Variant

Variant ID Consequence Effect Gene AC AN AF NS NHOM maxEAF
9-88162029-G-T p.Pro1226Thr missense AGTPBP1 1 83004 1.20476E-5 41502 0 3.18512E-5
9-88162032-G-A p.Leu1225Leu synonymous AGTPBP1 1 83052 1.20406E-5 41526 0 4.08965E-6
9-88162040-C-T p.Arg1222Lys missense AGTPBP1 1 83090 1.20351E-5 41545 0 8.33528E-6
9-88162065-C-T p.Val1214Ile missense AGTPBP1 1 83132 1.20291E-5 41566 0 8.25369E-6
9-88162066-T-G p.Glu1213Asp missense AGTPBP1 597 83134 0.00718118 41567 3 0.00856855
9-88162077-C-T p.Ala1210Thr missense AGTPBP1 1 83144 1.20273E-5 41572 0 NA
9-88162077-CAGA-C p.Ser1209del conservative_inframe_deletion AGTPBP1 2 83144 2.40547E-5 41572 0 1.20077E-5
9-88162083-G-A p.Pro1208Ser missense AGTPBP1 1 83170 1.20236E-5 41585 0 4.94478E-5
9-88162088-T-TA p.Tyr1206fs frameshift AGTPBP1 2 83172 2.40466E-5 41586 0 3.99262E-6
9-88162089-A-T p.Tyr1206Asn missense AGTPBP1 1 83176 1.20227E-5 41588 0 NA
9-88162115-A-G p.Ile1197Thr missense AGTPBP1 2 83198 2.4039E-5 41599 0 NA
9-88162116-T-C p.Ile1197Val missense AGTPBP1 3 83196 3.60594E-5 41598 0 4.78244E-5
9-88162131-T-C p.Asn1192Asp missense AGTPBP1 2 83180 2.40442E-5 41590 0 NA
9-88162133-C-A p.Ser1191Ile missense AGTPBP1 5 83180 6.01106E-5 41590 0 4.94454E-5
9-88162156-T-G p.Glu1183Asp missense AGTPBP1 1 83158 1.20253E-5 41579 0 NA
9-88162162-G-C p.Phe1181Leu missense AGTPBP1 2 83144 2.40547E-5 41572 0 NA
9-88162167-G-A p.Arg1180* stop_gained AGTPBP1 1 83126 1.20299E-5 41563 0 2.80348E-5
9-88162171-T-C p.Asn627Ser missense AGTPBP1 4 83114 4.81267E-5 41557 0 4.46059E-4
9-88162178-T-C p.Glu1176Gly missense AGTPBP1 7 83074 8.42622E-5 41537 0 6.36943E-5
9-88162182-C-G p.Asp1175His missense AGTPBP1 1 83064 1.20389E-5 41532 0 NA
9-88162188-C-T p.Val1173Ile missense AGTPBP1 1 83038 1.20427E-5 41519 0 NA
9-88162192-A-C p.Leu620Arg missense AGTPBP1 1 83022 1.2045E-5 41511 0 NA
9-88162206-A-C c.*2605-5T>G splice_region AGTPBP1 2 82912 2.4122E-5 41456 0 NA
9-88190233-G-C p.Thr1167Ser missense AGTPBP1 1 81500 1.22699E-5 40750 0 8.33528E-6
9-88190245-C-G p.Ser1163Thr missense AGTPBP1 1 81814 1.22228E-5 40907 0 4.22319E-6
9-88190258-A-T p.Leu1159Ile missense AGTPBP1 1 82214 1.21634E-5 41107 0 NA
9-88190258-A-G p.Leu1159Leu synonymous AGTPBP1 1 82212 1.21637E-5 41106 0 3.18878E-5
9-88190262-A-G p.Asn1157Asn synonymous AGTPBP1 10 82264 1.2156E-4 41132 0 4.2089E-5
9-88190289-C-T p.Leu1148Leu synonymous AGTPBP1 1 82666 1.20969E-5 41333 0 NA
9-88190298-C-T p.Glu1145Glu synonymous AGTPBP1 3 82830 3.62188E-5 41415 0 1.64965E-5
9-88190313-C-T p.Leu1140Leu synonymous AGTPBP1 1 82968 1.20528E-5 41484 0 6.37592E-5
9-88190314-A-G p.Leu1140Pro missense AGTPBP1 1 82960 1.2054E-5 41480 0 3.18593E-5
9-88190326-C-T p.Arg1136His missense AGTPBP1 2 82984 2.4101E-5 41492 0 5.03525E-4
9-88190327-G-A p.Arg1136Cys missense AGTPBP1 3 82998 3.61454E-5 41499 0 4.02531E-6
9-88190336-C-T p.Gly1133Ser missense AGTPBP1 6 83000 7.22892E-5 41500 0 6.25E-4
9-88190348-T-C p.Lys1129Glu missense AGTPBP1 52 82956 6.26838E-4 41478 0 0.00152973
9-88190358-C-G p.Glu1125Asp missense AGTPBP1 2 82906 2.41237E-5 41453 0 6.37227E-5
9-88190371-C-T p.Arg1121Gln missense AGTPBP1 17 82844 2.05205E-4 41422 0 0.00100705
9-88190372-G-A p.Arg1121* stop_gained AGTPBP1 1 82822 1.20741E-5 41411 0 3.18979E-5
9-88190378-C-T p.Gly1119Ser missense AGTPBP1 1 82788 1.2079E-5 41394 0 3.18857E-5
9-88193833-A-G c.*2443+2T>C splice_donor AGTPBP1 1 82996 1.20488E-5 41498 0 NA
9-88193839-T-C p.Tyr1113Cys missense AGTPBP1 1 83022 1.2045E-5 41511 0 NA
9-88193842-T-C p.Lys1112Arg missense AGTPBP1 2 83026 2.40888E-5 41513 0 5.03525E-4
9-88193848-T-C p.Gln1110Arg missense AGTPBP1 4 83076 4.81487E-5 41538 0 4.94381E-5
9-88193854-C-A p.Cys1108Phe missense AGTPBP1 2 83142 2.40552E-5 41571 0 3.99163E-6
9-88193862-T-C p.Leu1105Leu synonymous AGTPBP1 1 83196 1.20198E-5 41598 0 3.98572E-6
9-88193880-A-T p.Tyr1099* stop_gained AGTPBP1 1 83242 1.20132E-5 41621 0 NA
9-88193895-T-A p.Gly1094Gly synonymous AGTPBP1 4 83282 4.80296E-5 41641 0 1.64758E-5
9-88193920-C-T p.Arg1086His missense AGTPBP1 1 83316 1.20025E-5 41658 0 NA
9-88193925-T-C p.Thr1084Thr synonymous AGTPBP1 2 83318 2.40044E-5 41659 0 8.23886E-6
9-88193928-G-A p.Ser1083Ser synonymous AGTPBP1 1 83316 1.20025E-5 41658 0 NA
9-88193939-A-AT p.Ser1080fs frameshift AGTPBP1 1 83318 1.20022E-5 41659 0 NA
9-88193941-T-C p.Lys1079Arg missense AGTPBP1 18 83318 2.1604E-4 41659 0 5.03525E-4
9-88193952-G-A p.Phe1075Phe synonymous AGTPBP1 1 83328 1.20008E-5 41664 0 1.64804E-5
9-88193955-G-C p.Ser1074Arg missense AGTPBP1 1 83332 1.20002E-5 41666 0 2.47211E-5
9-88193969-T-C p.Met1070Val missense AGTPBP1 1 83312 1.20031E-5 41656 0 NA
9-88193970-G-A p.Cys1069Cys synonymous AGTPBP1 4 83316 4.801E-5 41658 0 4.04527E-5
9-88193971-C-A p.Cys1069Phe missense AGTPBP1 52 83308 6.2419E-4 41654 0 0.0040282
9-88193979-T-C p.Pro1066Pro synonymous AGTPBP1 1 83298 1.20051E-5 41649 0 6.3674E-5
9-88193984-C-T p.Ala1065Thr missense AGTPBP1 1 83272 1.20088E-5 41636 0 NA
9-88193999-T-A p.Ile1060Leu missense AGTPBP1 1 83228 1.20152E-5 41614 0 NA
9-88194000-C-A p.Lys1059Asn missense AGTPBP1 1 83210 1.20178E-5 41605 0 4.27077E-6
9-88194001-T-C p.Lys1059Arg missense AGTPBP1 3 83210 3.60534E-5 41605 0 5.14774E-5
9-88194016-TA-T c.*2267-6delT splice_region AGTPBP1 1 83084 1.2036E-5 41542 0 4.58821E-6
9-88194018-A-C c.*2267-7T>G splice_region AGTPBP1 1 83076 1.20372E-5 41538 0 3.18471E-5
9-88200371-T-G c.*2266+7A>C splice_region AGTPBP1 2 82466 2.42524E-5 41233 0 1.66187E-5
9-88200372-A-C c.*2266+6T>G splice_region AGTPBP1 2 82492 2.42448E-5 41246 0 9.55231E-5
9-88200378-C-A p.Arg1055Ser missense+splice_region AGTPBP1 1 82712 1.20901E-5 41356 0 3.18695E-5
9-88200383-A-G p.Tyr1054His missense AGTPBP1 1 82790 1.20788E-5 41395 0 NA
9-88200388-G-A p.Thr1052Met missense AGTPBP1 3 82852 3.62091E-5 41426 0 3.18654E-5
9-88200424-T-C p.Asn1040Ser missense AGTPBP1 2 83062 2.40784E-5 41531 0 4.12038E-5
9-88200428-T-C p.Thr1039Ala missense AGTPBP1 1 83064 1.20389E-5 41532 0 NA
9-88200439-G-C p.Thr1035Arg missense AGTPBP1 1 83086 1.20357E-5 41543 0 NA
9-88200445-T-C p.Lys1033Arg missense AGTPBP1 1 83092 1.20349E-5 41546 0 NA
9-88200483-G-T p.Ser1020Ser synonymous AGTPBP1 1 82810 1.20758E-5 41405 0 NA
9-88200489-G-A p.Gly1018Gly synonymous AGTPBP1 1 82768 1.2082E-5 41384 0 8.24824E-6
9-88200507-A-G p.Val1012Val splice_region+synonymous AGTPBP1 1 82510 1.21197E-5 41255 0 NA
9-88200509-C-T p.Val1012Ile missense+splice_region AGTPBP1 1 82464 1.21265E-5 41232 0 3.18939E-5
9-88200509-C-CCAAGGGTAAACG c.*2135-1_*2135insCGTTTACCCTTG splice_acceptor AGTPBP1 2 82464 2.4253E-5 41232 1 NA
9-88200510-C-CAAGGGTAAACGCTTCACTGCAGCCAAGTA c.*2135-2_*2135-1insTACTTGGCTGCAGTGAAGCGTTTACCCTT splice_acceptor AGTPBP1 2 82432 2.42624E-5 41216 1 NA
9-88200510-C-CAAGGG c.*2135-2_*2135-1insCCCTT splice_acceptor AGTPBP1 1 82432 1.21312E-5 41216 0 NA
9-88200511-TTG-T c.*2135-4_*2135-3delCA splice_region AGTPBP1 1 82192 1.21666E-5 41096 0 NA
9-88200511-T-TAATTTGGCCTGGAGCGGTGGCTCATGCC c.*2135-3_*2135-2insGGCATGAGCCACCGCTCCAGGCCAAATT splice_region AGTPBP1 1 82192 1.21666E-5 41096 0 NA
9-88201746-C-G p.Leu1011Phe missense+splice_region AGTPBP1 15 83278 1.8012E-4 41639 0 7.77655E-4
9-88201746-C-T p.Leu1011Leu splice_region+synonymous AGTPBP1 1 83278 1.2008E-5 41639 0 NA
9-88201752-T-G p.Leu1009Phe missense AGTPBP1 1 83290 1.20062E-5 41645 0 NA
9-88201756-C-T p.Arg1008His missense AGTPBP1 1 83302 1.20045E-5 41651 0 3.18654E-5
9-88201757-G-A p.Arg1008Cys missense AGTPBP1 2 83302 2.4009E-5 41651 0 3.18613E-5
9-88201765-G-A p.Ala1005Val missense AGTPBP1 1 83314 1.20028E-5 41657 0 8.24402E-6
9-88201767-A-C p.Ala1004Ala synonymous AGTPBP1 2 83318 2.40044E-5 41659 0 3.9789E-6
9-88201806-A-T p.Pro991Pro synonymous AGTPBP1 1 83338 1.19993E-5 41669 0 7.95494E-6
9-88201818-C-T p.Pro987Pro synonymous AGTPBP1 4 83326 4.80042E-5 41663 0 2.10814E-4
9-88201827-A-G p.Ser984Ser synonymous AGTPBP1 14 83322 1.68023E-4 41661 0 6.25E-4
9-88201849-T-A p.Asp977Val missense AGTPBP1 1 83326 1.20011E-5 41663 0 NA
9-88201863-A-G p.Ser972Ser synonymous AGTPBP1 158 83314 0.00189644 41657 1 0.00366666
9-88201864-G-C p.Ser972Cys missense AGTPBP1 1 83316 1.20025E-5 41658 0 3.97921E-6
9-88201867-C-T p.Cys971Tyr missense AGTPBP1 1 83314 1.20028E-5 41657 0 NA
9-88201878-A-G c.*2005-3T>C splice_region AGTPBP1 1 83268 1.20094E-5 41634 0 NA
9-88201881-T-C c.*2005-6A>G splice_region AGTPBP1 1 83264 1.201E-5 41632 0 3.98064E-6
9-88203207-A-G c.*2004+6T>C splice_region AGTPBP1 1 82670 1.20963E-5 41335 0 NA
9-88203215-T-G p.Gly967Gly splice_region+synonymous AGTPBP1 2 82804 2.41534E-5 41402 0 NA
9-88203248-G-T p.Val956Val synonymous AGTPBP1 1 83056 1.20401E-5 41528 0 3.32298E-5
9-88203264-T-C p.Tyr951Cys missense AGTPBP1 1 83116 1.20314E-5 41558 0 8.29064E-6
9-88203264-T-A p.Tyr951Phe missense AGTPBP1 1 83116 1.20314E-5 41558 0 4.0474E-6
9-88203272-T-G p.Arg948Arg synonymous AGTPBP1 5 83110 6.01612E-5 41555 0 NA
9-88203288-G-C p.Thr943Ser missense AGTPBP1 2 83172 2.40466E-5 41586 0 NA
9-88203291-G-A p.Pro942Leu missense AGTPBP1 1 83176 1.20227E-5 41588 0 8.27198E-6
9-88203292-G-A p.Pro942Ser missense AGTPBP1 28 83174 3.36644E-4 41587 0 0.00302115
9-88203299-G-T p.Ser939Arg missense AGTPBP1 2 83184 2.40431E-5 41592 0 3.18613E-5
9-88203316-A-G p.Leu934Leu synonymous AGTPBP1 1 83220 1.20163E-5 41610 0 3.98464E-6
9-88203341-A-G p.Asn925Asn synonymous AGTPBP1 3 83196 3.60594E-5 41598 0 6.36983E-5
9-88203367-C-A p.Ala917Ser missense AGTPBP1 1 83140 1.20279E-5 41570 0 NA
9-88203373-A-G p.Leu915Leu synonymous AGTPBP1 1 83138 1.20282E-5 41569 0 NA
9-88203379-C-T p.Val913Ile missense AGTPBP1 3 83112 3.60959E-5 41556 0 1.66094E-5
9-88203379-CG-C p.Tyr912fs frameshift AGTPBP1 2 83112 2.40639E-5 41556 0 8.30468E-6
9-88203401-A-G c.*1824-8T>C splice_region AGTPBP1 12 82878 1.44791E-4 41439 0 6.37105E-5
9-88204456-A-G p.His903His synonymous AGTPBP1 1 83164 1.20244E-5 41582 0 1.68081E-5
9-88204470-T-TATA p.Ser898_Asn899insTyr conservative_inframe_insertion AGTPBP1 2 83208 2.40361E-5 41604 0 4.02376E-6
9-88204519-C-G p.Leu882Leu synonymous AGTPBP1 2 83280 2.40154E-5 41640 0 NA
9-88204537-A-G p.Asp876Asp synonymous AGTPBP1 1 83280 1.20077E-5 41640 0 NA
9-88204540-T-A p.Lys875Asn missense AGTPBP1 1 83272 1.20088E-5 41636 0 3.18451E-5
9-88204544-C-T p.Arg874Gln missense AGTPBP1 2 83258 2.40217E-5 41629 0 3.18634E-5
9-88204557-G-C p.Gln870Glu missense AGTPBP1 1 83236 1.2014E-5 41618 0 3.18634E-5
9-88204570-T-C p.Ala865Ala synonymous AGTPBP1 1 83182 1.20218E-5 41591 0 NA
9-88204594-C-A p.Met857Ile missense+splice_region AGTPBP1 1 82968 1.20528E-5 41484 0 4.18564E-6
9-88204596-T-C p.Met857Val missense+splice_region AGTPBP1 7 82936 8.44024E-5 41468 0 6.37064E-5
9-88204603-A-T c.*1670-7T>A splice_region AGTPBP1 1 82716 1.20896E-5 41358 0 NA
9-88207490-C-T p.Thr851Thr synonymous AGTPBP1 2 82640 2.42014E-5 41320 0 2.47913E-5
9-88207499-A-G p.Tyr848Tyr synonymous AGTPBP1 1 82784 1.20796E-5 41392 0 NA
9-88207516-A-G p.Tyr843His missense AGTPBP1 1 82922 1.20595E-5 41461 0 3.18776E-5
9-88207522-C-A p.Val841Phe missense AGTPBP1 2 82960 2.4108E-5 41480 0 3.18796E-5
9-88207527-T-C p.Asp839Gly missense AGTPBP1 2 82960 2.4108E-5 41480 0 1.59785E-5
9-88207542-T-C p.Asn834Ser missense AGTPBP1 1 83004 1.20476E-5 41502 0 NA
9-88207546-C-T p.Val833Ile missense AGTPBP1 1 82996 1.20488E-5 41498 0 NA
9-88207563-T-G p.Tyr827Ser missense AGTPBP1 1 83022 1.2045E-5 41511 0 NA
9-88207577-C-T p.Lys822Lys synonymous AGTPBP1 51 83030 6.14236E-4 41515 0 0.00125
9-88207581-T-G p.Gln821Pro missense AGTPBP1 1 83022 1.2045E-5 41511 0 NA
9-88207601-ACTT-A p.Arg813del disruptive_inframe_deletion AGTPBP1 1 82998 1.20485E-5 41499 0 NA
9-88207610-G-T p.Phe811Leu missense AGTPBP1 16 82972 1.92836E-4 41486 0 1.40121E-4
9-88211279-A-G p.Tyr807Tyr splice_region+synonymous AGTPBP1 2 82202 2.43303E-5 41101 0 5.04541E-4
9-88211312-C-G p.Trp796Cys missense AGTPBP1 1 82576 1.21101E-5 41288 0 8.70913E-6
9-88211317-G-T p.Pro795Thr missense AGTPBP1 2 82590 2.4216E-5 41295 0 NA
9-88211341-C-T p.Val787Ile missense AGTPBP1 6 82516 7.27132E-5 41258 0 1.91119E-4
9-88211342-C-T p.Ser786Ser synonymous AGTPBP1 1 82382 1.21386E-5 41191 0 2.02519E-5
9-88211362-T-C p.Met780Val missense+splice_region AGTPBP1 1 82060 1.21862E-5 41030 0 NA
9-88211365-C-A c.*1437-1G>T splice_acceptor AGTPBP1 2 81886 2.44242E-5 40943 0 NA
9-88211371-AAGAG-A c.*1437-11_*1437-8delCTCT splice_region AGTPBP1 1 81368 1.22898E-5 40684 0 NA
9-88233890-T-C c.*1436+8A>G splice_region AGTPBP1 6 82586 7.26515E-5 41293 0 1.66305E-5
9-88233898-C-T p.Gly779Ser missense+splice_region AGTPBP1 1 82770 1.20817E-5 41385 0 NA
9-88233914-G-A p.Asn773Asn synonymous AGTPBP1 2 82878 2.41319E-5 41439 0 8.26638E-6
9-88233919-A-G p.Ser772Pro missense AGTPBP1 2 82872 2.41336E-5 41436 0 1.65248E-5
9-88233952-C-A p.Ala761Ser missense AGTPBP1 1 82870 1.20671E-5 41435 0 NA
9-88233957-C-T p.Gly759Asp missense AGTPBP1 4 82838 4.8287E-5 41419 0 2.47811E-5
9-88233970-C-T p.Gly755Arg missense AGTPBP1 3 82818 3.6224E-5 41409 0 3.18451E-5
9-88233981-A-C p.Phe751Cys missense AGTPBP1 2 82754 2.4168E-5 41377 0 NA
9-88234000-A-G p.Tyr745His missense AGTPBP1 1 82730 1.20875E-5 41365 0 NA
9-88234003-G-A p.His744Tyr missense AGTPBP1 1 82730 1.20875E-5 41365 0 NA
9-88234008-C-T p.Ser742Asn missense AGTPBP1 1 82714 1.20899E-5 41357 0 NA
9-88234038-T-A p.Tyr732Phe missense AGTPBP1 1 82730 1.20875E-5 41365 0 NA
9-88234046-TCTGAAAATAGAAGACAAAGAAATCTGATGAAAATTAGGAAATATCTGTGCACATACAAAATGAGAAAATCTTAAGTGACTTAC-T c.*1287+1_*1288-1delGTAAGTCACTTAAGATTTTCTCATTTTGTATGTGCACAGATATTTCCTAATTTTCATCAGATTTCTTTGTCTTCTATTTTCAG splice_acceptor AGTPBP1 10 82712 1.20901E-4 41356 3 NA
9-88234131-T-G p.Lys729Gln missense+splice_region AGTPBP1 2 82956 2.41092E-5 41478 0 NA
9-88234159-C-A p.Gly719Gly synonymous AGTPBP1 1 82988 1.20499E-5 41494 0 NA
9-88234188-A-G p.Leu710Leu synonymous AGTPBP1 7 82912 8.44269E-5 41456 0 1.0081E-4
9-88234190-A-G p.Ile709Thr missense AGTPBP1 1 82908 1.20616E-5 41454 0 6.45614E-5
9-88234200-C-G p.Glu706Gln missense AGTPBP1 2 82858 2.41377E-5 41429 0 9.55183E-6
9-88234200-C-T p.Glu706Lys missense AGTPBP1 1 82858 1.20688E-5 41429 0 NA
9-88234206-G-T p.Pro704Thr missense AGTPBP1 1 82786 1.20793E-5 41393 0 NA
9-88234210-G-C p.Thr702Thr synonymous AGTPBP1 1 82764 1.20825E-5 41382 0 2.04461E-5
9-88236125-A-C p.Asp697Glu missense AGTPBP1 3 77312 3.88038E-5 38656 0 6.06693E-6
9-88236134-A-G p.Tyr694Tyr synonymous AGTPBP1 4 77776 5.14297E-5 38888 0 2.9953E-5
9-88236135-T-A p.Tyr694Phe missense AGTPBP1 1 77790 1.28551E-5 38895 0 8.33097E-6
9-88236145-G-A p.Arg691Cys missense AGTPBP1 7 77684 9.01086E-5 38842 0 1.7472E-4
9-88236146-A-G p.Asp690Asp synonymous AGTPBP1 2 77936 2.56621E-5 38968 0 NA
9-88236150-A-G p.Ile689Thr missense AGTPBP1 11 77892 1.41221E-4 38946 0 0.00151057
9-88236151-T-C p.Ile689Val missense AGTPBP1 3 77964 3.84793E-5 38982 0 3.19122E-5
9-88236152-G-A p.Ile688Ile synonymous AGTPBP1 4 77942 5.13202E-5 38971 1 4.1587E-5
9-88236155-A-G p.Asp687Asp synonymous AGTPBP1 1 77608 1.28853E-5 38804 0 NA
9-88236173-C-A p.Arg681Ser missense AGTPBP1 1 76788 1.30229E-5 38394 0 NA
9-88236177-T-G p.Glu680Ala missense AGTPBP1 1 76252 1.31144E-5 38126 0 NA
9-88236189-G-A p.Ala676Val missense AGTPBP1 1 76200 1.31234E-5 38100 0 NA
9-88247586-C-A p.Gly669Val missense AGTPBP1 2 82848 2.41406E-5 41424 0 4.11831E-6
9-88247590-A-T p.Tyr668Asn missense AGTPBP1 1 82890 1.20642E-5 41445 0 NA
9-88247624-C-T p.Pro656Pro synonymous AGTPBP1 1 82996 1.20488E-5 41498 0 3.18695E-5
9-88247645-G-A p.Pro649Pro synonymous AGTPBP1 11 83026 1.32489E-4 41513 0 1.3226E-4
9-88247668-C-G p.Glu642Gln missense AGTPBP1 1 83084 1.2036E-5 41542 0 3.18451E-5
9-88247670-G-A p.Pro641Leu missense AGTPBP1 1 83080 1.20366E-5 41540 0 NA
9-88247672-G-C p.Val640Val synonymous AGTPBP1 1 83082 1.20363E-5 41541 0 NA
9-88247681-C-A p.Thr637Thr synonymous AGTPBP1 1 83112 1.2032E-5 41556 0 8.24348E-6
9-88247681-C-T p.Thr637Thr synonymous AGTPBP1 1 83112 1.2032E-5 41556 0 8.24348E-6
9-88247682-G-A p.Thr637Met missense AGTPBP1 2 83110 2.40645E-5 41555 0 1.5922E-5
9-88247685-T-C p.Asn636Ser missense AGTPBP1 13 83130 1.56382E-4 41565 0 2.86533E-4
9-88247689-T-G p.Lys635Gln missense AGTPBP1 3 83136 3.60855E-5 41568 0 6.3674E-5
9-88247715-T-A p.Asp626Val missense AGTPBP1 4 83220 4.80654E-5 41610 0 NA
9-88247729-T-C p.Gly621Gly synonymous AGTPBP1 1 83222 1.20161E-5 41611 0 3.1841E-5
9-88247734-C-G p.Asp620His missense AGTPBP1 1 83226 1.20155E-5 41613 0 NA
9-88247759-T-C p.Val611Val synonymous AGTPBP1 1 83180 1.20221E-5 41590 0 7.96026E-6
9-88247762-C-T p.Ser610Ser synonymous AGTPBP1 1 83178 1.20224E-5 41589 0 8.24226E-6
9-88247834-T-G p.Thr586Thr synonymous AGTPBP1 2 83008 2.40941E-5 41504 0 1.64856E-5
9-88247835-G-A p.Thr586Ile missense AGTPBP1 1 83004 1.20476E-5 41502 0 3.18451E-5
9-88247839-T-C p.Arg585Gly missense AGTPBP1 1 83002 1.20479E-5 41501 0 NA
9-88247856-T-C p.Asn579Ser missense AGTPBP1 13 83024 1.56581E-4 41512 0 3.18329E-5
9-88247882-T-A p.Ala570Ala synonymous AGTPBP1 1 83112 1.2032E-5 41556 0 NA
9-88247894-G-A p.Thr566Thr synonymous AGTPBP1 30 83152 3.60785E-4 41576 1 5.03525E-4
9-88247899-G-C p.Leu565Val missense AGTPBP1 1 83160 1.2025E-5 41580 0 3.98124E-6
9-88247900-G-A p.Val564Val synonymous AGTPBP1 1 83170 1.20236E-5 41585 0 NA
9-88247905-T-C p.Thr563Ala missense AGTPBP1 1 83190 1.20207E-5 41595 0 NA
9-88247907-A-G p.Leu562Pro missense AGTPBP1 1 83208 1.20181E-5 41604 0 NA
9-88247949-G-A p.Pro548Leu missense AGTPBP1 1 83286 1.20068E-5 41643 0 3.97931E-6
9-88247965-G-A p.Pro543Ser missense AGTPBP1 1 83274 1.20085E-5 41637 0 NA
9-88247978-T-C p.Thr538Thr synonymous AGTPBP1 1 83294 1.20057E-5 41647 0 3.97867E-6
9-88247985-C-T p.Arg536Gln missense AGTPBP1 2 83276 2.40165E-5 41638 0 1.64894E-4
9-88247999-T-C p.Val531Val synonymous AGTPBP1 1 83268 1.20094E-5 41634 0 6.3674E-5
9-88248006-T-C p.Asp529Gly missense AGTPBP1 2 83266 2.40194E-5 41633 0 1.64929E-5
9-88248007-CATT-C p.Asn528del conservative_inframe_deletion AGTPBP1 21 83266 2.52204E-4 41633 0 3.18492E-4
9-88248009-T-C p.Asn528Ser missense AGTPBP1 3 83270 3.60274E-5 41635 0 NA
9-88248019-C-T p.Gly525Ser missense AGTPBP1 1 83264 1.201E-5 41632 0 3.18471E-5
9-88248021-T-C p.His524Arg missense AGTPBP1 13 83260 1.56137E-4 41630 0 1.27364E-4
9-88248022-G-A p.His524Tyr missense AGTPBP1 2 83260 2.40211E-5 41630 0 8.24933E-6
9-88248029-T-C p.Ser521Ser synonymous AGTPBP1 243 83250 0.00291892 41625 4 0.003125
9-88248029-T-A p.Ser521Ser synonymous AGTPBP1 1 83256 1.20111E-5 41628 0 NA
9-88248034-T-C p.Ile520Val missense AGTPBP1 8 83248 9.60984E-5 41624 0 1.27397E-4
9-88248037-T-C p.Thr519Ala missense AGTPBP1 2 83246 2.40252E-5 41623 0 5.04032E-4
9-88248038-T-C p.Arg518Arg synonymous AGTPBP1 1 83250 1.2012E-5 41625 0 NA
9-88248056-C-T p.Gln512Gln synonymous AGTPBP1 5 83198 6.00976E-5 41599 0 8.25982E-6
9-88248072-C-T p.Arg507Lys missense AGTPBP1 1 83166 1.20241E-5 41583 0 NA
9-88248074-A-G p.Asp506Asp synonymous AGTPBP1 1 83162 1.20247E-5 41581 0 8.26788E-6
9-88248077-A-T p.Asn505Lys missense AGTPBP1 1 83160 1.2025E-5 41580 0 8.26788E-6
9-88248085-T-C p.Lys503Glu missense AGTPBP1 3 83142 3.60828E-5 41571 0 1.19867E-5
9-88248088-T-C p.Ile502Val missense AGTPBP1 2 83128 2.40593E-5 41564 0 8.26938E-6
9-88248107-C-T p.Met495Ile missense AGTPBP1 1 83062 1.20392E-5 41531 0 NA
9-88248108-A-G p.Met495Thr missense AGTPBP1 1 83054 1.20404E-5 41527 0 8.26843E-6
9-88248114-G-A p.Thr493Ile missense AGTPBP1 1 83026 1.20444E-5 41513 0 1.19916E-5
9-88248115-T-C p.Thr493Ala missense AGTPBP1 1 83028 1.20441E-5 41514 0 3.99722E-6
9-88248117-G-A p.Ser492Phe missense AGTPBP1 1 83020 1.20453E-5 41510 0 2.4804E-5
9-88248118-ACTTCTTTTCACCTTCATCTCCTT-A p.Lys484fs frameshift AGTPBP1 1 83012 1.20465E-5 41506 0 NA
9-88248145-A-C p.Ser483Ala missense AGTPBP1 10 82894 1.20636E-4 41447 0 5.12812E-4
9-88248145-A-T p.Ser483Thr missense AGTPBP1 1 82894 1.20636E-5 41447 0 3.18492E-5
9-88248148-A-G p.Ser482Pro missense AGTPBP1 3 82886 3.61943E-5 41443 0 1.99437E-5
9-88248152-G-A p.Asn480Asn synonymous AGTPBP1 3 82852 3.62091E-5 41426 0 1.27421E-4
9-88248181-T-C p.Asn471Asp missense AGTPBP1 2 82544 2.42295E-5 41272 0 NA
9-88248197-T-C p.Thr465Thr synonymous AGTPBP1 1 82316 1.21483E-5 41158 0 NA
9-88248204-T-C p.Glu463Gly missense AGTPBP1 1 81944 1.22035E-5 40972 0 NA
9-88248205-C-T p.Glu463Lys missense AGTPBP1 1 82106 1.21794E-5 41053 0 3.18512E-5
9-88248206-G-A p.Gly462Gly synonymous AGTPBP1 2 81994 2.4392E-5 40997 0 3.18715E-5
9-88248210-G-C p.Ala461Gly missense AGTPBP1 3 82148 3.65195E-5 41074 0 9.55292E-5
9-88248213-G-A p.Thr460Met missense AGTPBP1 2 82106 2.43588E-5 41053 0 4.42172E-5
9-88248219-A-G p.Val458Ala missense AGTPBP1 1 82010 1.21936E-5 41005 0 6.79371E-5
9-88248222-A-C p.Val457Gly missense AGTPBP1 2 81968 2.43998E-5 40984 0 3.18329E-5
9-88248223-C-T p.Val457Ile missense AGTPBP1 2 81964 2.4401E-5 40982 0 1.21327E-5
9-88248228-G-T p.Pro455His missense AGTPBP1 1 81792 1.22261E-5 40896 0 NA
9-88248235-G-C p.Arg453Gly missense AGTPBP1 1 81364 1.22904E-5 40682 0 NA
9-88248239-T-C p.Lys451Lys synonymous AGTPBP1 582 81196 0.00716784 40598 6 0.0275
9-88248270-T-A p.Lys441Ile missense AGTPBP1 1 79356 1.26014E-5 39678 0 NA
9-88248276-A-C p.Ile439Ser missense AGTPBP1 1 78778 1.26939E-5 39389 0 NA
9-88248278-T-A p.Leu438Phe missense AGTPBP1 1 78642 1.27159E-5 39321 0 NA
9-88248285-T-C p.Tyr436Cys missense AGTPBP1 1 77980 1.28238E-5 38990 0 7.41496E-5
9-88248287-G-T p.Asp435Glu missense+splice_region AGTPBP1 1 77768 1.28588E-5 38884 0 9.30925E-6
9-88248292-T-G c.*404-3A>C splice_region AGTPBP1 1 76826 1.30164E-5 38413 0 1.27348E-4
9-88257736-T-C c.*403+6A>G splice_region AGTPBP1 1 82354 1.21427E-5 41177 0 NA
9-88257755-A-G p.Val430Ala missense AGTPBP1 1 82750 1.20846E-5 41375 0 NA
9-88257771-G-A p.Leu425Phe missense AGTPBP1 1 82914 1.20607E-5 41457 0 7.99655E-6
9-88257775-T-A p.Glu423Asp missense AGTPBP1 1 82946 1.2056E-5 41473 0 NA
9-88257796-T-C p.Ile416Met missense AGTPBP1 3 83016 3.61376E-5 41508 0 NA
9-88257797-A-G p.Ile416Thr missense AGTPBP1 7 83008 8.43292E-5 41504 0 6.37999E-5
9-88257799-T-G p.Thr415Thr synonymous AGTPBP1 2 83016 2.40917E-5 41508 0 3.18512E-5
9-88257803-C-T p.Arg414Gln missense AGTPBP1 1 82988 1.20499E-5 41494 0 NA
9-88257808-C-T p.Pro412Pro synonymous AGTPBP1 2 82974 2.41039E-5 41487 0 7.96305E-6
9-88257809-G-A p.Pro412Leu missense AGTPBP1 1 82978 1.20514E-5 41489 0 8.2739E-6
9-88257811-T-A p.Glu411Asp missense AGTPBP1 22 82980 2.65124E-4 41490 0 9.19586E-4
9-88257830-T-C p.Lys405Arg missense AGTPBP1 1 82906 1.20619E-5 41453 0 3.98292E-6
9-88257839-T-C p.Asp402Gly missense AGTPBP1 1 82808 1.20761E-5 41404 0 1.19576E-5
9-88261232-T-A c.*286+4A>T splice_region AGTPBP1 2 82314 2.42972E-5 41157 0 3.1841E-5
9-88261238-TA-T p.Phe394fs frameshift AGTPBP1 2 82452 2.42565E-5 41226 0 4.00416E-6
9-88261257-A-G p.Asp388Asp synonymous AGTPBP1 1 82714 1.20899E-5 41357 0 NA
9-88261261-T-C p.Glu387Gly missense AGTPBP1 1 82730 1.20875E-5 41365 0 NA
9-88261269-A-C p.Thr384Thr synonymous AGTPBP1 2 82762 2.41657E-5 41381 0 1.66828E-5
9-88261274-C-T p.Glu383Lys missense AGTPBP1 1 82780 1.20802E-5 41390 0 8.33042E-6
9-88261284-T-C p.Glu379Glu synonymous AGTPBP1 2 82810 2.41517E-5 41405 0 NA
9-88261294-A-G p.Ile376Thr missense AGTPBP1 1 82780 1.20802E-5 41390 0 3.98858E-6
9-88261295-T-C p.Ile376Val missense AGTPBP1 1 82772 1.20814E-5 41386 0 3.98883E-6
9-88261297-T-C p.Asp375Gly missense AGTPBP1 2 82760 2.41663E-5 41380 0 NA
9-88261317-A-C p.Asp368Glu missense AGTPBP1 1 82658 1.2098E-5 41329 0 NA
9-88261325-C-T p.Val366Ile missense AGTPBP1 1 82492 1.21224E-5 41246 0 6.37105E-5
9-88261325-C-A p.Val366Leu missense AGTPBP1 1 82492 1.21224E-5 41246 0 NA
9-88270050-G-A c.*188+8C>T splice_region AGTPBP1 1 82518 1.21186E-5 41259 0 6.36983E-5
9-88270054-C-T c.*188+4G>A splice_region AGTPBP1 1 82602 1.21062E-5 41301 0 6.60839E-5
9-88270055-T-C c.*188+3A>G splice_region AGTPBP1 2 82616 2.42084E-5 41308 0 6.37064E-5
9-88270106-T-G p.Ile347Leu missense AGTPBP1 1 83164 1.20244E-5 41582 0 1.81038E-5
9-88270117-T-C c.*131-2A>G splice_acceptor AGTPBP1 1 83180 1.20221E-5 41590 0 NA
9-88270143-T-A p.Pro334Pro synonymous AGTPBP1 5 83208 6.00904E-5 41604 0 6.37064E-5
9-88270148-G-C p.Leu333Val missense AGTPBP1 1 83216 1.20169E-5 41608 0 1.41167E-5
9-88270156-C-T p.Arg330Gln missense AGTPBP1 1 83186 1.20213E-5 41593 0 NA
9-88270159-T-C p.Asn329Ser missense AGTPBP1 1 83194 1.20201E-5 41597 0 NA
9-88270218-C-T p.Gly227Glu missense AGTPBP1 209 82744 0.00252586 41372 0 0.0014979
9-88270227-C-T p.Trp224* stop_gained AGTPBP1 7 82138 8.52224E-5 41069 0 4.75587E-4
9-88272353-C-T n.789G>A splice_region AGTPBP1 1 82730 1.20875E-5 41365 0 1.21702E-5
9-88272361-T-C p.Asn300Asp missense AGTPBP1 1 82872 1.20668E-5 41436 0 8.70762E-6
9-88272368-A-G p.Ile297Ile synonymous AGTPBP1 1 82928 1.20587E-5 41464 0 NA
9-88272384-G-T p.Ala292Asp missense AGTPBP1 1 82994 1.20491E-5 41497 0 1.6769E-5
9-88272419-T-C p.Thr280Thr synonymous AGTPBP1 1 83042 1.20421E-5 41521 0 NA
9-88272435-C-G p.Ser275Thr missense AGTPBP1 1 83028 1.20441E-5 41514 0 3.18654E-5
9-88272463-T-C p.Met266Val missense AGTPBP1 1 83006 1.20473E-5 41503 0 NA
9-88272467-T-G p.Arg264Ser missense AGTPBP1 1 82994 1.20491E-5 41497 0 NA
9-88272474-C-T p.Arg262Gln missense AGTPBP1 2 82980 2.41022E-5 41490 0 6.37064E-5
9-88272478-T-A p.Asn261Tyr missense AGTPBP1 4 82994 4.81963E-5 41497 0 NA
9-88272482-A-G p.Ter189Argext*? stop_lost AGTPBP1 1 82984 1.20505E-5 41492 0 NA
9-88272516-A-G p.Val248Ala missense AGTPBP1 1 82966 1.20531E-5 41483 0 NA
9-88272518-T-C p.Ser177Gly missense AGTPBP1 2 82972 2.41045E-5 41486 0 3.58449E-5
9-88272524-A-G p.Cys175Arg missense AGTPBP1 1 82958 1.20543E-5 41479 0 1.65774E-5
9-88272533-G-A p.Gln172* stop_gained AGTPBP1 1 82922 1.20595E-5 41461 0 NA
9-88272548-G-A p.Gln167* stop_gained AGTPBP1 1 82766 1.20823E-5 41383 0 NA
9-88275859-A-G p.Leu231Pro missense AGTPBP1 1 82384 1.21383E-5 41192 0 4.3872E-6
9-88275873-AGTG-A p.Thr226del disruptive_inframe_deletion AGTPBP1 1 82500 1.21212E-5 41250 0 1.20224E-5
9-88275887-C-T p.Val222Ile missense+splice_region AGTPBP1 3 82378 3.64175E-5 41189 0 6.26566E-4
9-88284392-T-C c.488+8A>G splice_region AGTPBP1 99 81144 0.00122005 40572 1 0.0029016
9-88284413-A-G p.Ser159Pro missense AGTPBP1 5 81948 6.10143E-5 40974 0 1.59378E-4
9-88284428-A-T p.Phe154Ile missense AGTPBP1 1 82092 1.21815E-5 41046 0 1.65287E-5
9-88284452-G-C p.Leu146Val missense AGTPBP1 1 82102 1.218E-5 41051 0 4.12964E-5
9-88284458-C-G p.Val144Leu missense AGTPBP1 2 82102 2.43599E-5 41051 0 NA
9-88284484-G-T p.Ser135* stop_gained AGTPBP1 1 81882 1.22127E-5 40941 0 NA
9-88284486-A-G p.Asn134Asn synonymous AGTPBP1 2 81826 2.44421E-5 40913 0 1.9129E-4
9-88284496-G-A c.395-3C>T splice_region AGTPBP1 1 81696 1.22405E-5 40848 0 8.30248E-6
9-88287458-T-C c.394+7A>G splice_region AGTPBP1 18 83250 2.16216E-4 41625 0 1.56589E-4
9-88287476-T-C p.Tyr128Cys missense AGTPBP1 6 83326 7.20063E-5 41663 0 4.12201E-5
9-88287486-A-G p.Leu125Leu synonymous AGTPBP1 1 83348 1.19979E-5 41674 0 NA
9-88287512-C-T p.Arg116His missense AGTPBP1 5 83386 5.99621E-5 41693 0 4.11957E-5
9-88287512-C-A p.Arg116Leu missense AGTPBP1 1 83386 1.19924E-5 41693 0 NA
9-88287521-T-C p.Gln113Arg missense AGTPBP1 4 83396 4.79639E-5 41698 0 1.276E-4
9-88287537-C-T p.Val108Ile missense AGTPBP1 1 83386 1.19924E-5 41693 0 3.97722E-6
9-88287540-A-C p.Leu107Val missense AGTPBP1 3 83384 3.59781E-5 41692 0 NA
9-88287558-G-C p.Leu101Val missense AGTPBP1 1 83356 1.19967E-5 41678 0 NA
9-88287560-G-A p.Ala100Val missense AGTPBP1 1 83348 1.19979E-5 41674 0 NA
9-88287588-A-G p.Phe91Leu missense AGTPBP1 2 83134 2.40575E-5 41567 0 NA
9-88287590-T-G p.Lys90Thr missense AGTPBP1 1 83142 1.20276E-5 41571 0 4.43443E-6
9-88287601-T-A c.263-5A>T splice_region AGTPBP1 2 82966 2.41063E-5 41483 0 1.0469E-4
9-88287602-TA-T c.263-7delT splice_region AGTPBP1 2246 74742 0.03005 37371 24 0.138775
9-88287602-T-TA c.263-7_263-6insT splice_region AGTPBP1 199 79332 0.00250845 39666 1 0.0285733
9-88287602-T-TAA c.263-7_263-6insTT splice_region AGTPBP1 4 82892 4.82556E-5 41446 0 5.72039E-5
9-88287602-TAA-T c.263-8_263-7delTT splice_region AGTPBP1 1 82890 1.20642E-5 41445 0 2.55448E-4
9-88287603-A-T c.263-7T>A splice_region AGTPBP1 1 82654 1.20986E-5 41327 0 1.13028E-4
9-88292346-C-T c.262+5G>A splice_region AGTPBP1 1 82538 1.21156E-5 41269 0 0.003125
9-88292358-T-C p.Gly85Gly synonymous AGTPBP1 1 82710 1.20904E-5 41355 0 8.26091E-6
9-88292368-G-GC p.Ala82fs frameshift AGTPBP1 2 82820 2.41488E-5 41410 0 NA
9-88292375-T-C p.Ile80Val missense AGTPBP1 3 82832 3.62179E-5 41416 0 6.38121E-5
9-88292388-T-C p.Val75Val synonymous AGTPBP1 1 82932 1.20581E-5 41466 0 2.04312E-5
9-88292390-C-T p.Val75Ile missense AGTPBP1 6 82942 7.23397E-5 41471 0 3.38278E-4
9-88292393-T-C p.Met74Val missense AGTPBP1 3 82938 3.61716E-5 41469 0 1.91436E-4
9-88292394-T-C p.Leu73Leu synonymous AGTPBP1 431 82936 0.00519678 41468 7 0.00995215
9-88292410-G-T p.Pro68His missense AGTPBP1 48 82992 5.78369E-4 41496 0 0.00251762
9-88292431-A-G p.Met1? start_lost AGTPBP1 1 82948 1.20557E-5 41474 0 4.09035E-6
9-88292454-T-C p.Ser53Ser synonymous AGTPBP1 5 82764 6.04127E-5 41382 0 3.30251E-5
9-88292483-C-T p.Val44Met missense AGTPBP1 3 81770 3.66883E-5 40885 0 5.48348E-5
9-88292488-C-T p.Arg42Gln missense AGTPBP1 1 81248 1.2308E-5 40624 0 1.12686E-5
9-88292495-C-T p.Gly40Arg missense+splice_region AGTPBP1 1 80564 1.24125E-5 40282 0 9.92983E-5
9-88292497-C-T p.Gly39Asp missense+splice_region AGTPBP1 4 80304 4.98107E-5 40152 0 NA
9-88292499-T-TA c.116-3_116-2insT splice_region AGTPBP1 1 80346 1.24462E-5 40173 0 NA
9-88292500-A-C c.116-3T>G splice_region AGTPBP1 11 81360 1.35202E-4 40680 0 4.88043E-5
9-88292505-T-A c.116-8A>T splice_region AGTPBP1 3 80382 3.73218E-5 40191 0 2.97597E-4
9-88293267-A-G p.Val33Ala missense AGTPBP1 2 82162 2.43422E-5 41081 0 NA
9-88293279-A-G p.Leu29Ser missense AGTPBP1 1 82124 1.21767E-5 41062 0 NA
9-88293282-A-G p.Ile28Thr missense AGTPBP1 1 82070 1.21847E-5 41035 0 1.70248E-5
9-88293307-T-C p.Lys20Glu missense AGTPBP1 1 81594 1.22558E-5 40797 0 NA
9-88293313-T-C p.Asn18Asp missense+splice_region AGTPBP1 1 81422 1.22817E-5 40711 0 NA
9-88296193-G-A p.Ser14Leu missense AGTPBP1 1 83054 1.20404E-5 41527 0 1.66066E-5
9-88296197-G-T p.Leu13Met missense AGTPBP1 2 83064 2.40778E-5 41532 0 NA
9-88296209-T-C p.Met9Val missense AGTPBP1 2 83060 2.4079E-5 41530 0 NA
9-88296211-C-G p.Gly8Ala missense AGTPBP1 2 83072 2.40755E-5 41536 0 8.30192E-6
9-88296230-T-C p.Thr2Ala missense AGTPBP1 1 83060 1.20395E-5 41530 0 8.05678E-6
9-88296243-T-C p.Thr55Thr synonymous AGTPBP1 2 83038 2.40854E-5 41519 0 8.41E-6
9-88296243-T-G p.Thr55Thr synonymous AGTPBP1 1 83038 1.20427E-5 41519 0 5.03525E-4
9-88296252-T-TTGACTCTGAGCCAGATGAAGAATTTTTGATGTAACATATCGGGCA c.-17-3_-17-2insTGCCCGATATGTTACATCAAAAATTCTTCATCTGGCTCAGAGTCA splice_region AGTPBP1 1 82972 1.20523E-5 41486 0 NA
9-88307599-T-C c.-18+5A>G splice_region AGTPBP1 1 83052 1.20406E-5 41526 0 8.25396E-6
9-88307619-G-A c.-33C>T 5_prime_UTR_premature_start_codon_gain AGTPBP1 1 83186 1.20213E-5 41593 0 NA
9-88307622-G-A p.His47Tyr missense AGTPBP1 4 83188 4.80839E-5 41594 0 NA
9-88307645-C-G p.Arg39Pro missense AGTPBP1 1 83224 1.20158E-5 41612 0 NA
9-88307655-C-T p.Asp36Asn missense AGTPBP1 1 83254 1.20114E-5 41627 0 3.29701E-5
9-88307668-C-T p.Glu31Glu synonymous AGTPBP1 1 83230 1.20149E-5 41615 0 NA
9-88307675-T-C p.Asn29Ser missense AGTPBP1 1 83228 1.20152E-5 41614 0 2.47251E-5
9-88307677-G-T p.Ile28Ile synonymous AGTPBP1 5 83210 6.00889E-5 41605 0 1.19373E-5
9-88307683-C-T p.Glu26Glu synonymous AGTPBP1 1 83198 1.20195E-5 41599 0 3.9795E-6
9-88307706-C-T p.Val19Ile missense AGTPBP1 5 83162 6.01236E-5 41581 0 7.96407E-6
9-88307706-C-A p.Val19Leu missense AGTPBP1 1 83162 1.20247E-5 41581 0 8.24348E-6
9-88307707-G-A c.-121C>T 5_prime_UTR_premature_start_codon_gain AGTPBP1 2 83150 2.40529E-5 41575 0 5.04032E-4
9-88307720-T-C p.Asn14Ser missense AGTPBP1 107 83110 0.00128745 41555 0 8.66065E-4
9-88307727-G-T p.Leu12Ile missense+splice_region AGTPBP1 2 83114 2.40633E-5 41557 0 NA
9-88307733-A-C c.-142-5T>G splice_region AGTPBP1 3 83066 3.61159E-5 41533 0 1.20057E-4
9-88327428-T-C p.Ile7Met missense AGTPBP1 1 79214 1.2624E-5 39607 0 NA
9-88327431-C-A p.Val6Val synonymous AGTPBP1 6 79248 7.57117E-5 39624 0 7.86749E-4
9-88327478-T-C c.-204A>G 5_prime_UTR_premature_start_codon_gain AGTPBP1 14 77562 1.80501E-4 38781 0 7.6337E-5
9-88356682-G-A c.-208+8C>T splice_region AGTPBP1 1 67972 1.47119E-5 33986 0 NA
9-88356691-G-A p.Arg63Cys missense+splice_region AGTPBP1 1 66600 1.5015E-5 33300 0 NA
9-88356698-G-A p.Ile60Ile synonymous AGTPBP1 1 65866 1.51823E-5 32933 0 NA
9-88356700-T-C p.Ile60Val missense AGTPBP1 1 65332 1.53064E-5 32666 0 NA
9-88356708-T-C p.Gln57Arg missense AGTPBP1 3 63468 4.72679E-5 31734 0 NA
9-88356709-G-A p.Gln57* stop_gained AGTPBP1 4 63358 6.31333E-5 31679 0 3.19836E-5
9-88356710-G-A p.Arg56Arg synonymous AGTPBP1 4 62788 6.37064E-5 31394 0 NA
9-88356720-C-A p.Arg53Leu missense AGTPBP1 1 59576 1.67853E-5 29788 0 NA
9-88356721-GC-G p.Arg53fs frameshift AGTPBP1 6 59512 1.0082E-4 29756 0 0.00242522
9-88356724-G-A c.-242C>T 5_prime_UTR_premature_start_codon_gain AGTPBP1 3 59384 5.05187E-5 29692 0 0.00194049
9-88356728-C-G p.Ala50Ala synonymous AGTPBP1 2 57758 3.46272E-5 28879 0 6.39918E-5
9-88356728-C-T p.Ala50Ala synonymous AGTPBP1 1 57758 1.73136E-5 28879 0 NA
9-88356729-G-T p.Ala50Glu missense AGTPBP1 1 57656 1.73442E-5 28828 0 NA
9-88356743-A-G p.Ala45Ala synonymous AGTPBP1 9214 51778 0.177952 25889 976 0.334353
9-88356743-AG-GA p.Ala45Val missense AGTPBP1 3 53964 5.55926E-5 26982 0 NA
9-88356747-C-A p.Gly44Val missense AGTPBP1 1 52944 1.88879E-5 26472 0 NA
9-88356755-A-T p.Arg41Arg synonymous AGTPBP1 2 51114 3.91282E-5 25557 0 1.7994E-5
9-88356757-G-C p.Arg41Gly missense AGTPBP1 1 50328 1.98697E-5 25164 0 NA
9-88356763-T-G p.Ile39Leu missense AGTPBP1 2 48134 4.15507E-5 24067 0 NA
9-88356769-G-A p.Arg37* stop_gained AGTPBP1 1 46048 2.17165E-5 23024 0 NA
9-88356772-G-T p.Arg36Arg synonymous AGTPBP1 1 45212 2.2118E-5 22606 0 6.4041E-5
9-88356783-G-A p.Pro32Leu missense AGTPBP1 4 42770 9.35235E-5 21385 0 6.31579E-4
9-88356787-T-C p.Thr31Ala missense AGTPBP1 3 41898 7.16025E-5 20949 0 2.08882E-5
9-88356814-A-AGGC p.Ala21dup conservative_inframe_insertion AGTPBP1 2 35556 5.62493E-5 17778 0 NA
9-88356815-G-C p.Ala21Ala synonymous AGTPBP1 7 35484 1.97272E-4 17742 0 NA
9-88356818-G-T p.Ser20Ser synonymous AGTPBP1 1 34852 2.86928E-5 17426 0 NA
9-88356820-AGGC-A p.Ala19del conservative_inframe_deletion AGTPBP1 1619 34322 0.0471709 17161 41 0.0434247
9-88356820-A-AGGCGGC p.Ala18_Ala19dup conservative_inframe_insertion AGTPBP1 188 34390 0.00546671 17195 5 0.00862013
9-88356820-A-AGGC p.Ala19dup conservative_inframe_insertion AGTPBP1 16 34400 4.65116E-4 17200 0 6.4813E-5
9-88356820-A-AGGCGGCGGC p.Ala17_Ala19dup conservative_inframe_insertion AGTPBP1 14 34400 4.06977E-4 17200 0 2.26846E-4
9-88356821-G-GGCGGCGGCGGCGGCAGCT p.Ala14_Ala19dup disruptive_inframe_insertion AGTPBP1 58 33604 0.00172598 16802 2 0.00174595
9-88356824-G-GGCGGCGGCAGCT p.Ala15_Ala18dup disruptive_inframe_insertion AGTPBP1 3 33560 8.93921E-5 16780 0 NA
9-88356824-G-GGCGGCGGCGGCAGCTGCGGCGGCGGCGGCAGCT p.Ala18_Ala19insAlaAlaAlaAlaAlaAlaAlaAlaAlaAlaAla disruptive_inframe_insertion AGTPBP1 2 33554 5.96054E-5 16777 0 1.41243E-4
9-88356827-G-GGCGGCGGCAGCT p.Ala14_Ala17dup disruptive_inframe_insertion AGTPBP1 6 33008 1.81774E-4 16504 0 1.28858E-4
9-88356827-G-GGCGGCAGCT p.Ala15_Ala17dup disruptive_inframe_insertion AGTPBP1 1 33010 3.02938E-5 16505 0 NA
9-88356827-G-GGCGGCGGCA p.Ala15_Ala17dup disruptive_inframe_insertion AGTPBP1 1 33010 3.02938E-5 16505 0 3.22144E-5
9-88356827-GGCGGCGGCAGCT-G p.Ala14_Ala17del disruptive_inframe_deletion AGTPBP1 1 33010 3.02938E-5 16505 0 NA
9-88356830-G-GGCGGCA p.Ala15_Ala16dup disruptive_inframe_insertion AGTPBP1 1 32554 3.07182E-5 16277 0 6.44371E-5
9-88356833-G-A c.-351C>T 5_prime_UTR_premature_start_codon_gain AGTPBP1 1 32120 3.11333E-5 16060 0 3.23708E-5
9-88356833-G-T p.Ala15Ala synonymous AGTPBP1 2 32124 6.22587E-5 16062 0 2.20653E-4
9-88356833-G-C p.Ala15Ala synonymous AGTPBP1 1 32124 3.11294E-5 16062 0 NA
9-88356836-A-AGCTGCGGCG p.Ala12_Ala14dup disruptive_inframe_insertion AGTPBP1 3 31916 9.39967E-5 15958 0 NA
9-88356836-A-AGCTGCGGCGGCG p.Ala11_Ala14dup disruptive_inframe_insertion AGTPBP1 2 31916 6.26645E-5 15958 0 6.47878E-5
9-88356839-T-TGCG p.Ala13dup disruptive_inframe_insertion AGTPBP1 4 31684 1.26247E-4 15842 0 6.4855E-5
9-88356841-C-CGGCGGCGGCGCTGGA p.Ala12_Ala13insSerSerAlaAlaAla conservative_inframe_insertion AGTPBP1 41 31360 0.0013074 15680 0 0.00151711
9-88356841-C-G p.Ala13Pro missense AGTPBP1 2 31370 6.37552E-5 15685 0 7.07214E-4
9-88356846-G-T p.Ala11Asp missense AGTPBP1 1 30848 3.2417E-5 15424 0 NA
9-88356846-G-A p.Ala11Val missense AGTPBP1 1 30850 3.24149E-5 15425 0 NA
9-88356848-GGCGCTGGAGGCGGCGGAACCTGTC-G p.Thr3_Ala10del disruptive_inframe_deletion AGTPBP1 1 30500 3.27869E-5 15250 0 NA
9-88356851-G-A p.Ser9Ser synonymous AGTPBP1 2 30210 6.62032E-5 15105 0 NA
9-88356858-G-A p.Ala7Val missense AGTPBP1 1 29440 3.39674E-5 14720 0 9.68429E-5
9-88356859-C-T p.Ala7Thr missense AGTPBP1 1 29160 3.42936E-5 14580 0 NA
9-88356862-C-T p.Ala6Thr missense AGTPBP1 27 28824 9.36719E-4 14412 0 4.52459E-4
9-88356863-G-C p.Ser5Ser synonymous AGTPBP1 3 28852 1.03979E-4 14426 0 3.23227E-4
9-88356863-G-A c.-381C>T 5_prime_UTR_premature_start_codon_gain AGTPBP1 1 28852 3.46596E-5 14426 0 NA
9-88356864-G-C p.Ser5Cys missense AGTPBP1 392 28776 0.0136225 14388 5 0.0143312
9-88356871-T-C p.Thr3Ala missense AGTPBP1 5 27424 1.82322E-4 13712 0 9.72763E-5
9-88356874-G-A p.Arg2Trp missense AGTPBP1 1 27006 3.70288E-5 13503 0 NA
9-88356880-C-A c.-398G>T 5_prime_UTR_premature_start_codon_gain AGTPBP1 1 26294 3.80315E-5 13147 0 3.23813E-5
9-88356924-G-T c.-442C>A 5_prime_UTR_premature_start_codon_gain AGTPBP1 1 24726 4.04433E-5 12363 0 NA
9-88356938-C-A c.-456G>T 5_prime_UTR_premature_start_codon_gain AGTPBP1 1 24420 4.095E-5 12210 0 3.2417E-5