Asp486Asp synonymous AHCYL2 2 82962 2.41074E-5 41481 0 3.18552E-5
7-129053526-C-G p.Asp486Glu missense AHCYL2 1 82962 1.20537E-5 41481 0 3.98029E-6
7-129053527-G-A p.Val487Met missense+splice_region AHCYL2 1 82940 1.20569E-5 41470 0 NA
7-129053529-G-GGCGA c.1461_1461+1insGCGA splice_donor AHCYL2 1 82946 1.2056E-5 41473 0 NA
7-129053529-G-GGCGAGTCTGCGGACACCAGAACTGACCTGGGAGCGA c.1461_1461+1insGCGAGTCTGCGGACACCAGAACTGACCTGGGAGCGA splice_donor AHCYL2 1 82946 1.2056E-5 41473 0 NA
7-129062682-C-T p.Ala488Val missense+splice_region AHCYL2 2 83060 2.4079E-5 41530 0 3.58586E-5
7-129062683-G-A p.Ala488Ala splice_region+synonymous AHCYL2 1 83074 1.20375E-5 41537 0 3.98222E-5
7-129062722-A-G p.Arg501Arg synonymous AHCYL2 1 83126 1.20299E-5 41563 0 NA
7-129062728-A-G p.Gln503Gln synonymous AHCYL2 1 83134 1.20288E-5 41567 0 3.18471E-5
7-129062730-T-C p.Val504Ala missense AHCYL2 1 83124 1.20302E-5 41562 0 3.97779E-6
7-129062761-G-A p.Arg514Arg synonymous AHCYL2 2 82908 2.41231E-5 41454 0 8.24769E-6
7-129062768-C-T p.Leu517Leu synonymous AHCYL2 1 82782 1.20799E-5 41391 0 NA
7-129062772-T-C p.Leu518Pro missense AHCYL2 1 82698 1.20922E-5 41349 0 NA
7-129062773-G-T p.Leu518Leu synonymous AHCYL2 2 82676 2.41908E-5 41338 0 NA
7-129062784-G-A c.1560+5G>A splice_region AHCYL2 1 82314 1.21486E-5 41157 0 3.18492E-5
7-129064709-C-T c.1561-6C>T splice_region AHCYL2 1 82602 1.21062E-5 41301 0 NA
7-129064712-T-C c.1561-3T>C splice_region AHCYL2 1 82706 1.2091E-5 41353 0 1.98875E-5
7-129064718-C-T p.Arg522Cys missense AHCYL2 1 82862 1.20683E-5 41431 0 3.97741E-6
7-129064719-G-A p.Arg522His missense AHCYL2 1 82924 1.20592E-5 41462 0 8.23805E-6
7-129064730-C-T p.Leu526Phe missense AHCYL2 3 83154 3.60776E-5 41577 0 3.29506E-5
7-129064748-C-A p.Pro532Thr missense AHCYL2 2 83282 2.40148E-5 41641 0 8.23723E-6
7-129064753-A-T p.Thr533Thr synonymous AHCYL2 6 83306 7.20236E-5 41653 0 1.2747E-4
7-129064766-A-G p.Ile538Val missense AHCYL2 1 83308 1.20036E-5 41654 0 3.18492E-5
7-129064771-T-C p.Thr539Thr synonymous AHCYL2 1 83320 1.20019E-5 41660 0 8.23778E-6
7-129064781-CAGGTAAGGCTTCCAGAGTGGGATAGCAGTAGTCTGGAGAAGGTCCTCAGACCCACCAGGTTTCACTTGCTTGGGTAGATTGCCATGAATGGCACATCAGCATCCATCTCTCTGCTTTTCT-C p.Gln543fs frameshift AHCYL2 7 83334 8.39993E-5 41667 0 NA
7-129064784-G-A c.1629+1G>A splice_donor AHCYL2 1 83326 1.20011E-5 41663 0 NA
7-129064789-G-A c.1629+6G>A splice_region AHCYL2 4 83308 4.80146E-5 41654 0 3.29516E-5
7-129064789-G-T c.1629+6G>T splice_region AHCYL2 1 83308 1.20036E-5 41654 0 NA
7-129064927-C-T p.Tyr551Tyr synonymous AHCYL2 10 83248 1.20123E-4 41624 0 4.77737E-4
7-129064933-T-C p.Ala553Ala synonymous AHCYL2 1 83254 1.20114E-5 41627 0 NA
7-129064944-G-A p.Arg557His missense AHCYL2 1 83226 1.20155E-5 41613 0 3.18451E-5
7-129064952-C-T p.Gln560* stop_gained AHCYL2 1 83220 1.20163E-5 41610 0 NA
7-129064960-C-T p.Val562Val synonymous AHCYL2 2 83194 2.40402E-5 41597 0 NA
7-129066277-G-C c.1709-7G>C splice_region AHCYL2 2 83324 2.40027E-5 41662 0 8.23805E-6
7-129066384-C-T p.Pro603Pro synonymous AHCYL2 1 83322 1.20016E-5 41661 0 NA
7-129066393-T-G p.Pro606Pro synonymous AHCYL2 7 83296 8.40377E-5 41648 0 1.27453E-4
7-129066406-T-TATTAAGTTCCTGTAACTCAAACCAGAATTTTTAAGGAATAGAACTCCAA c.1829+2_1829+3insATTAAGTTCCTGTAACTCAAACCAGAATTTTTAAGGAATAGAACTCCAA splice_region AHCYL2 3 83254 3.60343E-5 41627 1 NA
7-129066873-C-T c.1830-7C>T splice_region AHCYL2 1 81428 1.22808E-5 40714 0 NA
7-129066876-C-G c.1830-4C>G splice_region AHCYL2 1 81462 1.22757E-5 40731 0 3.18776E-5
7-129067050-C-G c.*164C>G splice_region AHCYL2 2 69030 2.89729E-5 34515 0 NA
7-129067053-T-C c.*167T>C splice_region AHCYL2 18651 65108 0.286462 32554 2350 0.311697