Variant

Variant ID Consequence Effect Gene AC AN AF NS NHOM maxEAF
20-32868848-G-A p.Arg431Cys missense AHCY 1 83114 1.20317E-5 41557 0 2.50133E-5
20-32868856-T-C p.Asp428Gly missense AHCY 1 83114 1.20317E-5 41557 0 8.3185E-6
20-32868857-C-T p.Asp428Asn missense AHCY 3 83118 3.60933E-5 41559 0 NA
20-32868858-C-T p.Pro427Pro synonymous AHCY 1 83128 1.20296E-5 41564 0 3.32751E-5
20-32868859-G-A p.Pro427Leu missense AHCY 2 83132 2.40581E-5 41566 0 3.18613E-5
20-32868878-A-G p.Cys421Arg missense AHCY 26 83120 3.12801E-4 41560 0 6.37267E-4
20-32868884-T-G p.Met419Leu missense AHCY 1 83106 1.20328E-5 41553 0 NA
20-32868885-G-A p.Gly418Gly synonymous AHCY 1 83094 1.20346E-5 41547 0 2.78529E-5
20-32868903-C-T p.Lys412Lys synonymous AHCY 13 83124 1.56393E-4 41562 0 4.13005E-5
20-32868910-G-T p.Thr410Asn missense AHCY 1 83128 1.20296E-5 41564 0 NA
20-32868911-T-A p.Thr410Ser missense AHCY 2 83130 2.40587E-5 41565 0 3.97782E-6
20-32868911-T-G p.Thr410Pro missense AHCY 1 83130 1.20294E-5 41565 0 3.97782E-6
20-32868929-C-T p.Val404Met missense AHCY 9 83034 1.08389E-4 41517 0 8.253E-5
20-32868948-G-T p.Ala397Ala synonymous AHCY 2 82668 2.41932E-5 41334 0 1.65071E-5
20-32868949-G-A p.Ala397Val missense AHCY 2 82618 2.42078E-5 41309 0 1.5919E-5
20-32868975-G-T c.1168-4C>A splice_region AHCY 1 81214 1.23131E-5 40607 0 3.98651E-6
20-32873242-C-T c.1167+4G>A splice_region AHCY 1 82850 1.207E-5 41425 0 NA
20-32873254-G-C p.Pro387Ala missense AHCY 2 83060 2.4079E-5 41530 0 3.97978E-6
20-32873267-C-A p.Gly382Gly synonymous AHCY 1 83174 1.2023E-5 41587 0 NA
20-32873269-C-CCCGGCAGGTGGAGGTTGCAGT p.Val381_Gly382insThrAlaThrSerThrCysArg conservative_inframe_insertion AHCY 1 83184 1.20215E-5 41592 0 NA
20-32873272-C-T p.Val381Ile missense AHCY 1 83202 1.20189E-5 41601 0 3.18552E-5
20-32873272-C-A p.Val381Phe missense AHCY 1 83202 1.20189E-5 41601 0 NA
20-32873272-C-CGG p.Val381fs frameshift AHCY 1 83202 1.20189E-5 41601 0 NA
20-32873273-G-A p.Pro380Pro synonymous AHCY 1 83216 1.20169E-5 41608 0 2.4717E-5
20-32873280-T-C p.Lys378Arg missense AHCY 1 83242 1.20132E-5 41621 0 1.98891E-5
20-32873299-G-A p.Leu372Leu synonymous AHCY 6 83308 7.20219E-5 41654 0 1.27389E-4
20-32873309-C-T p.Ala368Ala synonymous AHCY 5 83334 5.99995E-5 41667 0 3.18512E-5
20-32873324-G-A p.Thr363Thr synonymous AHCY 3 83326 3.60032E-5 41663 0 3.18471E-5
20-32873351-G-A p.Pro354Pro synonymous AHCY 1 83280 1.20077E-5 41640 0 1.19306E-5
20-32873370-C-G p.Gly348Ala missense AHCY 1 83242 1.20132E-5 41621 0 NA
20-32873372-C-G p.Leu347Leu synonymous AHCY 1 83244 1.20129E-5 41622 0 NA
20-32873386-G-A p.Arg343Trp missense AHCY 1 83206 1.20184E-5 41603 0 8.25846E-6
20-32873393-G-A p.Ala340Ala synonymous AHCY 2 83190 2.40414E-5 41595 0 6.37714E-5
20-32873398-G-A p.Leu339Leu synonymous AHCY 1 83178 1.20224E-5 41589 0 2.48106E-5
20-32873402-G-A p.Ile337Ile synonymous AHCY 3 83164 3.60733E-5 41582 0 2.38777E-5
20-32873405-G-A p.Ile336Ile synonymous AHCY 63 83120 7.5794E-4 41560 0 7.40452E-4
20-32873409-C-T p.Arg335His missense AHCY 1 83052 1.20406E-5 41526 0 0.00151822
20-32873410-G-C p.Arg335Gly missense AHCY 2 83022 2.409E-5 41511 0 NA
20-32873410-G-A p.Arg335Cys missense AHCY 5 83022 6.0225E-5 41511 0 0.00151822
20-32873412-C-T p.Arg334His missense AHCY 42 82948 5.06341E-4 41474 0 4.14209E-5
20-32873413-G-A p.Arg334Cys missense AHCY 26 82932 3.1351E-4 41466 0 0.00202634
20-32873426-C-T p.Arg329Arg synonymous AHCY 2 82810 2.41517E-5 41405 0 NA
20-32873427-C-T p.Arg329Gln missense AHCY 1 82756 1.20837E-5 41378 0 6.25E-4
20-32873428-G-A p.Arg329Trp missense AHCY 4 82704 4.83653E-5 41352 0 9.56816E-5
20-32873428-G-C p.Arg329Gly missense AHCY 1 82704 1.20913E-5 41352 0 NA
20-32873431-A-C p.Tyr328Asp missense AHCY 1 82592 1.21077E-5 41296 0 1.99893E-5
20-32873433-C-T p.Arg327Gln missense AHCY 4 82582 4.84367E-5 41291 0 1.66594E-5
20-32873434-G-A p.Arg327Trp missense AHCY 19 82498 2.30309E-4 41249 1 1.08031E-4
20-32873444-C-A c.973-4G>T splice_region AHCY 3 82338 3.64352E-5 41169 0 8.38167E-6
20-32873446-C-G c.973-6G>C splice_region AHCY 2 82326 2.42937E-5 41163 0 8.39588E-6
20-32873446-C-T c.973-6G>A splice_region AHCY 3 82326 3.64405E-5 41163 0 NA
20-32873447-G-A c.973-7C>T splice_region AHCY 4016 82142 0.0488909 41071 548 0.106345
20-32878141-C-T p.Pro323Pro synonymous AHCY 5 82094 6.09058E-5 41047 0 2.47517E-5
20-32878164-C-T p.Val316Met missense AHCY 2 82926 2.41179E-5 41463 0 3.18613E-5
20-32878165-G-A p.Ala315Ala synonymous AHCY 8 82920 9.64785E-5 41460 0 1.2747E-4
20-32878167-C-T p.Ala315Thr missense AHCY 1 82956 1.20546E-5 41478 0 3.18573E-5
20-32878168-G-A p.Asn314Asn synonymous AHCY 1 83004 1.20476E-5 41502 0 3.58135E-5
20-32878174-G-A p.Asn312Asn synonymous AHCY 1 83090 1.20351E-5 41545 0 2.78485E-5
20-32878184-T-C p.Lys309Arg missense AHCY 3 83232 3.60438E-5 41616 0 1.19323E-5
20-32878191-C-T p.Asp307Asn missense AHCY 1 83254 1.20114E-5 41627 0 3.18796E-5
20-32878192-G-A p.Ile306Ile synonymous AHCY 32 83266 3.84311E-4 41633 0 5.03525E-4
20-32878200-C-T p.Val304Met missense AHCY 2 83296 2.40108E-5 41648 0 1.64853E-5
20-32878201-G-A p.Asp303Asp synonymous AHCY 1 83294 1.20057E-5 41647 0 1.64856E-5
20-32878228-G-C p.Ala294Ala synonymous AHCY 16 83338 1.91989E-4 41669 0 0.00302115
20-32878246-C-T p.Glu288Glu synonymous AHCY 2 83340 2.39981E-5 41670 0 8.23927E-6
20-32878254-GCCTGTCAGGCAGCCCAAGACCGTGGGAGATTGTCAGGGACAGAAAGCTGTCCCAACTCTGCCCTCCTCCCTCACTCCCCGGGACCCCCCATCTGGCACCTA-G p.His286fs frameshift AHCY 8 83330 9.60038E-5 41665 2 NA
20-32878255-C-G p.Arg285Arg splice_region+synonymous AHCY 2 83336 2.39992E-5 41668 0 NA
20-32878263-G-A c.855-8C>T splice_region AHCY 26 83322 3.12042E-4 41661 0 3.18573E-4
20-32878350-C-T c.854+7G>A splice_region AHCY 2 83214 2.40344E-5 41607 0 6.25E-4
20-32878352-C-A c.854+5G>T splice_region AHCY 2 83212 2.4035E-5 41606 0 NA
20-32878358-G-A p.Arg285Trp missense+splice_region AHCY 128 83182 0.00153879 41591 0 0.00127462
20-32878359-G-C p.Gly284Gly splice_region+synonymous AHCY 1 83186 1.20213E-5 41593 0 NA
20-32878368-G-A p.Ile281Ile synonymous AHCY 1 83188 1.2021E-5 41594 0 NA
20-32878382-C-G p.Gly277Arg missense AHCY 1 83216 1.20169E-5 41608 0 NA
20-32878411-T-C p.Gln267Arg missense AHCY 2 83266 2.40194E-5 41633 0 8.23778E-6
20-32878420-T-TCATC p.Glu264fs frameshift AHCY 1 83270 1.20091E-5 41635 0 NA
20-32878427-T-C p.Met262Val missense AHCY 1 83284 1.20071E-5 41642 0 3.97716E-6
20-32878442-A-G p.Tyr257His missense+splice_region AHCY 12 83314 1.44033E-4 41657 0 1.27478E-4
20-32878443-GCCTGTGCAGAGACAGTGGCTGTGGGTCATCTACGGTGGCCTTGCCCCTCCCTCTGGCCCCAGTGGCTGACAACCAACCCTTGCCCTATCCTA-G p.Gly256fs frameshift AHCY 14 83310 1.68047E-4 41655 7 NA
20-32878450-CAG-C c.767-8_767-7delCT splice_region AHCY 51 83284 6.12363E-4 41642 0 0.00121089
20-32878558-C-A p.Ala249Ser missense AHCY 3 83230 3.60447E-5 41615 0 8.23995E-6
20-32878559-G-A p.Asn248Asn synonymous AHCY 256 83232 0.00307574 41616 1 0.00341134
20-32878564-T-C p.Ile247Val missense AHCY 5 83226 6.00774E-5 41613 0 2.38654E-5
20-32878577-G-A p.Thr242Thr synonymous AHCY 2 83172 2.40466E-5 41586 0 6.37796E-5
20-32878580-G-A p.Ile241Ile synonymous AHCY 2 83178 2.40448E-5 41589 0 NA
20-32878588-C-T p.Val239Ile missense AHCY 1 83148 1.20267E-5 41574 0 6.38366E-5
20-32878589-G-A p.Arg238Arg synonymous AHCY 1 83134 1.20288E-5 41567 0 3.18193E-5
20-32878590-C-T p.Arg238His missense AHCY 5 83128 6.01482E-5 41564 0 1.19321E-5
20-32878591-G-A p.Arg238Cys missense AHCY 2 83140 2.40558E-5 41570 0 7.95406E-6
20-32878594-C-A p.Ala237Ser missense AHCY 1 83118 1.20311E-5 41559 0 NA
20-32878598-G-A p.Phe235Phe synonymous AHCY 1 83120 1.20308E-5 41560 0 1.5908E-5
20-32878605-C-T p.Arg233Gln missense AHCY 22 83138 2.6462E-4 41569 0 0.00151057
20-32878617-G-C p.Ala229Gly missense AHCY 1 83106 1.20328E-5 41553 0 7.95355E-6
20-32878618-C-T p.Ala229Thr missense AHCY 2 83124 2.40604E-5 41562 0 8.2447E-6
20-32878635-T-TCAC p.Gly222dup conservative_inframe_insertion AHCY 1 83122 1.20305E-5 41561 0 NA
20-32878640-A-G p.Tyr221Tyr synonymous AHCY 21 83126 2.52629E-4 41563 0 0.0020141
20-32878641-T-C p.Tyr221Cys missense AHCY 1 83126 1.20299E-5 41563 0 3.97674E-6
20-32878664-G-A p.Gly213Gly synonymous AHCY 9 83052 1.08366E-4 41526 0 4.12977E-5
20-32878666-C-T p.Gly213Ser missense AHCY 2 83032 2.40871E-5 41516 0 3.18857E-5
20-32878667-G-A p.Ala212Ala synonymous AHCY 13 83016 1.56596E-4 41508 0 4.46343E-4
20-32878690-G-A p.Arg205Trp missense AHCY 2 82840 2.41429E-5 41420 0 8.28624E-6
20-32878725-T-A p.Tyr193Phe missense AHCY 2 81384 2.45749E-5 40692 0 7.99527E-6
20-32878725-T-C p.Tyr193Cys missense AHCY 2 81384 2.45749E-5 40692 0 8.40407E-6
20-32878733-G-A p.Asp190Asp synonymous AHCY 2 80436 2.48645E-5 40218 0 1.36114E-4
20-32878734-T-C p.Asp190Gly missense AHCY 1 80334 1.2448E-5 40167 0 NA
20-32878746-T-TTGGTGACGGAGTCATTGACATTGATG c.559-3_559-2insCATCAATGTCAATGACTCCGTCACCA splice_region AHCY 1 78590 1.27243E-5 39295 0 NA
20-32879217-C-A c.558+8G>T splice_region AHCY 1 82692 1.20931E-5 41346 0 7.95488E-6
20-32879217-C-T c.558+8G>A splice_region AHCY 1 82692 1.20931E-5 41346 0 8.2371E-6
20-32879225-C-G p.Lys186Asn missense+splice_region AHCY 1 82996 1.20488E-5 41498 0 NA
20-32879231-G-A p.Val184Val synonymous AHCY 1 83074 1.20375E-5 41537 0 6.26566E-4
20-32879233-C-T p.Val184Ile missense AHCY 5 83088 6.01772E-5 41544 1 5.03525E-4
20-32879237-G-A p.Asp182Asp synonymous AHCY 1 83154 1.20259E-5 41577 0 NA
20-32879238-T-C p.Asp182Gly missense AHCY 1 83172 1.20233E-5 41586 0 NA
20-32879274-T-C p.Asn170Ser missense AHCY 1 83280 1.20077E-5 41640 0 4.94185E-5
20-32879277-G-A p.Ala169Val missense AHCY 1 83292 1.2006E-5 41646 0 NA
20-32879283-A-T p.Met167Lys missense AHCY 1 83302 1.20045E-5 41651 0 NA
20-32879286-T-C p.Lys166Arg missense AHCY 1 83308 1.20036E-5 41654 0 8.23642E-6
20-32879287-T-C p.Lys166Glu missense AHCY 1 83310 1.20034E-5 41655 0 NA
20-32879288-G-A p.Tyr165Tyr synonymous AHCY 1 83314 1.20028E-5 41657 0 NA
20-32879298-T-C p.His162Arg missense AHCY 1 83304 1.20042E-5 41652 0 NA
20-32879312-G-A p.Thr157Thr synonymous AHCY 20 83258 2.40217E-4 41629 0 6.37511E-5
20-32879319-T-G p.Glu155Ala missense AHCY 1 83236 1.2014E-5 41618 0 NA
20-32879326-T-C p.Ile153Val missense AHCY 1 83186 1.20213E-5 41593 0 NA
20-32879331-C-T p.Arg151Gln missense AHCY 5 83170 6.01178E-5 41585 0 6.25E-4
20-32879332-G-A p.Arg151* stop_gained AHCY 1 83162 1.20247E-5 41581 0 6.37633E-5
20-32880177-C-T p.Pro144Pro synonymous AHCY 3 82844 3.62126E-5 41422 0 3.98775E-6
20-32880179-G-C p.Pro144Ala missense AHCY 2 82874 2.4133E-5 41437 1 NA
20-32880181-T-C p.Tyr143Cys missense AHCY 17 82842 2.0521E-4 41421 0 1.27429E-4
20-32880186-G-A p.Thr141Thr synonymous AHCY 1 82924 1.20592E-5 41462 0 4.2214E-5
20-32880193-A-G p.Ile139Thr missense AHCY 1 82980 1.20511E-5 41490 0 1.19421E-5
20-32880209-C-T p.Asp134Asn missense AHCY 1 83040 1.20424E-5 41520 0 NA
20-32880210-G-A p.Gly133Gly synonymous AHCY 4 83052 4.81626E-5 41526 0 1.91156E-4
20-32880216-G-A p.Asp131Asp synonymous AHCY 3 83094 3.61037E-5 41547 0 9.92851E-5
20-32880219-G-A p.Asp130Asp synonymous AHCY 42 83130 5.05233E-4 41565 0 6.05443E-4
20-32880230-T-C p.Met127Val missense AHCY 2 83190 2.40414E-5 41595 0 3.97668E-6
20-32880238-G-A p.Pro124Leu missense AHCY 1 83192 1.20204E-5 41596 0 NA
20-32880240-C-A p.Gly123Gly synonymous AHCY 1 83174 1.2023E-5 41587 0 NA
20-32880242-C-T p.Gly123Arg missense AHCY 493 83170 0.00592762 41585 4 0.00405633
20-32880243-G-A p.Asp122Asp synonymous AHCY 2 83174 2.4046E-5 41587 0 2.47313E-5
20-32880243-G-C p.Asp122Glu missense AHCY 3 83174 3.6069E-5 41587 0 3.18552E-5
20-32880259-G-C p.Thr117Ser missense AHCY 2 83194 2.40402E-5 41597 0 1.98829E-5
20-32880263-G-A p.Gln116* stop_gained AHCY 1 83180 1.20221E-5 41590 0 7.95323E-6
20-32880282-C-T p.Glu109Glu synonymous AHCY 1 83056 1.20401E-5 41528 0 NA
20-32880283-T-C p.Glu109Gly missense AHCY 1 83032 1.20435E-5 41516 0 NA
20-32880285-C-T p.Glu108Glu synonymous AHCY 3 83018 3.61367E-5 41509 0 NA
20-32880287-C-T p.Glu108Lys missense AHCY 2 82988 2.40999E-5 41494 0 NA
20-32880288-G-A p.Asp107Asp synonymous AHCY 4 82952 4.82207E-5 41476 0 6.25E-4
20-32880291-C-T p.Thr106Thr synonymous AHCY 2 82914 2.41214E-5 41457 0 3.18431E-5
20-32880292-G-A p.Thr106Met missense AHCY 1 82884 1.20651E-5 41442 0 7.95583E-6
20-32880296-C-T p.Glu105Lys missense AHCY 2 82760 2.41663E-5 41380 0 NA
20-32880300-C-T p.Lys103Lys synonymous AHCY 5 82658 6.04902E-5 41329 0 2.06036E-4
20-32881888-C-T p.Pro98Pro splice_region+synonymous AHCY 1 82480 1.21242E-5 41240 0 1.19461E-5
20-32881888-C-A p.Pro98Pro splice_region+synonymous AHCY 2 82482 2.42477E-5 41241 0 8.34948E-6
20-32881889-G-A p.Pro98Leu missense+splice_region AHCY 4 82490 4.84907E-5 41245 0 6.36862E-5
20-32881902-T-C p.Lys94Glu missense AHCY 1 82624 1.2103E-5 41312 0 6.36821E-5
20-32881902-T-G p.Lys94Gln missense AHCY 1 82624 1.2103E-5 41312 0 NA
20-32881905-C-T p.Ala93Thr missense AHCY 1 82644 1.21001E-5 41322 0 8.50441E-6
20-32881908-T-C p.Ile92Val missense AHCY 208 82628 0.00251731 41314 1 0.00394779
20-32881909-G-A p.Ala91Ala synonymous AHCY 1 82626 1.21027E-5 41313 0 3.1837E-5
20-32881916-G-A p.Ala89Val missense AHCY 1 82640 1.21007E-5 41320 0 1.59468E-5
20-32881918-C-T p.Ala88Ala synonymous AHCY 10 82656 1.20983E-4 41328 0 5.04032E-4
20-32881919-G-A p.Ala88Val missense AHCY 1 82648 1.20995E-5 41324 0 1.59492E-5
20-32881924-G-C p.Asp86Glu missense AHCY 1 82670 1.20963E-5 41335 0 NA
20-32881925-T-C p.Asp86Gly missense AHCY 2 82642 2.42008E-5 41321 0 5.02386E-5
20-32881951-G-A p.Ser77Ser synonymous AHCY 1 82140 1.21743E-5 41070 0 NA
20-32883024-TCAC-T n.479+1_479+3delGTG splice_donor AHCY 1 72498 1.37935E-5 36249 0 7.57472E-6
20-32883029-A-C n.478T>G splice_region AHCY 8 73128 1.09397E-4 36564 0 6.05211E-4
20-32883193-G-A c.219+8C>T splice_region AHCY 4 80774 4.95209E-5 40387 0 1.6132E-5
20-32883194-G-C c.219+7C>G splice_region AHCY 93 80778 0.0011513 40389 0 0.001875
20-32883207-A-G p.Gly71Gly synonymous AHCY 1 81098 1.23308E-5 40549 0 NA
20-32883213-G-A p.Thr69Thr synonymous AHCY 1 81282 1.23028E-5 40641 0 3.18573E-5
20-32883216-G-A p.Val68Val synonymous AHCY 2 81312 2.45966E-5 40656 0 1.20418E-5
20-32883218-C-T p.Val68Ile missense AHCY 12 81342 1.47525E-4 40671 0 3.18573E-5
20-32883236-C-T p.Val62Ile missense AHCY 2 81690 2.44828E-5 40845 0 1.61039E-4
20-32883254-T-C p.Met56Val missense AHCY 2 82184 2.43356E-5 41092 0 1.99741E-5
20-32883269-C-T p.Ala51Thr missense AHCY 1 82274 1.21545E-5 41137 0 NA
20-32883275-G-A p.Arg49Cys missense AHCY 5 82362 6.07076E-5 41181 0 3.18552E-5
20-32883278-C-T p.Ala48Thr missense AHCY 1 82274 1.21545E-5 41137 0 3.99594E-6
20-32883285-C-T p.Leu45Leu synonymous AHCY 1 82432 1.21312E-5 41216 0 3.99818E-6
20-32883286-A-T p.Leu45Gln missense AHCY 2 82422 2.42654E-5 41211 0 NA
20-32883298-G-A p.Ala41Val missense AHCY 1 82018 1.21924E-5 41009 0 8.02047E-6
20-32883308-G-A p.Arg38Trp missense AHCY 1253 81752 0.0153268 40876 6 0.0135952
20-32883309-C-A p.Glu37Asp missense AHCY 1 81834 1.22199E-5 40917 0 NA
20-32883310-T-A p.Glu37Val missense AHCY 13 81788 1.58948E-4 40894 0 0.0020141
20-32883318-A-C p.Arg34Arg synonymous AHCY 3 81960 3.66032E-5 40980 0 4.00215E-6
20-32883319-C-T p.Arg34His missense AHCY 2 81968 2.43998E-5 40984 0 1.69676E-5
20-32883320-G-A p.Arg34Cys missense AHCY 10 81932 1.22052E-4 40966 0 0.00302419
20-32883327-G-A p.Gly31Gly synonymous AHCY 2 81936 2.44093E-5 40968 0 NA
20-32883330-C-T p.Pro30Pro synonymous AHCY 2 82000 2.43902E-5 41000 0 8.48954E-6
20-32883330-C-G p.Pro30Pro synonymous AHCY 1 82000 1.21951E-5 41000 0 NA
20-32883330-C-A p.Pro30Pro synonymous AHCY 2 82000 2.43902E-5 41000 0 NA
20-32883350-T-C p.Ile24Val missense AHCY 2 81870 2.4429E-5 40935 0 3.40675E-5
20-32883352-TC-AT p.Asp23Ile missense AHCY 1 81856 1.22166E-5 40928 0 NA
20-32883353-C-T p.Asp23Asn missense AHCY 2 81846 2.44361E-5 40923 0 NA
20-32883359-C-T p.Ala21Thr missense AHCY 2 81648 2.44954E-5 40824 0 7.70416E-5
20-32883372-G-A c.-37C>T 5_prime_UTR_premature_start_codon_gain AHCY 1 81372 1.22892E-5 40686 0 NA
20-32883384-G-A c.-49C>T 5_prime_UTR_premature_start_codon_gain AHCY 8 81142 9.85926E-5 40571 0 6.25E-4
20-32883386-T-C p.Ile12Val missense AHCY 1 81098 1.23308E-5 40549 0 NA
20-32883390-G-A c.-55C>T 5_prime_UTR_premature_start_codon_gain AHCY 2 80942 2.47091E-5 40471 0 1.83137E-5
20-32883390-G-C p.Ala10Ala splice_region+synonymous AHCY 1 80942 1.23545E-5 40471 0 NA
20-32883395-C-T c.29-4G>A splice_region AHCY 2 80690 2.47862E-5 40345 0 6.48072E-5
20-32883396-G-A c.29-5C>T splice_region AHCY 3 80584 3.72282E-5 40292 0 6.37227E-5
20-32891042-G-A c.28+7C>T splice_region AHCY 277 80432 0.0034439 40216 0 0.0048751
20-32891054-T-C p.Lys8Arg missense AHCY 1 80582 1.24097E-5 40291 0 NA
20-32891058-A-G p.Tyr7His missense AHCY 1 80618 1.24042E-5 40309 0 NA
20-32891083-G-A c.-7C>T 5_prime_UTR_premature_start_codon_gain AHCY 1 81024 1.2342E-5 40512 0 6.39746E-6
20-32891101-G-A c.-25C>T 5_prime_UTR_premature_start_codon_gain AHCY 1 81200 1.23153E-5 40600 0 6.37064E-5
20-32891105-G-A c.-29C>T 5_prime_UTR_premature_start_codon_gain AHCY 3 81224 3.69349E-5 40612 0 6.36983E-5