Variant

Variant ID Consequence Effect Gene AC AN AF NS NHOM maxEAF
7-128864877-A-T c.-41A>T 5_prime_UTR_premature_start_codon_gain AHCYL2 2 75108 2.66283E-5 37554 0 2.02648E-4
7-128864895-C-T c.-23C>T 5_prime_UTR_premature_start_codon_gain AHCYL2 8 75304 1.06236E-4 37652 0 6.25782E-4
7-128864924-G-C p.Val3Leu missense AHCYL2 1 75360 1.32696E-5 37680 0 NA
7-128864928-A-G p.Gln4Arg missense AHCYL2 1 75382 1.32658E-5 37691 0 2.38243E-5
7-128864929-G-A p.Gln4Gln synonymous AHCYL2 1 75426 1.3258E-5 37713 0 NA
7-128864931-T-C p.Val5Ala missense AHCYL2 1 75394 1.32637E-5 37697 0 1.84412E-5
7-128864937-C-T p.Ser7Leu missense AHCYL2 1 75354 1.32707E-5 37677 0 4.61335E-6
7-128864940-C-G p.Ala8Gly missense AHCYL2 10 75376 1.32668E-4 37688 0 0.00102354
7-128864941-C-T p.Ala8Ala synonymous AHCYL2 1 75354 1.32707E-5 37677 0 NA
7-128864944-G-A p.Ala9Ala synonymous AHCYL2 1 75344 1.32725E-5 37672 0 9.13476E-6
7-128864961-C-G p.Pro15Arg missense AHCYL2 1 75308 1.32788E-5 37654 0 NA
7-128864974-G-A p.Leu19Leu synonymous AHCYL2 9 75218 1.19652E-4 37609 0 NA
7-128864997-C-A p.Ala27Glu missense AHCYL2 3 74832 4.00898E-5 37416 0 NA
7-128864997-C-T p.Ala27Val missense AHCYL2 1 74832 1.33633E-5 37416 0 1.8761E-5
7-128864998-G-A p.Ala27Ala synonymous AHCYL2 1 74856 1.3359E-5 37428 0 0.00255102
7-128865007-A-G p.Gln30Gln synonymous AHCYL2 1 74762 1.33758E-5 37381 0 1.95274E-5
7-128865010-A-G p.Leu31Leu synonymous AHCYL2 1 74714 1.33844E-5 37357 0 NA
7-128865015-T-A p.Leu33Gln missense AHCYL2 11 74602 1.47449E-4 37301 0 5.1282E-4
7-128865027-C-T p.Ala37Val missense AHCYL2 1 74310 1.34571E-5 37155 0 NA
7-128865033-G-A p.Gly39Asp missense AHCYL2 1 74288 1.34611E-5 37144 0 NA
7-128865041-G-GC p.Ala45fs frameshift AHCYL2 2 74052 2.7008E-5 37026 0 6.1654E-5
7-128865042-C-T p.Ala42Val missense AHCYL2 1 74068 1.35011E-5 37034 0 4.09679E-5
7-128865047-C-G p.Pro44Ala missense AHCYL2 1 73906 1.35307E-5 36953 0 3.25288E-5
7-128865047-C-A p.Pro44Thr missense AHCYL2 1 73906 1.35307E-5 36953 0 NA
7-128865048-C-A p.Pro44Gln missense AHCYL2 1 73796 1.35509E-5 36898 0 NA
7-128865050-G-A p.Ala45Thr missense AHCYL2 2 73678 2.71451E-5 36839 0 7.30034E-6
7-128865064-C-T p.Asp49Asp synonymous AHCYL2 1 72998 1.3699E-5 36499 0 NA
7-128865066-C-G p.Pro50Arg missense AHCYL2 2 72834 2.74597E-5 36417 0 1.91685E-5
7-128865080-C-G p.Pro55Ala missense AHCYL2 5 71102 7.03215E-5 35551 0 3.25945E-5
7-128865084-C-A p.Ala56Asp missense AHCYL2 1 70442 1.41961E-5 35221 0 6.93481E-4
7-128865085-C-T p.Ala56Ala synonymous AHCYL2 2 70294 2.84519E-5 35147 0 1.42183E-5
7-128865086-G-T p.Ala57Ser missense AHCYL2 1 70138 1.42576E-5 35069 0 6.93481E-4
7-128865089-G-C p.Glu58Gln missense AHCYL2 2 69894 2.86148E-5 34947 0 6.90608E-4
7-128865095-C-T p.Pro60Ser missense AHCYL2 2 69102 2.89427E-5 34551 0 0.0011139
7-128865098-C-T p.Pro61Ser missense AHCYL2 1 68896 1.45146E-5 34448 0 1.56755E-5
7-128865099-C-T p.Pro61Leu missense AHCYL2 1 68594 1.45785E-5 34297 0 NA
7-128865100-G-A p.Pro61Pro synonymous AHCYL2 4 68604 5.83056E-5 34302 0 NA
7-128865107-G-T p.Gly64Cys missense AHCYL2 1 67892 1.47293E-5 33946 0 NA
7-128865110-C-T p.Pro65Ser missense AHCYL2 5 67588 7.39776E-5 33794 0 6.53509E-5
7-128865112-G-T p.Pro65Pro synonymous AHCYL2 1 67514 1.48117E-5 33757 0 NA
7-128865123-C-T p.Pro69Leu missense AHCYL2 1 67508 1.48131E-5 33754 0 3.25119E-5
7-128865130-C-T p.Ala71Ala synonymous AHCYL2 18992 66194 0.286914 33097 2647 0.34273
7-128865140-C-G p.Pro75Ala missense AHCYL2 8 67876 1.17862E-4 33938 0 6.45494E-5
7-128865147-C-T p.Ala77Val missense AHCYL2 39 67742 5.75714E-4 33871 0 0.00154819
7-128865154-G-A p.Lys79Lys synonymous AHCYL2 1 68118 1.46804E-5 34059 0 9.6637E-5
7-128865162-A-C p.Gln82Pro missense AHCYL2 1 68582 1.45811E-5 34291 0 4.56955E-5
7-128865164-G-A p.Ala83Thr missense AHCYL2 31 68578 4.5204E-4 34289 0 3.21792E-4
7-128865172-C-T p.Ala85Ala synonymous AHCYL2 3 69340 4.32651E-5 34670 0 9.74089E-5
7-128865212-C-T p.Arg99Cys missense AHCYL2 3 72222 4.15386E-5 36111 0 6.40943E-5
7-128865227-G-T p.Ala104Ser missense AHCYL2 1 73006 1.36975E-5 36503 0 NA
7-128865234-T-G p.Val106Gly missense AHCYL2 1 73218 1.36578E-5 36609 0 8.67799E-6
7-128865244-C-T p.Asp109Asp synonymous AHCYL2 2 73494 2.72131E-5 36747 0 2.62794E-5
7-128865245-G-A p.Gly110Ser missense AHCYL2 1 73518 1.36021E-5 36759 0 3.19877E-5
7-128865250-C-G p.Thr111Thr synonymous AHCYL2 1 73570 1.35925E-5 36785 0 NA
7-128865251-G-A p.Val112Ile missense AHCYL2 11 73588 1.49481E-4 36794 0 0.00593972
7-128865259-G-A p.Glu114Glu synonymous AHCYL2 2 73704 2.71356E-5 36852 0 8.02568E-4
7-128923236-C-G p.Leu4Leu synonymous AHCYL2 1 8094 1.23548E-4 4047 0 3.18573E-5
7-128923254-T-A p.Phe10Leu missense AHCYL2 1 8092 1.23579E-4 4046 0 NA
7-129008002-C-T c.-334C>T 5_prime_UTR_premature_start_codon_gain AHCYL2 1 33646 2.97212E-5 16823 0 1.2738E-4
7-129008095-C-T c.-241C>T 5_prime_UTR_premature_start_codon_gain AHCYL2 1 63326 1.57913E-5 31663 0 NA
7-129008130-C-T c.-206C>T 5_prime_UTR_premature_start_codon_gain AHCYL2 5 68112 7.34085E-5 34056 0 3.18532E-5
7-129008155-T-C c.-181T>C 5_prime_UTR_premature_start_codon_gain AHCYL2 1 73774 1.35549E-5 36887 0 NA
7-129008161-A-G c.-175A>G 5_prime_UTR_premature_start_codon_gain AHCYL2 2 74862 2.67158E-5 37431 0 NA
7-129008174-T-G c.-162T>G 5_prime_UTR_premature_start_codon_gain AHCYL2 1 76282 1.31093E-5 38141 0 NA
7-129008179-C-T c.-157C>T 5_prime_UTR_premature_start_codon_gain AHCYL2 2 76810 2.60383E-5 38405 0 1.59307E-4
7-129008229-C-T c.-107C>T 5_prime_UTR_premature_start_codon_gain AHCYL2 1 79140 1.26358E-5 39570 0 NA
7-129008302-T-C c.-34T>C 5_prime_UTR_premature_start_codon_gain AHCYL2 1 80282 1.24561E-5 40141 0 NA
7-129008350-C-T p.Asp5Asp synonymous AHCYL2 5 80296 6.22696E-5 40148 0 6.83071E-5
7-129008350-C-A p.Asp5Glu missense AHCYL2 1 80296 1.24539E-5 40148 0 NA
7-129008351-G-A p.Gly6Ser missense AHCYL2 4 80296 4.98157E-5 40148 0 6.25E-4
7-129008369-G-C p.Ala12Pro missense AHCYL2 8 80294 9.96338E-5 40147 0 5.03525E-4
7-129008370-C-G p.Ala12Gly missense AHCYL2 1 80294 1.24542E-5 40147 0 8.03568E-6
7-129008375-C-G p.His14Asp missense AHCYL2 1 80294 1.24542E-5 40147 0 8.31421E-6
7-129008380-G-A p.Met15Ile missense AHCYL2 1 80292 1.24545E-5 40146 0 8.31449E-6
7-129008387-T-G p.Trp18Gly missense AHCYL2 1 80284 1.24558E-5 40142 0 8.31463E-6
7-129008388-G-A p.Trp18* stop_gained AHCYL2 1 80284 1.24558E-5 40142 0 6.36943E-5
7-129015519-A-G c.-192A>G 5_prime_UTR_premature_start_codon_gain AHCYL2 1 57352 1.74362E-5 28676 0 3.18451E-5
7-129015691-G-A c.-20G>A 5_prime_UTR_premature_start_codon_gain AHCYL2 26 74540 3.48806E-4 37270 0 2.86606E-4
7-129015716-G-A p.Leu2Leu synonymous AHCYL2 1 74624 1.34005E-5 37312 0 3.18471E-5
7-129015720-A-C p.Ser4Arg missense AHCYL2 3 74624 4.02015E-5 37312 0 5.20191E-5
7-129015724-A-G p.Lys5Arg missense AHCYL2 1 74634 1.33987E-5 37317 0 3.18471E-5
7-129015724-A-C p.Lys5Thr missense AHCYL2 1 74634 1.33987E-5 37317 0 3.18471E-5
7-129015731-A-G p.Lys7Lys synonymous AHCYL2 3 74656 4.01843E-5 37328 0 3.18471E-5
7-129015734-C-A p.Tyr8* stop_gained AHCYL2 1 74646 1.33966E-5 37323 0 NA
7-129015743-TG-T p.Gly12fs frameshift AHCYL2 1 74626 1.34002E-5 37313 0 NA
7-129015745-G-A p.Gly12Asp missense AHCYL2 2 74616 2.68039E-5 37308 0 0.00132626
7-129015749-C-T p.Asn13Asn synonymous AHCYL2 1 74622 1.34009E-5 37311 0 NA
7-129015750-T-G p.Ser14Ala missense AHCYL2 9 74612 1.20624E-4 37306 0 5.94628E-5
7-129017385-A-G p.Lys15Arg missense+splice_region AHCYL2 1 53244 1.87815E-5 26622 0 NA
7-129017410-A-G p.Ser10Ser synonymous AHCYL2 15 53350 2.81162E-4 26675 0 0.00261535
7-129017423-G-A p.Val15Ile missense AHCYL2 2 53372 3.74728E-5 26686 0 7.03334E-5
7-129017436-A-G p.His19Arg missense AHCYL2 9 53394 1.68558E-4 26697 0 1.27413E-4
7-129017440-A-G p.Gln20Gln synonymous AHCYL2 5 53394 9.36435E-5 26697 0 7.30418E-6
7-129017448-T-A p.Ile23Asn missense AHCYL2 1 53380 1.87336E-5 26690 0 7.03829E-5
7-129017451-T-C p.Phe24Ser missense AHCYL2 2 53386 3.7463E-5 26693 0 NA
7-129017455-A-T p.Leu25Phe missense AHCYL2 1 53392 1.87294E-5 26696 0 7.30396E-6
7-129019476-T-C c.364-3T>C splice_region AHCYL2 1 80452 1.24298E-5 40226 0 NA
7-129019478-G-A c.364-1G>A splice_acceptor AHCYL2 1 80460 1.24285E-5 40230 0 1.24267E-4
7-129019492-C-T p.Ala126Val missense AHCYL2 1 80556 1.24137E-5 40278 0 NA
7-129019496-C-G p.Asp127Glu missense AHCYL2 2 80574 2.48219E-5 40287 0 6.37389E-5
7-129019499-G-A p.Gln128Gln synonymous AHCYL2 2 80592 2.48164E-5 40296 0 8.31628E-6
7-129019505-A-G p.Gln130Gln synonymous AHCYL2 2 80606 2.4812E-5 40303 0 3.98181E-6
7-129019523-C-T p.Pro136Pro synonymous AHCYL2 1 80592 1.24082E-5 40296 0 3.18715E-5
7-129019530-A-G p.Ile139Val missense AHCYL2 2 80584 2.48188E-5 40292 0 4.13887E-5
7-129019552-G-A p.Arg146His missense AHCYL2 1 80510 1.24208E-5 40255 0 8.29807E-6
7-129019558-T-A p.Ile148Asn missense AHCYL2 1 80442 1.24313E-5 40221 0 3.98311E-6
7-129019577-C-A p.Asp154Glu missense AHCYL2 2 80314 2.49023E-5 40157 0 NA
7-129019584-A-T p.Ser157Cys missense AHCYL2 4 80204 4.98728E-5 40102 0 NA
7-129019589-A-G p.Ser158Ser splice_region+synonymous AHCYL2 1 80122 1.2481E-5 40061 0 1.68626E-5
7-129019590-G-GCGGCTTCATATACAGATAGCTCTGATGATGAGACATCGCCCA c.475_475+1insCGGCTTCATATACAGATAGCTCTGATGATGAGACATCGCCCA splice_donor AHCYL2 2 80124 2.49613E-5 40062 1 NA
7-129019594-A-C c.475+4A>C splice_region AHCYL2 2 80050 2.49844E-5 40025 0 8.01912E-6
7-129028897-C-T p.Ala159Val missense+splice_region AHCYL2 1 80682 1.23943E-5 40341 0 9.60123E-5
7-129028898-G-T p.Ala159Ala splice_region+synonymous AHCYL2 3 80676 3.71858E-5 40338 0 8.25832E-6
7-129028898-G-A p.Ala159Ala splice_region+synonymous AHCYL2 2 80676 2.47905E-5 40338 0 2.09291E-5
7-129028909-C-T p.Thr163Ile missense AHCYL2 1 80680 1.23946E-5 40340 0 NA
7-129028910-A-G p.Thr163Thr synonymous AHCYL2 2 80690 2.47862E-5 40345 0 1.59775E-5
7-129028913-T-C p.Asp164Asp synonymous AHCYL2 1 80696 1.23922E-5 40348 0 3.98886E-6
7-129028931-A-G p.Thr170Thr synonymous AHCYL2 2 80774 2.47604E-5 40387 0 NA
7-129028934-G-A p.Ser171Ser synonymous AHCYL2 2 80762 2.47641E-5 40381 0 5.77053E-5
7-129028943-C-G p.Asp174Glu missense AHCYL2 6 80834 7.42262E-5 40417 0 4.37982E-5
7-129028963-A-G p.Lys181Arg missense AHCYL2 2 80898 2.47225E-5 40449 0 3.18532E-5
7-129028969-G-A p.Ser183Asn missense AHCYL2 2 80910 2.47188E-5 40455 0 8.24212E-6
7-129028988-G-A p.Lys189Lys synonymous AHCYL2 1 80920 1.23579E-5 40460 0 8.24239E-6
7-129028992-A-G p.Ile191Val missense AHCYL2 1 80930 1.23564E-5 40465 0 3.18512E-5
7-129028995-A-G p.Lys192Glu missense AHCYL2 1 80930 1.23564E-5 40465 0 3.97912E-6
7-129029027-A-T p.Glu202Asp missense AHCYL2 2 80948 2.47072E-5 40474 0 NA
7-129029040-G-GAAATGCCT c.619_619+1insAAATGCCT splice_donor AHCYL2 1 80908 1.23597E-5 40454 0 NA
7-129029040-G-GAAATGCCTGCATTGATGGCTTTGA c.619_619+1insAAATGCCTGCATTGATGGCTTTGA splice_donor AHCYL2 2 80908 2.47194E-5 40454 1 NA
7-129029040-G-GAAATGCCTGCATTGATGGCTTTGAGGAAGAGA c.619_619+1insAAATGCCTGCATTGATGGCTTTGAGGAAGAGA splice_donor AHCYL2 2 80908 2.47194E-5 40454 1 NA
7-129029042-T-G c.619+2T>G splice_donor AHCYL2 1 80888 1.23628E-5 40444 0 NA
7-129029500-G-A p.Arg215Arg synonymous AHCYL2 1 80520 1.24193E-5 40260 0 8.33194E-6
7-129029504-A-C p.Arg217Arg synonymous AHCYL2 1 80540 1.24162E-5 40270 0 NA
7-129029542-C-T p.Ile229Ile synonymous AHCYL2 9 80586 1.11682E-4 40293 0 6.37227E-5
7-129029543-G-A p.Val230Met missense AHCYL2 2 80584 2.48188E-5 40292 0 3.98572E-6
7-129029566-T-C p.Ala237Ala synonymous AHCYL2 4 80496 4.96919E-5 40248 0 2.40612E-4
7-129029578-G-GCTTATGGAAACTCTGGGTGCTCTGGGGGCCCAGTGCCGATGGGCTGCC c.720+3_720+4insCTTATGGAAACTCTGGGTGCTCTGGGGGCCCAGTGCCGATGGGCTGCC splice_region AHCYL2 2 80360 2.4888E-5 40180 1 NA
7-129029578-G-GCTTATGGAAACTCTGGGTGCTCTGGGGGCCC c.720+3_720+4insCTTATGGAAACTCTGGGTGCTCTGGGGGCCC splice_region AHCYL2 2 80360 2.4888E-5 40180 1 NA
7-129029583-C-A c.720+8C>A splice_region AHCYL2 2 80266 2.49171E-5 40133 0 8.60237E-6
7-129037056-A-C c.721-7A>C splice_region AHCYL2 2 80828 2.47439E-5 40414 0 8.25955E-6
7-129037102-C-T p.Arg254* stop_gained AHCYL2 1 80766 1.23814E-5 40383 0 NA
7-129037103-G-A p.Arg254Gln missense AHCYL2 1 80766 1.23814E-5 40383 0 0.00151057
7-129037104-A-C p.Arg254Arg synonymous AHCYL2 7 80774 8.66616E-5 40387 0 0.00125
7-129037105-T-C p.Trp255Arg missense AHCYL2 1 80770 1.23808E-5 40385 0 NA
7-129037119-C-T p.Asn259Asn synonymous AHCYL2 1 80698 1.23919E-5 40349 0 3.1841E-5
7-129037146-T-A p.Ala268Ala synonymous AHCYL2 1 80536 1.24168E-5 40268 0 NA
7-129037150-G-A p.Ala270Thr missense AHCYL2 1 80500 1.24224E-5 40250 0 NA
7-129037165-G-GGATTTCCTGTTTTTGCCTGGAAGGGAGA c.823_823+1insGATTTCCTGTTTTTGCCTGGAAGGGAGA splice_donor AHCYL2 2 80398 2.48762E-5 40199 1 NA
7-129037166-G-GA c.823+1_823+2insA splice_donor AHCYL2 4 80370 4.97698E-5 40185 2 NA
7-129040126-C-T c.824-5C>T splice_region AHCYL2 1 80942 1.23545E-5 40471 0 9.78218E-5
7-129040153-G-A p.Lys282Lys synonymous AHCYL2 466 81014 0.00575209 40507 5 0.00479423
7-129040159-G-A p.Glu182Glu splice_region+synonymous AHCYL2 2 81024 2.4684E-5 40512 0 3.29489E-5
7-129040186-C-T p.Ile293Ile synonymous AHCYL2 1 81040 1.23396E-5 40520 0 3.18939E-5
7-129040189-T-C p.Asp294Asp synonymous AHCYL2 1 81044 1.2339E-5 40522 0 2.47101E-5
7-129040195-T-C p.Cys296Cys synonymous AHCYL2 2 81040 2.46792E-5 40520 0 NA
7-129040225-G-GATCTTGGATGATGGAGGGGATCTTACCCACT c.918_918+1insATCTTGGATGATGGAGGGGATCTTACCCACT splice_donor AHCYL2 2 80980 2.46975E-5 40490 1 NA
7-129040225-G-GATCTT c.918_918+1insATCTT splice_donor AHCYL2 2 80980 2.46975E-5 40490 1 NA
7-129040225-G-GATCTTGGATGATGGAGGGGATCTTACCCACTGGATTTATAAAAA c.918_918+1insATCTTGGATGATGGAGGGGATCTTACCCACTGGATTTATAAAAA splice_donor AHCYL2 2 80980 2.46975E-5 40490 1 NA
7-129043213-A-G c.919-7A>G splice_region AHCYL2 4 80422 4.97376E-5 40211 0 3.18512E-5
7-129043249-C-T p.His316His synonymous AHCYL2 1 80830 1.23716E-5 40415 0 NA
7-129043254-T-C p.Ile318Thr missense AHCYL2 2 80832 2.47427E-5 40416 0 4.808E-5
7-129043274-A-G p.Met325Val missense AHCYL2 1 80872 1.23652E-5 40436 0 8.27061E-6
7-129043282-G-A p.Lys327Lys synonymous AHCYL2 1 80882 1.23637E-5 40441 0 NA
7-129043295-A-G p.Ile332Val missense AHCYL2 1 80864 1.23664E-5 40432 0 4.00753E-6
7-129043295-A-T p.Ile332Leu missense AHCYL2 1 80864 1.23664E-5 40432 0 4.00753E-6
7-129043298-G-A p.Val333Ile missense AHCYL2 1 80858 1.23674E-5 40429 0 2.23862E-4
7-129043315-T-G p.Thr338Thr synonymous AHCYL2 3 80776 3.71397E-5 40388 0 8.33875E-6
7-129043327-G-GC c.1025+1_1025+2insC splice_donor AHCYL2 4 80612 4.96204E-5 40306 1 NA
7-129045019-C-A p.Asp369Glu missense AHCYL2 1 80742 1.23851E-5 40371 0 NA
7-129045044-A-G p.Ile378Val missense AHCYL2 1 80584 1.24094E-5 40292 0 4.1448E-6
7-129045054-G-GACTTAAAAGGACAACAGACATGATGTTTGGTGGAAAGCAA c.1142_1142+1insACTTAAAAGGACAACAGACATGATGTTTGGTGGAAAGCAA splice_donor AHCYL2 4 80430 4.97327E-5 40215 1 NA
7-129045054-G-GACTTAAAAGGACAACAGACATGAT c.1142_1142+1insACTTAAAAGGACAACAGACATGAT splice_donor AHCYL2 2 80430 2.48663E-5 40215 1 NA
7-129045054-G-GACTTAAAAGGACAACAGACATGATGTTTGGTGGAAAGCAAGT c.1142_1142+1insACTTAAAAGGACAACAGACATGATGTTTGGTGGAAAGCAAGT splice_donor AHCYL2 1 80430 1.24332E-5 40215 0 NA
7-129045058-A-G c.1142+4A>G splice_region AHCYL2 8 80340 9.95768E-5 40170 0 6.80627E-4
7-129045669-T-C c.1143-8T>C splice_region AHCYL2 1 80320 1.24502E-5 40160 0 2.14221E-4
7-129045695-C-T p.Asp387Asp synonymous AHCYL2 1 80792 1.23775E-5 40396 0 NA
7-129045700-T-C p.Met389Thr missense AHCYL2 1 80808 1.2375E-5 40404 0 NA
7-129045742-T-A c.1206+2T>A splice_donor AHCYL2 1 80778 1.23796E-5 40389 0 NA
7-129045746-GTTTAACC-G c.1206+7_1206+13delTTTAACC splice_region AHCYL2 1 80734 1.23864E-5 40367 0 NA
7-129046233-C-T p.Cys407Cys synonymous AHCYL2 1 80632 1.2402E-5 40316 0 3.18573E-5
7-129046259-C-T p.Ser416Phe missense AHCYL2 1 80776 1.23799E-5 40388 0 NA
7-129046261-A-G p.Ile417Val missense AHCYL2 1 80758 1.23827E-5 40379 0 NA
7-129046266-G-A p.Val418Val synonymous AHCYL2 2 80782 2.4758E-5 40391 0 NA
7-129046268-A-G p.Tyr419Cys missense AHCYL2 5 80776 6.18996E-5 40388 0 NA
7-129046284-C-T p.Asp424Asp synonymous AHCYL2 2 80748 2.47684E-5 40374 0 NA
7-129046295-C-T p.Ala428Val missense AHCYL2 1 80700 1.23916E-5 40350 0 NA
7-129046296-C-T p.Ala428Ala synonymous AHCYL2 2 80696 2.47844E-5 40348 0 3.29478E-5
7-129046304-C-CCTGTATGGATGGATTTCGA p.Ile423fs frameshift AHCYL2 2 80652 2.47979E-5 40326 1 NA
7-129049311-C-T c.1296-6C>T splice_region AHCYL2 1 80638 1.24011E-5 40319 0 3.59152E-5
7-129049333-C-G p.Leu438Val missense AHCYL2 1 80726 1.23876E-5 40363 0 NA
7-129049334-T-C p.Leu438Pro missense AHCYL2 2 80738 2.47715E-5 40369 0 3.18451E-5
7-129049358-G-A p.Arg446Gln missense AHCYL2 2 80742 2.47703E-5 40371 0 NA
7-129049360-C-A p.Gln447Lys missense AHCYL2 2 80746 2.4769E-5 40373 0 NA
7-129049364-T-G p.Val448Gly missense AHCYL2 1 80732 1.23867E-5 40366 0 NA
7-129053441-A-G p.Lys458Arg missense AHCYL2 1 80786 1.23784E-5 40393 0 8.24103E-6
7-129053444-A-G p.Asn459Ser missense AHCYL2 1 80782 1.2379E-5 40391 0 3.97826E-6
7-129053450-T-C p.Val461Ala missense AHCYL2 3 80830 3.71149E-5 40415 0 8.23995E-6
7-129053470-C-T p.Arg468Cys missense AHCYL2 1 80866 1.23661E-5 40433 0 NA
7-129053471-G-A p.Arg468His missense AHCYL2 1 80866 1.23661E-5 40433 0 1.64772E-5
7-129053475-G-T p.Met469Ile missense AHCYL2 2 80898 2.47225E-5 40449 0 NA
7-129053483-G-A p.Ser472Asn missense AHCYL2 1 80882 1.23637E-5 40441 0 3.9781E-6
7-129053490-C-T p.Ile474Ile synonymous AHCYL2 3 80870 3.70966E-5 40435 0 6.36862E-5
7-129053491-G-A p.Val475Ile missense AHCYL2 1 80858 1.23674E-5 40429 0 3.2956E-5
7-129053505-A-C p.Gly479Gly synonymous AHCYL2 8 80826 9.89781E-5 40413 0 9.06379E-5
7-129053522-T-C p.Ile485Thr missense AHCYL2 1 80700 1.23916E-5 40350 0 8.24375E-6
7-129053526-C-T p.Asp486Asp synonymous AHCYL2 2 80666 2.47936E-5 40333 0 3.18552E-5
7-129053526-C-G p.Asp486Glu missense AHCYL2 1 80666 1.23968E-5 40333 0 3.98029E-6
7-129053527-G-A p.Val487Met missense+splice_region AHCYL2 1 80646 1.23999E-5 40323 0 NA
7-129053529-G-GGCGA c.1461_1461+1insGCGA splice_donor AHCYL2 1 80650 1.23993E-5 40325 0 NA
7-129053529-G-GGCGAGTCTGCGGACACCAGAACTGACCTGGGAGCGA c.1461_1461+1insGCGAGTCTGCGGACACCAGAACTGACCTGGGAGCGA splice_donor AHCYL2 1 80650 1.23993E-5 40325 0 NA
7-129062682-C-T p.Ala488Val missense+splice_region AHCYL2 3 80794 3.71315E-5 40397 0 3.58586E-5
7-129062683-G-A p.Ala488Ala splice_region+synonymous AHCYL2 1 80800 1.23762E-5 40400 0 3.98222E-5
7-129062722-A-G p.Arg501Arg synonymous AHCYL2 1 80858 1.23674E-5 40429 0 NA
7-129062728-A-G p.Gln503Gln synonymous AHCYL2 1 80860 1.23671E-5 40430 0 3.18471E-5
7-129062730-T-C p.Val504Ala missense AHCYL2 1 80848 1.23689E-5 40424 0 3.97779E-6
7-129062761-G-A p.Arg514Arg synonymous AHCYL2 2 80648 2.47991E-5 40324 0 8.24769E-6
7-129062768-C-T p.Leu517Leu synonymous AHCYL2 1 80520 1.24193E-5 40260 0 NA
7-129062772-T-C p.Leu518Pro missense AHCYL2 1 80444 1.2431E-5 40222 0 NA
7-129062773-G-T p.Leu518Leu synonymous AHCYL2 2 80426 2.48676E-5 40213 0 NA
7-129062784-G-A c.1560+5G>A splice_region AHCYL2 1 80078 1.24878E-5 40039 0 3.18492E-5
7-129064709-C-T c.1561-6C>T splice_region AHCYL2 1 80290 1.24549E-5 40145 0 NA
7-129064712-T-C c.1561-3T>C splice_region AHCYL2 1 80388 1.24397E-5 40194 0 1.98875E-5
7-129064718-C-T p.Arg522Cys missense AHCYL2 1 80546 1.24153E-5 40273 0 3.97741E-6
7-129064719-G-A p.Arg522His missense AHCYL2 1 80610 1.24054E-5 40305 0 8.23805E-6
7-129064730-C-T p.Leu526Phe missense AHCYL2 3 80840 3.71103E-5 40420 0 3.29506E-5
7-129064748-C-A p.Pro532Thr missense AHCYL2 2 80970 2.47005E-5 40485 0 8.23723E-6
7-129064753-A-T p.Thr533Thr synonymous AHCYL2 6 80994 7.40796E-5 40497 0 1.2747E-4
7-129064766-A-G p.Ile538Val missense AHCYL2 1 80996 1.23463E-5 40498 0 3.18492E-5
7-129064771-T-C p.Thr539Thr synonymous AHCYL2 1 81008 1.23445E-5 40504 0 8.23778E-6
7-129064781-CAGGTAAGGCTTCCAGAGTGGGATAGCAGTAGTCTGGAGAAGGTCCTCAGACCCACCAGGTTTCACTTGCTTGGGTAGATTGCCATGAATGGCACATCAGCATCCATCTCTCTGCTTTTCT-C p.Gln543fs frameshift AHCYL2 7 81022 8.63963E-5 40511 0 NA
7-129064784-G-A c.1629+1G>A splice_donor AHCYL2 1 81018 1.23429E-5 40509 0 NA
7-129064789-G-A c.1629+6G>A splice_region AHCYL2 4 81000 4.93827E-5 40500 0 3.29516E-5
7-129064789-G-T c.1629+6G>T splice_region AHCYL2 1 81000 1.23457E-5 40500 0 NA
7-129064927-C-T p.Tyr551Tyr synonymous AHCYL2 11 80938 1.35906E-4 40469 0 4.77737E-4
7-129064933-T-C p.Ala553Ala synonymous AHCYL2 1 80944 1.23542E-5 40472 0 NA
7-129064944-G-A p.Arg557His missense AHCYL2 1 80916 1.23585E-5 40458 0 3.18451E-5
7-129064952-C-T p.Gln560* stop_gained AHCYL2 1 80908 1.23597E-5 40454 0 NA
7-129064960-C-T p.Val562Val synonymous AHCYL2 2 80882 2.47274E-5 40441 0 NA
7-129066277-G-C c.1709-7G>C splice_region AHCYL2 2 81012 2.46877E-5 40506 0 8.23805E-6
7-129066384-C-T p.Pro603Pro synonymous AHCYL2 1 81008 1.23445E-5 40504 0 NA
7-129066393-T-G p.Pro606Pro synonymous AHCYL2 7 80984 8.64368E-5 40492 0 1.27453E-4
7-129066406-T-TATTAAGTTCCTGTAACTCAAACCAGAATTTTTAAGGAATAGAACTCCAA c.1829+2_1829+3insATTAAGTTCCTGTAACTCAAACCAGAATTTTTAAGGAATAGAACTCCAA splice_region AHCYL2 3 80946 3.70617E-5 40473 1 NA
7-129066873-C-T c.1830-7C>T splice_region AHCYL2 1 79372 1.25989E-5 39686 0 NA
7-129066876-C-G c.1830-4C>G splice_region AHCYL2 1 79402 1.25941E-5 39701 0 3.18776E-5
7-129067050-C-G c.*164C>G splice_region AHCYL2 3 68510 4.37892E-5 34255 0 NA
7-129067053-T-C c.*167T>C splice_region AHCYL2 18670 64802 0.288108 32401 2390 0.311697