Variant

Variant ID Consequence Effect Gene AC AN AF NS NHOM maxEAF
1-955556-G-C p.Ala2Pro missense AGRN 1 33092 3.02188E-5 16546 0 NA
1-955557-C-A p.Ala2Asp missense AGRN 12 33112 3.62406E-4 16556 0 8.42091E-4
1-955560-G-A p.Gly3Asp missense AGRN 1 33142 3.01732E-5 16571 0 NA
1-955563-G-C p.Arg4Pro missense AGRN 128 33332 0.00384015 16666 1 0.0114527
1-955563-G-T p.Arg4Leu missense AGRN 1 33342 2.99922E-5 16671 0 NA
1-955576-CCCGCTGCGG-C p.Arg11_Leu13del disruptive_inframe_deletion AGRN 1 35064 2.85193E-5 17532 0 3.32889E-5
1-955580-C-T p.Leu10Leu synonymous AGRN 1 35012 2.85616E-5 17506 0 3.12911E-5
1-955580-C-A p.Leu10Met missense AGRN 1 35012 2.85616E-5 17506 0 NA
1-955586-C-T p.Pro12Ser missense AGRN 1 35252 2.83672E-5 17626 0 NA
1-955588-G-C p.Pro12Pro synonymous AGRN 1 35428 2.82263E-5 17714 0 NA
1-955596-C-G p.Pro15Arg missense AGRN 12 36306 3.30524E-4 18153 1 8.8218E-4
1-955596-CG-GT p.Pro15Arg missense AGRN 6 36304 1.65271E-4 18152 0 NA
1-955596-C-T p.Pro15Leu missense AGRN 1 36306 2.75437E-5 18153 0 3.93051E-5
1-955597-G-T p.Pro15Pro synonymous AGRN 10357 35018 0.295762 17509 1381 0.424182
1-955603-TGTG-T p.Val19del disruptive_inframe_deletion AGRN 2 36972 5.4095E-5 18486 0 1.96425E-4
1-955619-G-C p.Val23Leu missense AGRN 316 38084 0.00829745 19042 1 0.0347528
1-955627-C-G p.Pro25Pro synonymous AGRN 1 38416 2.60308E-5 19208 0 NA
1-955628-G-A p.Gly26Arg missense AGRN 1 38382 2.60539E-5 19191 0 1.26419E-5
1-955644-G-A p.Cys31Tyr missense AGRN 1 38962 2.5666E-5 19481 0 NA
1-955654-C-T p.Arg34Arg synonymous AGRN 5 38962 1.2833E-4 19481 0 3.54912E-5
1-955668-G-A p.Arg39His missense AGRN 2 39116 5.113E-5 19558 0 NA
1-955677-A-C p.Glu42Ala missense AGRN 8 39232 2.03915E-4 19616 0 4.21804E-4
1-955701-C-T p.Thr50Met missense AGRN 1 39938 2.50388E-5 19969 0 1.61697E-4
1-955719-A-C p.Asn56Thr missense AGRN 1 40398 2.47537E-5 20199 0 NA
1-955720-C-T p.Asn56Asn synonymous AGRN 1 40416 2.47427E-5 20208 0 9.84252E-6
1-955724-G-A p.Asp58Asn missense AGRN 4 40466 9.88484E-5 20233 0 2.58548E-4
1-955729-G-A p.Pro59Pro synonymous AGRN 1 40520 2.46792E-5 20260 0 NA
1-955735-G-C p.Gln61His missense AGRN 14 40638 3.44505E-4 20319 0 1.0386E-4
1-957586-G-C p.Arg69Arg synonymous AGRN 2 81782 2.44553E-5 40891 0 NA
1-957597-A-G p.Tyr73Cys missense AGRN 1 82024 1.21916E-5 41012 0 NA
1-957604-G-A p.Lys75Lys synonymous AGRN 2 82214 2.43268E-5 41107 0 1.99629E-5
1-957610-A-G p.Lys77Lys synonymous AGRN 1 82348 1.21436E-5 41174 0 3.99138E-6
1-957621-C-G p.Ala81Gly missense AGRN 1 82384 1.21383E-5 41192 0 NA
1-957624-G-A p.Arg82Gln missense AGRN 3 82506 3.6361E-5 41253 0 1.59266E-4
1-957625-G-A p.Arg82Arg synonymous AGRN 2 82528 2.42342E-5 41264 0 3.98813E-6
1-957638-G-A p.Asp87Asn missense AGRN 1 82698 1.20922E-5 41349 0 NA
1-957640-C-T p.Asp87Asp synonymous AGRN 1800 82670 0.0217733 41335 35 0.0276939
1-957643-C-T p.Gly88Gly synonymous AGRN 2 82724 2.41768E-5 41362 0 6.25E-4
1-957644-G-A p.Gly89Ser missense AGRN 1 82774 1.20811E-5 41387 0 8.28748E-6
1-957657-T-C p.Val93Ala missense AGRN 1 82878 1.20659E-5 41439 0 NA
1-957676-C-T p.Asp99Asp synonymous AGRN 2 82954 2.41097E-5 41477 0 1.65615E-5
1-957714-C-T p.Thr112Ile missense AGRN 1 82966 1.20531E-5 41483 0 NA
1-957715-C-T p.Thr112Thr synonymous AGRN 12 82968 1.44634E-4 41484 0 2.38973E-5
1-957724-C-T p.Phe115Phe synonymous AGRN 4 82980 4.82044E-5 41490 0 NA
1-957734-C-T p.Pro119Ser missense AGRN 1 82924 1.20592E-5 41462 0 NA
1-957735-C-T p.Pro119Leu missense AGRN 4 82918 4.82404E-5 41459 0 5.03525E-4
1-957737-G-C p.Ala120Pro missense AGRN 3 82868 3.62022E-5 41434 0 3.18613E-5
1-957741-C-A p.Pro121His missense AGRN 1 82912 1.2061E-5 41456 0 0.00125
1-957742-C-G p.Pro121Pro synonymous AGRN 1 82910 1.20613E-5 41455 0 3.98476E-6
1-957742-C-T p.Pro121Pro synonymous AGRN 1 82910 1.20613E-5 41455 0 8.29132E-6
1-957743-C-G p.Pro122Ala missense AGRN 3 82904 3.61864E-5 41452 0 0.00125
1-957763-C-G p.His128Gln missense AGRN 10 82722 1.20887E-4 41361 0 8.57339E-4
1-957770-G-A p.Glu131Lys missense AGRN 3 82616 3.63126E-5 41308 0 3.18492E-5
1-957805-C-T p.Thr142Thr synonymous AGRN 1 81010 1.23442E-5 40505 0 6.25E-4
1-957809-C-T p.Arg144Trp missense AGRN 1 80562 1.24128E-5 40281 0 2.40836E-5
1-957828-A-C p.Glu150Ala missense AGRN 1 78960 1.26646E-5 39480 0 1.69866E-5
1-957838-G-T p.Val153Val synonymous AGRN 1 77734 1.28644E-5 38867 0 NA
1-957841-A-C p.Glu154Asp missense+splice_region AGRN 1 77114 1.29678E-5 38557 0 NA
1-957846-C-T c.463+4C>T splice_region AGRN 1 74940 1.3344E-5 37470 0 NA
1-957847-G-A c.463+5G>A splice_region AGRN 1 75324 1.3276E-5 37662 0 1.74067E-5
1-970091-G-A n.598+8G>A splice_region AGRN 16 53606 2.98474E-4 26803 0 1.27567E-4
1-970650-C-T c.464-7C>T splice_region AGRN 2 82744 2.41709E-5 41372 0 9.96943E-5
1-970653-C-A c.464-4C>A splice_region AGRN 2 82776 2.41616E-5 41388 0 3.98527E-6
1-970660-A-C p.Lys156Thr missense AGRN 1 82832 1.20726E-5 41416 0 NA
1-970663-C-T p.Pro157Leu missense AGRN 1 82846 1.20706E-5 41423 0 NA
1-970664-C-T p.Pro157Pro synonymous AGRN 2 82864 2.41359E-5 41432 0 3.32099E-5
1-970665-G-A p.Gly158Arg missense AGRN 2 82858 2.41377E-5 41429 0 3.18695E-5
1-970676-C-T p.Phe161Phe synonymous AGRN 2 82880 2.41313E-5 41440 0 1.35505E-4
1-970680-C-T p.Pro163Ser missense AGRN 2 82892 2.41278E-5 41446 0 3.18695E-5
1-970687-C-T p.Pro165Leu missense AGRN 63 82922 7.5975E-4 41461 0 0.00165637
1-970690-C-T p.Pro166Leu missense AGRN 2 82904 2.41243E-5 41452 0 1.19591E-5
1-970693-C-T p.Thr167Met missense AGRN 1 82888 1.20645E-5 41444 0 8.30441E-6
1-970694-G-A p.Thr167Thr synonymous AGRN 1 82848 1.20703E-5 41424 0 2.49145E-5
1-970696-C-T p.Pro168Leu missense AGRN 2 82868 2.41348E-5 41434 0 3.32204E-5
1-970703-T-C p.Asp170Asp splice_region+synonymous AGRN 1 82818 1.20747E-5 41409 0 NA
1-976039-C-T c.512-6C>T splice_region AGRN 3 67614 4.43695E-5 33807 0 2.05846E-5
1-976045-C-T p.Ala171Val missense+splice_region AGRN 1 68152 1.46731E-5 34076 0 NA
1-976050-C-G p.Arg173Gly missense AGRN 2 68598 2.91554E-5 34299 0 NA
1-976052-G-C p.Arg173Arg synonymous AGRN 16 68912 2.3218E-4 34456 0 9.57426E-5
1-976052-G-A p.Arg173Arg synonymous AGRN 3 68922 4.35275E-5 34461 0 NA
1-976056-A-G p.Met175Val missense AGRN 14 68988 2.02934E-4 34494 0 8.19062E-4
1-976067-C-T p.Gly178Gly synonymous AGRN 1 69444 1.44001E-5 34722 0 NA
1-976076-C-T p.Ala181Ala synonymous AGRN 1 69582 1.43715E-5 34791 0 NA
1-976079-G-A p.Val182Val synonymous AGRN 2 69780 2.86615E-5 34890 0 NA
1-976083-G-A p.Glu184Lys missense AGRN 1 69890 1.43082E-5 34945 0 NA
1-976087-C-G p.Pro185Arg missense AGRN 1 70130 1.42592E-5 35065 0 3.19652E-5
1-976090-A-G p.Asn186Ser missense AGRN 1 70264 1.4232E-5 35132 0 2.05609E-5
1-976094-G-A p.Ala187Ala synonymous AGRN 1 70596 1.41651E-5 35298 0 NA
1-976102-C-T p.Pro190Leu missense AGRN 1 70784 1.41275E-5 35392 0 6.90722E-6
1-976107-C-T p.Arg192Trp missense AGRN 1 71404 1.40048E-5 35702 0 1.38009E-5
1-976112-G-A p.Ala193Ala synonymous AGRN 103 71906 0.00143243 35953 1 0.00278311
1-976124-CAAG-C p.Lys199del disruptive_inframe_deletion AGRN 33 73062 4.51671E-4 36531 0 6.64489E-4
1-976133-C-G p.Ser200Arg missense AGRN 2 73358 2.72636E-5 36679 0 NA
1-976135-C-T p.Pro201Leu missense AGRN 1 73342 1.36348E-5 36671 0 7.54148E-5
1-976140-C-T p.Pro203Ser missense AGRN 1 73460 1.36129E-5 36730 0 1.49858E-4
1-976146-G-A p.Val205Met missense AGRN 1 73622 1.35829E-5 36811 0 2.09374E-5
1-976153-C-A p.Ala207Glu missense AGRN 1 73490 1.36073E-5 36745 0 NA
1-976157-T-C p.Pro208Pro synonymous AGRN 22 73556 2.99092E-4 36778 0 0.00107991
1-976171-A-C p.Asp213Ala missense AGRN 1 72590 1.3776E-5 36295 0 NA
1-976172-C-T p.Asp213Asp synonymous AGRN 1 72542 1.37851E-5 36271 0 NA
1-976175-C-T p.Ala214Ala synonymous AGRN 4 72402 5.52471E-5 36201 0 1.05686E-4
1-976176-T-G p.Ser215Ala missense AGRN 15 72254 2.07601E-4 36127 0 7.05268E-5
1-976178-C-T p.Ser215Ser synonymous AGRN 2 72212 2.76962E-5 36106 0 2.26929E-4
1-976191-G-T p.Glu220* stop_gained AGRN 1 70704 1.41435E-5 35352 0 NA
1-976196-C-T p.Cys221Cys synonymous AGRN 5 69622 7.18164E-5 34811 0 5.81024E-5
1-976204-A-G p.Gln224Arg missense AGRN 1 67884 1.4731E-5 33942 0 NA
1-976205-G-A p.Gln224Gln synonymous AGRN 4 67700 5.90842E-5 33850 0 7.91264E-5
1-976208-G-A p.Arg225Arg synonymous AGRN 3 67158 4.46708E-5 33579 0 2.94174E-5
1-976210-CGCAGT-C p.Cys228fs frameshift AGRN 1 66138 1.51199E-5 33069 0 NA
1-976220-C-G p.Ser229Arg missense AGRN 2 64012 3.12441E-5 32006 0 NA
1-976231-G-T p.Arg233Leu missense AGRN 12 59940 2.002E-4 29970 0 3.23813E-4
1-976236-C-T p.Arg235Cys missense AGRN 1 58610 1.70619E-5 29305 0 NA
1-976240-T-G p.Leu236Arg missense AGRN 1 57488 1.73949E-5 28744 0 NA
1-976244-C-T p.Leu237Leu synonymous AGRN 2 56182 3.55986E-5 28091 0 6.48887E-5
1-976249-G-A p.Arg239His missense AGRN 1 53988 1.85226E-5 26994 0 3.25309E-5
1-976256-G-T p.Pro241Pro synonymous AGRN 1 51902 1.92671E-5 25951 0 3.25246E-5
1-976259-C-T p.Cys242Cys splice_region+synonymous AGRN 8 50228 1.59274E-4 25114 0 0.00314861
1-976266-C-CGGGGCGGGGCCGGTGCCT c.727+6_727+7insGGGGCGGGGCCGGTGCCT splice_region AGRN 1 47798 2.09214E-5 23899 0 NA
1-976554-C-G p.Gly243Gly splice_region+synonymous AGRN 179 38490 0.00465056 19245 1 0.0149371
1-976557-G-T p.Ser244Ser synonymous AGRN 1 38660 2.58665E-5 19330 0 NA
1-976563-C-T p.Asp246Asp synonymous AGRN 115 39248 0.00293009 19624 1 0.00831354
1-976574-A-C p.Asn250Thr missense AGRN 1 39618 2.52411E-5 19809 0 3.74906E-4
1-976576-G-A p.Val251Met missense AGRN 1 39636 2.52296E-5 19818 0 3.28407E-5
1-976577-T-C p.Val251Ala missense AGRN 21 39658 5.29527E-4 19829 0 7.25211E-4
1-976590-C-T p.Phe255Phe synonymous AGRN 2 39728 5.03423E-5 19864 0 NA
1-976595-GC-AA p.Ser257Lys missense AGRN 1 39780 2.51383E-5 19890 0 NA
1-976598-C-T p.Thr258Ile missense AGRN 65 39812 0.00163267 19906 0 0.0062553
1-976605-G-A p.Ala260Ala synonymous AGRN 1 39832 2.51054E-5 19916 0 NA
1-976610-C-T p.Ser262Leu missense AGRN 2 39878 5.0153E-5 19939 0 NA
1-976617-C-A p.Asp264Glu missense AGRN 1 39936 2.50401E-5 19968 0 NA
1-976622-T-A p.Leu266Gln missense AGRN 1 39990 2.50063E-5 19995 0 NA
1-976625-C-T p.Thr267Met missense AGRN 43 40008 0.00107479 20004 0 0.00444444
1-976627-GC-AT p.Ala268Ile missense AGRN 2 40022 4.99725E-5 20011 0 NA
1-976629-C-T p.Ala268Ala synonymous AGRN 713 40012 0.0178197 20006 29 0.0437063
1-976629-C-G p.Ala268Ala synonymous AGRN 1 40046 2.49713E-5 20023 0 NA
1-976631-C-T p.Ser269Leu missense AGRN 1 40050 2.49688E-5 20025 0 9.94214E-6
1-976632-G-A p.Ser269Ser synonymous AGRN 1 40060 2.49626E-5 20030 0 9.74279E-5
1-976663-C-T p.Pro280Ser missense AGRN 1 40582 2.46415E-5 20291 0 3.21895E-5
1-976665-C-G p.Pro280Pro synonymous AGRN 6 40610 1.47747E-4 20305 0 9.65686E-5
1-976668-G-C p.Glu281Asp missense AGRN 1 40700 2.457E-5 20350 0 NA
1-976680-C-T p.Cys285Cys synonymous AGRN 2 40988 4.87948E-5 20494 0 8.48608E-6
1-976690-G-A p.Gly289Ser missense AGRN 4 41264 9.69368E-5 20632 0 NA
1-976710-G-A p.Glu295Glu synonymous AGRN 1 42304 2.36384E-5 21152 0 7.79047E-6
1-976730-C-T p.Ala302Val missense AGRN 2 43520 4.59559E-5 21760 0 4.15973E-4
1-976730-C-G p.Ala302Gly missense AGRN 4 43520 9.19118E-5 21760 0 3.20718E-5
1-976743-G-A p.Gln306Gln synonymous AGRN 4 45046 8.87981E-5 22523 0 1.40528E-5
1-976748-A-G p.Asn308Ser missense AGRN 1 45486 2.19848E-5 22743 0 6.25E-4
1-976748-A-T p.Asn308Ile missense AGRN 1 45486 2.19848E-5 22743 0 NA
1-976776-TGGTGAGCGCGGCGGCGGGCGCACGGCTCGAGCTCTGTGGGCGCGCGGCGACAGCGTCCTGACTCCTGCCCTCGACCCCCA-T p.Asp318fs frameshift AGRN 1 47182 2.11945E-5 23591 0 NA
1-976777-G-GGTGA c.952_952+1insGTGA splice_donor AGRN 1 47230 2.1173E-5 23615 0 NA
1-976783-CGCG-C c.952+7_952+9delGCG splice_region AGRN 1 47026 2.12648E-5 23513 0 NA
1-976878-C-T p.Pro325Ser missense AGRN 1 52216 1.91512E-5 26108 0 4.64309E-6
1-976884-C-T p.Pro327Ser missense AGRN 2 52896 3.781E-5 26448 0 9.62155E-5
1-976909-C-T p.Pro335Leu missense AGRN 1 58416 1.71186E-5 29208 0 1.09577E-5
1-976925-T-C p.Pro340Pro synonymous AGRN 1 62928 1.58912E-5 31464 0 1.51304E-4
1-976929-A-G p.Met342Val missense AGRN 1 63500 1.5748E-5 31750 0 3.21048E-5
1-976931-G-C p.Met342Ile missense AGRN 4 63878 6.26194E-5 31939 0 3.20102E-5
1-976938-C-A p.Arg345Arg synonymous AGRN 1 65438 1.52816E-5 32719 0 6.4082E-5
1-976939-G-T p.Arg345Leu missense AGRN 1 65556 1.52541E-5 32778 0 NA
1-976943-C-G p.Pro346Pro synonymous AGRN 1 66482 1.50417E-5 33241 0 NA
1-976958-C-T p.Ala351Ala synonymous AGRN 1 68764 1.45425E-5 34382 0 8.46303E-6
1-976959-C-T p.Arg352Trp missense AGRN 4 68902 5.80535E-5 34451 0 3.78108E-5
1-976963-A-G p.Gln353Arg missense AGRN 452 69466 0.00650678 34733 10 0.0153084
1-976965-G-A p.Ala354Thr missense AGRN 1 69962 1.42935E-5 34981 0 4.67464E-5
1-976966-C-A p.Ala354Glu missense AGRN 1 69930 1.43E-5 34965 0 NA
1-976971-G-T p.Val356Leu missense AGRN 5 70820 7.06015E-5 35410 0 NA
1-976982-C-T p.Asp359Asp synonymous AGRN 1 71696 1.39478E-5 35848 0 NA
1-976994-C-T p.Thr363Thr synonymous AGRN 1 73466 1.36117E-5 36733 0 2.73553E-5
1-976998-G-A p.Glu365Lys missense AGRN 1 73544 1.35973E-5 36772 0 4.16497E-6
1-976999-A-G p.Glu365Gly missense AGRN 1 73722 1.35645E-5 36861 0 NA
1-977003-C-T p.Asn366Asn synonymous AGRN 3 73840 4.06284E-5 36920 0 9.09554E-6
1-977006-C-T p.Asp367Asp synonymous AGRN 1 74078 1.34993E-5 37039 0 3.20246E-5
1-977012-C-T p.Val369Val synonymous AGRN 21 74258 2.82798E-4 37129 0 2.27467E-4
1-977017-G-A p.Gly371Asp missense AGRN 1 74044 1.35055E-5 37022 0 1.29497E-4
1-977023-C-T p.Ser373Leu missense AGRN 4 73928 5.41067E-5 36964 0 2.51189E-5
1-977026-G-C p.Gly374Ala missense AGRN 1 73974 1.35183E-5 36987 0 NA
1-977027-G-A p.Gly374Gly synonymous AGRN 3 73928 4.058E-5 36964 0 5.50055E-5
1-977028-G-T p.Ala375Ser missense AGRN 501 73716 0.00679635 36858 6 0.0110999
1-977031-G-A p.Ala376Thr missense AGRN 1 73678 1.35726E-5 36839 0 1.25933E-5
1-977035-G-A p.Arg377Gln missense AGRN 2 73956 2.70431E-5 36978 0 NA
1-977042-C-T p.Leu379Leu synonymous AGRN 1 74052 1.3504E-5 37026 0 8.41305E-6
1-977046-C-A p.Leu381Met missense AGRN 1 74132 1.34895E-5 37066 0 NA
1-977058-CGCTCCGGCCAGTGCCAGGGTCGAGGTGAGCGGCTCCCCCGGGGGAGG-C p.Arg385_Asp393delinsHis splice_donor AGRN 11 73706 1.49242E-4 36853 0 1.24119E-4
1-977060-C-T p.Arg385Arg synonymous AGRN 2 73730 2.7126E-5 36865 0 6.45578E-5
1-977072-C-T p.Cys389Cys synonymous AGRN 1 73238 1.36541E-5 36619 0 NA
1-977082-G-A p.Asp393Asn missense+splice_region AGRN 1 72698 1.37555E-5 36349 0 3.21137E-5
1-977086-A-G c.1177+4A>G splice_region AGRN 1 72022 1.38846E-5 36011 0 2.09007E-4
1-977089-G-A c.1177+7G>A splice_region AGRN 2 71144 2.8112E-5 35572 0 5.71207E-5
1-977328-C-T c.1178-8C>T splice_region AGRN 1 79286 1.26126E-5 39643 0 4.07774E-6
1-977329-G-A c.1178-7G>A splice_region AGRN 101 79290 0.00127381 39645 0 0.00110035
1-977329-GT-AC c.1178-7_1178-6delGTinsAC splice_region AGRN 16 79292 2.01786E-4 39646 0 NA
1-977330-T-C c.1178-6T>C splice_region AGRN 67634 75964 0.890343 37982 30326 0.923277
1-977339-A-G p.Gln394Arg missense AGRN 1 79496 1.25792E-5 39748 0 NA
1-977345-C-A p.Pro396Gln missense AGRN 3 79354 3.78053E-5 39677 0 NA
1-977345-C-T p.Pro396Leu missense AGRN 5 79354 6.30088E-5 39677 0 6.25782E-4
1-977346-G-A p.Pro396Pro synonymous AGRN 202 79418 0.0025435 39709 0 0.0025
1-977348-A-G p.Glu397Gly missense AGRN 1 79376 1.25983E-5 39688 0 2.85193E-5
1-977352-C-G p.Pro398Pro synonymous AGRN 1 79606 1.25619E-5 39803 0 8.5703E-6
1-977356-C-T p.Arg400Trp missense AGRN 59 79614 7.41076E-4 39807 0 0.00125
1-977356-C-A p.Arg400Arg synonymous AGRN 10 79612 1.25609E-4 39806 0 3.19346E-5
1-977357-G-A p.Arg400Gln missense AGRN 8 79712 1.00361E-4 39856 0 5.69606E-5
1-977367-C-T p.Ala403Ala synonymous AGRN 26 79840 3.25651E-4 39920 0 0.0015121
1-977368-G-A p.Val404Met missense AGRN 1 79868 1.25207E-5 39934 0 5.04032E-4
1-977374-C-T p.Leu406Leu synonymous AGRN 2 79930 2.50219E-5 39965 0 8.60112E-6
1-977374-C-G p.Leu406Val missense AGRN 4 79930 5.00438E-5 39965 0 NA
1-977379-C-A p.Ser407Ser synonymous AGRN 3 80566 3.72366E-5 40283 0 NA
1-977380-C-T p.Arg408Cys missense AGRN 6 80614 7.44288E-5 40307 0 1.71972E-5
1-977384-G-A p.Arg409His missense AGRN 4 80698 4.95675E-5 40349 0 6.38937E-5
1-977390-G-A p.Arg411His missense AGRN 3 80776 3.71397E-5 40388 0 3.19366E-5
1-977393-C-A p.Pro412His missense AGRN 1 80944 1.23542E-5 40472 0 4.06858E-6
1-977396-G-A p.Arg413His missense AGRN 3 80954 3.70581E-5 40477 0 5.05051E-4
1-977406-C-T p.Cys416Cys synonymous AGRN 3 81102 3.69905E-5 40551 0 0.0025
1-977407-G-A p.Asp417Asn missense AGRN 1 81070 1.2335E-5 40535 0 3.19387E-5
1-977408-A-G p.Asp417Gly missense AGRN 2 81048 2.46767E-5 40524 0 NA
1-977411-GC-TT p.Arg418Leu missense AGRN 2 81078 2.46676E-5 40539 0 NA
1-977411-G-A p.Arg418His missense AGRN 2 81078 2.46676E-5 40539 0 4.09303E-6
1-977413-G-A p.Val419Ile missense AGRN 3 81086 3.69978E-5 40543 0 3.19183E-5
1-977416-A-G p.Thr420Ala missense AGRN 1 81168 1.23201E-5 40584 0 8.67423E-6
1-977424-C-T p.Asp422Asp synonymous AGRN 3 81160 3.6964E-5 40580 0 2.61238E-5
1-977425-G-A p.Gly423Arg missense AGRN 2 81146 2.46469E-5 40573 0 3.19244E-5
1-977429-C-T p.Ala424Val missense AGRN 4 80940 4.94193E-5 40470 0 7.85958E-5
1-977431-T-C p.Tyr425His missense AGRN 4 81012 4.93754E-5 40506 0 NA
1-977439-C-T p.Pro427Pro synonymous AGRN 6 80938 7.41308E-5 40469 0 1.27673E-4
1-977440-G-A p.Val428Met missense AGRN 3 80652 3.71968E-5 40326 0 2.6249E-4
1-977448-C-G p.Ala430Ala synonymous AGRN 1 80776 1.23799E-5 40388 0 NA
1-977452-G-A p.Asp432Asn missense AGRN 1 80770 1.23808E-5 40385 0 9.57243E-5
1-977454-C-T p.Asp432Asp synonymous AGRN 1 80692 1.23928E-5 40346 0 2.07695E-5
1-977456-G-A p.Gly433Glu missense AGRN 1 80690 1.23931E-5 40345 0 4.15762E-6
1-977456-G-C p.Gly433Ala missense AGRN 1 80690 1.23931E-5 40345 0 NA
1-977459-G-T p.Arg434Leu missense AGRN 2 80552 2.48287E-5 40276 0 0.00125
1-977462-C-T p.Thr435Met missense AGRN 9 80574 1.11699E-4 40287 0 6.17328E-5
1-977463-G-A p.Thr435Thr synonymous AGRN 11 80524 1.36605E-4 40262 0 7.0624E-5
1-977473-G-A p.Asp439Asn missense AGRN 2 80490 2.48478E-5 40245 0 3.54478E-5
1-977483-G-A p.Arg442Gln missense AGRN 1 79992 1.25013E-5 39996 0 NA
1-977490-G-C p.Gln444His missense AGRN 1 79840 1.2525E-5 39920 0 NA
1-977500-C-T p.Arg448Trp missense AGRN 8 79362 1.00804E-4 39681 0 2.23371E-4
1-977501-G-A p.Arg448Gln missense AGRN 3 79326 3.78186E-5 39663 0 9.57365E-5
1-977506-C-T p.Gln450* stop_gained AGRN 4 79088 5.05766E-5 39544 0 NA
1-977510-G-A p.Arg451His missense AGRN 3 78886 3.80296E-5 39443 0 1.27665E-4
1-977512-G-A p.Ala452Thr missense AGRN 1 78822 1.26868E-5 39411 0 NA
1-977521-A-G p.Ser455Gly missense AGRN 1 78650 1.27146E-5 39325 0 4.28736E-6
1-977537-C-T p.Pro460Leu missense AGRN 2 77788 2.57109E-5 38894 0 3.19101E-5
1-977538-G-A p.Pro460Pro synonymous AGRN 2 77806 2.5705E-5 38903 0 4.66557E-5
1-977548-C-T c.1384+6C>T splice_region AGRN 26 76958 3.37847E-4 38479 0 1.59541E-4
1-977548-CGCCCCGGGGTGG-C c.1384+7_1384+18delGCCCCGGGGTGG splice_region AGRN 1 76960 1.29938E-5 38480 0 NA
1-977549-G-GC c.1384+7_1384+8insC splice_region AGRN 5 76760 6.51381E-5 38380 0 1.59551E-4
1-977549-G-C c.1384+7G>C splice_region AGRN 2 76760 2.60552E-5 38380 0 NA
1-977549-G-A c.1384+7G>A splice_region AGRN 1 76760 1.30276E-5 38380 0 6.38203E-5
1-977550-C-T c.1384+8C>T splice_region AGRN 1 76720 1.30344E-5 38360 0 NA
1-978615-C-G c.1385-4C>G splice_region AGRN 2 80068 2.49788E-5 40034 0 NA
1-978619-A-G p.Asp462Gly missense+splice_region AGRN 1 80138 1.24785E-5 40069 0 NA
1-978628-C-T p.Pro465Leu missense AGRN 82 80442 0.00101937 40221 1 0.00455927
1-978629-G-A p.Pro465Pro synonymous AGRN 10 80442 1.24313E-4 40221 0 6.16325E-5
1-978635-A-G p.Pro467Pro synonymous AGRN 2 80614 2.48096E-5 40307 0 8.39081E-6
1-978639-C-T p.Leu469Phe missense AGRN 2 80626 2.48059E-5 40313 0 4.63607E-5
1-978641-C-T p.Leu469Leu synonymous AGRN 2 80602 2.48133E-5 40301 0 1.1494E-5
1-978642-G-A p.Gly470Arg missense AGRN 2 80778 2.47592E-5 40389 0 0.00101112
1-978645-G-A p.Val471Met missense AGRN 9 80898 1.11251E-4 40449 0 9.98957E-5
1-978646-T-C p.Val471Ala missense AGRN 2 80784 2.47574E-5 40392 0 NA
1-978665-G-A p.Ala477Ala synonymous AGRN 1 81212 1.23135E-5 40606 0 1.0337E-5
1-978668-G-A p.Thr478Thr synonymous AGRN 305 81246 0.00375403 40623 1 0.00327018
1-978668-G-T p.Thr478Thr synonymous AGRN 2 81258 2.4613E-5 40629 0 NA
1-978675-G-A p.Val481Met missense AGRN 1 81326 1.22962E-5 40663 0 4.08223E-6
1-978683-C-T p.Asn483Asn synonymous AGRN 6 81314 7.3788E-5 40657 0 6.37959E-5
1-978686-G-A p.Gly484Gly synonymous AGRN 1 81310 1.22986E-5 40655 0 NA
1-978694-C-T p.Ala487Val missense AGRN 6 81218 7.38752E-5 40609 0 1.91327E-4
1-978695-G-A p.Ala487Ala synonymous AGRN 6 81318 7.37844E-5 40659 0 5.04541E-4
1-978702-T-C p.Cys490Arg missense AGRN 2 81312 2.45966E-5 40656 0 NA
1-978704-C-T p.Cys490Cys synonymous AGRN 3 81310 3.68958E-5 40655 0 6.37471E-5
1-978708-CAGGCGTGCTCG-C p.Ala493fs frameshift AGRN 1 81248 1.2308E-5 40624 0 NA
1-978711-G-A p.Ala493Thr missense AGRN 3 81192 3.69495E-5 40596 0 4.21351E-6
1-978712-C-T p.Ala493Val missense AGRN 1 81076 1.23341E-5 40538 0 6.37877E-5
1-978718-C-T p.Ser495Leu missense AGRN 1 81098 1.23308E-5 40549 0 2.25317E-5
1-978719-G-A p.Ser495Ser synonymous AGRN 2 81626 2.4502E-5 40813 0 2.03674E-5
1-978727-A-G p.Tyr498Cys missense AGRN 1 81740 1.22339E-5 40870 0 NA
1-978728-C-T p.Tyr498Tyr synonymous AGRN 3 81782 3.66829E-5 40891 0 1.01523E-5
1-978729-G-A p.Asp499Asn missense AGRN 1 81778 1.22282E-5 40889 0 1.23831E-5
1-978734-T-C p.Pro500Pro synonymous AGRN 11 81776 1.34514E-4 40888 0 8.04333E-4
1-978735-G-A p.Val501Met missense AGRN 1 81778 1.22282E-5 40889 0 4.1278E-6
1-978736-T-C p.Val501Ala missense AGRN 2 81754 2.44636E-5 40877 0 NA
1-978740-C-T p.Cys502Cys synonymous AGRN 1 81694 1.22408E-5 40847 0 1.03385E-5
1-978741-G-A p.Gly503Ser missense AGRN 4 81728 4.89428E-5 40864 0 0.001875
1-978746-C-T p.Ser504Ser synonymous AGRN 1 81604 1.22543E-5 40802 0 5.13284E-5
1-978747-G-A p.Asp505Asn missense AGRN 3 81612 3.67593E-5 40806 0 1.59317E-4
1-978752-C-T p.Gly506Gly synonymous AGRN 2 81490 2.45429E-5 40745 0 6.20142E-5
1-978753-G-A p.Val507Ile missense AGRN 1 81496 1.22705E-5 40748 0 6.25E-4
1-978762-G-A p.Gly510Ser missense AGRN 687 81334 0.00844665 40667 3 0.0100057
1-978768-G-A p.Ala512Thr missense AGRN 10 81138 1.23247E-4 40569 0 3.36751E-5
1-978768-G-T p.Ala512Ser missense AGRN 1 81138 1.23247E-5 40569 0 1.04241E-5
1-978769-C-T p.Ala512Val missense AGRN 3 81104 3.69895E-5 40552 0 3.18756E-5
1-978770-G-A p.Ala512Ala synonymous AGRN 2 81132 2.46512E-5 40566 0 3.1953E-5
1-978773-C-T p.Cys513Cys synonymous AGRN 2 81058 2.46737E-5 40529 0 9.5645E-5
1-978774-G-A p.Glu514Lys missense AGRN 15 81084 1.84993E-4 40542 0 0.00202224
1-978777-C-G p.Leu515Val missense AGRN 2 81076 2.46682E-5 40538 0 NA
1-978788-G-A p.Thr518Thr synonymous AGRN 1 80892 1.23622E-5 40446 0 2.11013E-5
1-978791-C-T p.Ala519Ala synonymous AGRN 14 80920 1.7301E-4 40460 0 0.00125
1-978797-C-T p.Thr521Thr synonymous AGRN 1 80798 1.23765E-5 40399 0 NA
1-978800-C-T p.Leu522Leu synonymous AGRN 27 80676 3.34672E-4 40338 1 2.40385E-4
1-978801-G-A p.Gly523Arg missense AGRN 4 80638 4.96044E-5 40319 0 4.07285E-4
1-978803-G-A p.Gly523Gly synonymous AGRN 1 80624 1.24033E-5 40312 0 1.03814E-5
1-978804-C-T p.Arg524Trp missense AGRN 38 80548 4.71768E-4 40274 2 0.00125
1-978805-G-A p.Arg524Gln missense AGRN 4 80566 4.96487E-5 40283 0 3.12806E-5
1-978814-A-C p.Gln527Pro missense AGRN 1 80398 1.24381E-5 40199 0 3.18918E-5
1-978820-C-T p.Ala529Val missense AGRN 2 79938 2.50194E-5 39969 0 2.36038E-4
1-978821-G-C p.Ala529Ala synonymous AGRN 1 79934 1.25103E-5 39967 0 NA
1-978823-G-A p.Arg530His missense AGRN 2 79840 2.50501E-5 39920 0 6.37471E-5
1-978836-TGGTCAGTGGCGGGTGAGGGGTCTGGTGGGGGTCGGGGAGAGAGAGGTTCCTGGTCGCCTGGTGATGGAAGCTCCTCCCCA-T p.Asp535fs frameshift AGRN 6 79430 7.55382E-5 39715 2 NA
1-978840-C-G c.1603+3C>G splice_region AGRN 1 79142 1.26355E-5 39571 0 4.41735E-6
1-978840-C-T c.1603+3C>T splice_region AGRN 1 79142 1.26355E-5 39571 0 1.06302E-5
1-978921-G-A p.Arg536His missense AGRN 1 72440 1.38045E-5 36220 0 2.57008E-5
1-978926-G-A p.Gly538Arg missense AGRN 2 72446 2.76068E-5 36223 0 3.42296E-5
1-978934-C-T p.Cys540Cys synonymous AGRN 4 72162 5.54308E-5 36081 0 3.41857E-5
1-978944-G-C p.Ala544Pro missense AGRN 1 71930 1.39024E-5 35965 0 NA
1-978946-C-T p.Ala544Ala synonymous AGRN 1 71846 1.39187E-5 35923 0 NA
1-978952-C-T p.Cys546Cys synonymous AGRN 2 71040 2.81532E-5 35520 0 6.25E-4
1-978953-G-A p.Glu547Lys missense AGRN 1 71270 1.40311E-5 35635 0 6.25E-4
1-978958-C-T p.Ala548Ala synonymous AGRN 3 70338 4.26512E-5 35169 0 5.45517E-5
1-978959-G-A p.Glu549Lys missense AGRN 8 70616 1.13289E-4 35308 0 6.37836E-5
1-978963-C-T p.Thr550Ile missense AGRN 1 70422 1.42001E-5 35211 0 4.19463E-6
1-978965-G-A p.Gly551Arg missense AGRN 2 70116 2.85242E-5 35058 0 4.19474E-6
1-978968-C-T p.Arg552Cys missense AGRN 3 69742 4.30157E-5 34871 0 3.1902E-5
1-978973-C-T p.Cys553Cys synonymous AGRN 4 69436 5.7607E-5 34718 0 1.70917E-4
1-978974-G-A p.Val554Met missense AGRN 365 69430 0.00525709 34715 2 0.0103011
1-978974-G-C p.Val554Leu missense AGRN 1 69450 1.43988E-5 34725 0 NA
1-978980-C-A p.Pro556Thr missense AGRN 1 69300 1.443E-5 34650 0 NA
1-978991-CGTG-C p.Val560del disruptive_inframe_deletion AGRN 1 68462 1.46066E-5 34231 0 NA
1-978992-G-A p.Val560Met missense AGRN 2 68558 2.91724E-5 34279 0 5.124E-5
1-978999-T-C p.Leu562Ser missense AGRN 2 68120 2.936E-5 34060 0 1.2606E-5
1-979003-C-G p.Ala563Ala synonymous AGRN 1 67772 1.47554E-5 33886 0 NA
1-979007-C-T p.Pro565Ser missense AGRN 1 67490 1.4817E-5 33745 0 3.36939E-5
1-979009-C-T p.Pro565Pro synonymous AGRN 2 67132 2.97921E-5 33566 0 6.74002E-5
1-979021-C-T p.Ser569Ser synonymous AGRN 1 66186 1.51089E-5 33093 0 1.71157E-5
1-979022-G-A p.Asp570Asn missense AGRN 3 66196 4.532E-5 33098 0 6.37836E-5
1-979024-C-T p.Asp570Asp synonymous AGRN 1 65770 1.52045E-5 32885 0 3.42489E-5
1-979031-A-T p.Thr573Ser missense AGRN 2 65278 3.06382E-5 32639 0 8.56795E-6
1-979033-G-A p.Thr573Thr synonymous AGRN 3 64768 4.63192E-5 32384 0 2.57153E-5
1-979042-C-T p.Ser576Ser synonymous AGRN 13 63766 2.0387E-4 31883 0 5.03525E-4
1-979043-G-A p.Glu577Lys missense AGRN 5 63700 7.84929E-5 31850 0 6.00508E-5
1-979045-G-A p.Glu577Glu synonymous AGRN 7 63864 1.09608E-4 31932 0 1.27804E-4
1-979052-C-G p.Leu580Val missense AGRN 2 63156 3.16676E-5 31578 0 8.58959E-6
1-979058-G-A p.Val582Met missense AGRN 1 62200 1.60772E-5 31100 0 4.30115E-5
1-979063-C-T p.His583His synonymous AGRN 2 61474 3.25341E-5 30737 0 6.38529E-5
1-979083-G-A p.Ser590Asn missense AGRN 2 59650 3.35289E-5 29825 0 6.39904E-5
1-979097-TC-CT p.Ser595Leu missense AGRN 6 58020 1.03413E-4 29010 0 NA
1-979097-T-C p.Ser595Pro missense AGRN 1 58020 1.72354E-5 29010 0 8.5357E-5
1-979098-C-T p.Ser595Leu missense AGRN 1 58038 1.72301E-5 29019 0 8.96348E-5
1-979103-G-A p.Gly597Arg missense AGRN 1 57360 1.74338E-5 28680 0 3.47234E-5
1-979111-TGGTGAGTGAGGCCCTGGGGCCGGGCGGGCCAGGGTCCTGTGCCTCCCTCAGCCTGGGCCTGCCGACCCCTGCCTGGCTCTGTCTCCTGCA-T p.Glu600fs frameshift AGRN 2 56806 3.52075E-5 28403 1 NA
1-979217-G-A p.Ala605Thr missense AGRN 1 61324 1.63068E-5 30662 0 NA
1-979219-C-T p.Ala605Ala synonymous AGRN 10 61782 1.61859E-4 30891 0 0.00100806
1-979230-T-C p.Phe609Ser missense AGRN 3 64232 4.67057E-5 32116 0 4.14295E-6
1-979246-C-T p.Ser614Ser synonymous AGRN 1 67562 1.48012E-5 33781 0 5.04541E-4
1-979247-G-A p.Ala615Thr missense AGRN 3 67514 4.44352E-5 33757 0 2.48272E-5
1-979268-C-T p.Arg622Trp missense AGRN 19 71914 2.64204E-4 35957 0 5.04541E-4
1-979269-G-A p.Arg622Gln missense AGRN 15 72128 2.07964E-4 36064 0 6.25E-4
1-979282-C-A p.Pro626Pro synonymous AGRN 1 74054 1.35037E-5 37027 0 4.15652E-6
1-979283-C-T p.Pro627Ser missense AGRN 1 74144 1.34873E-5 37072 0 6.25E-4
1-979284-C-T p.Pro627Leu missense AGRN 1 74254 1.34673E-5 37127 0 1.83898E-5
1-979288-C-T p.Pro628Pro synonymous AGRN 3 75270 3.98565E-5 37635 0 6.3861E-5
1-979289-G-A p.Gly629Ser missense AGRN 1 75478 1.32489E-5 37739 0 4.14976E-5
1-979289-G-T p.Gly629Cys missense AGRN 2 75478 2.64978E-5 37739 0 9.22782E-6
1-979294-C-T p.Pro630Pro synonymous AGRN 2 76912 2.60037E-5 38456 0 1.28263E-4
1-979295-G-A p.Val631Met missense AGRN 2 77038 2.59612E-5 38519 0 0.00151515
1-979298-T-C p.Cys632Arg missense AGRN 2 77562 2.57858E-5 38781 0 NA
1-979306-C-T p.Ser634Ser synonymous AGRN 11 77918 1.41174E-4 38959 0 0.0025
1-979309-C-T p.Asp635Asp synonymous AGRN 3 78518 3.82078E-5 39259 0 1.67065E-5
1-979311-G-T p.Gly636Val missense AGRN 1 78878 1.26778E-5 39439 0 4.17554E-6
1-979313-G-A p.Val637Ile missense AGRN 1 79038 1.26521E-5 39519 0 NA
1-979315-C-T p.Val637Val synonymous AGRN 1 79162 1.26323E-5 39581 0 8.40096E-6
1-979321-C-T p.Tyr639Tyr synonymous AGRN 2 79360 2.52016E-5 39680 0 6.37836E-5
1-979322-G-A p.Gly640Ser missense AGRN 3 79396 3.77853E-5 39698 0 0.00202429
1-979324-C-T p.Gly640Gly synonymous AGRN 1 79542 1.2572E-5 39771 0 2.91664E-5
1-979326-G-A p.Ser641Asn missense AGRN 1 79678 1.25505E-5 39839 0 NA
1-979333-C-T p.Cys643Cys synonymous AGRN 6 79874 7.51183E-5 39937 0 1.02682E-4
1-979334-G-A p.Glu644Lys missense AGRN 1 80026 1.24959E-5 40013 0 6.37714E-5
1-979340-C-T p.Arg646Trp missense AGRN 2 80324 2.48992E-5 40162 0 5.05561E-4
1-979341-G-A p.Arg646Gln missense AGRN 4 80462 4.97129E-5 40231 0 3.99297E-5
1-979348-C-T p.Ala648Ala synonymous AGRN 1 80670 1.23962E-5 40335 0 2.99509E-5
1-979349-G-A p.Ala649Thr missense AGRN 6 80728 7.43237E-5 40364 0 9.56145E-5
1-979360-G-A p.Gln652Gln synonymous AGRN 1 81294 1.2301E-5 40647 0 4.22972E-6
1-979365-C-T p.Thr654Ile missense AGRN 1 81430 1.22805E-5 40715 0 9.79374E-6
1-979366-A-G p.Thr654Thr synonymous AGRN 2 81434 2.45598E-5 40717 0 9.77574E-6
1-979369-G-A p.Gln655Gln synonymous AGRN 1 81490 1.22714E-5 40745 0 4.24185E-6
1-979372-C-T p.Ile656Ile synonymous AGRN 3 81418 3.68469E-5 40709 0 6.37349E-5
1-979382-C-T p.Arg660Trp missense AGRN 1 81658 1.22462E-5 40829 0 0.00100705
1-979383-G-T p.Arg660Leu missense AGRN 2 81664 2.44906E-5 40832 0 1.26488E-5
1-979386-C-T p.Ala661Val missense AGRN 4 81708 4.89548E-5 40854 0 3.18654E-5
1-979389-G-A p.Gly662Glu missense AGRN 1 81760 1.22309E-5 40880 0 9.59859E-6
1-979391-C-T p.Pro663Ser missense AGRN 1 81760 1.22309E-5 40880 0 NA
1-979392-C-T p.Pro663Leu missense AGRN 1 81756 1.22315E-5 40878 0 2.92757E-5
1-979393-G-A p.Pro663Pro synonymous AGRN 3 81790 3.66793E-5 40895 0 9.55901E-5
1-979396-C-T p.Cys664Cys synonymous AGRN 6 81802 7.33478E-5 40901 0 1.99597E-4
1-979397-G-A p.Glu665Lys missense AGRN 210 81836 0.00256611 40918 0 0.00704405
1-979399-G-T p.Glu665Asp missense AGRN 1 81870 1.22145E-5 40935 0 1.24307E-5
1-979400-C-G p.Gln666Glu missense AGRN 22 81878 2.68692E-4 40939 0 3.82434E-4
1-979402-GGGTAGGCCGGGGGACGCTGGCGAAAACTGCTGGGCTCTGGCTTTGGACAAGAAGCCCCTGGGTGACTCTGCTCCCCTTCCCCGCA-G p.Ala667fs frameshift AGRN 8 81952 9.76181E-5 40976 4 NA
1-979408-G-A c.1999+5G>A splice_region AGRN 1 81958 1.22014E-5 40979 0 3.18674E-5
1-979411-G-A c.1999+8G>A splice_region AGRN 1 82036 1.21898E-5 41018 0 3.18634E-5
1-979483-C-T c.2000-6C>T splice_region AGRN 1 82612 1.21048E-5 41306 0 3.18715E-5
1-979485-G-A c.2000-4G>A splice_region AGRN 3 82544 3.63443E-5 41272 0 1.67667E-5
1-979490-C-T p.Ala667Ala splice_region+synonymous AGRN 1 82554 1.21133E-5 41277 0 1.67462E-5
1-979491-G-A p.Glu668Lys missense+splice_region AGRN 7 82544 8.48033E-5 41272 0 1.59368E-4
1-979496-C-T p.Cys669Cys synonymous AGRN 7 82564 8.47827E-5 41282 0 6.37552E-5
1-979497-G-A p.Gly670Ser missense AGRN 1 82576 1.21101E-5 41288 0 6.37511E-5
1-979502-C-T p.Ser671Ser synonymous AGRN 34 82566 4.11792E-4 41283 0 0.00105196
1-979503-G-A p.Gly672Arg missense AGRN 4 82568 4.84449E-5 41284 0 3.18817E-5
1-979514-C-G p.Gly675Gly synonymous AGRN 393 82596 0.0047581 41298 4 0.0110962
1-979517-T-A p.Ser676Ser synonymous AGRN 8 82600 9.68523E-5 41300 0 6.25E-4
1-979526-C-T p.Asp679Asp synonymous AGRN 2 82552 2.42272E-5 41276 0 1.19846E-5
1-979527-G-A p.Gly680Ser missense AGRN 2 82574 2.42207E-5 41287 0 6.25E-4
1-979533-T-C p.Cys682Arg missense AGRN 1 82578 1.21098E-5 41289 0 NA
1-979537-A-C p.Glu683Ala missense AGRN 1 82608 1.21054E-5 41304 0 1.19786E-5
1-979549-G-C p.Cys687Ser missense AGRN 2 82652 2.41978E-5 41326 0 NA
1-979551-C-A p.Arg688Arg synonymous AGRN 1 82618 1.21039E-5 41309 0 8.32598E-6
1-979552-G-A p.Arg688Gln missense AGRN 4 82650 4.83969E-5 41325 0 0.00151057
1-979556-G-A p.Gln689Gln synonymous AGRN 356 82672 0.00430617 41336 0 0.00704935
1-979557-C-T p.Arg690Cys missense AGRN 1 82646 1.20998E-5 41323 0 NA
1-979558-G-A p.Arg690His missense AGRN 1 82662 1.20975E-5 41331 0 2.49709E-5
1-979559-C-T p.Arg690Arg synonymous AGRN 3 82648 3.62985E-5 41324 0 3.32923E-5
1-979561-G-T p.Gly691Val missense AGRN 1 82700 1.20919E-5 41350 0 NA
1-979563-G-A p.Gly692Ser missense AGRN 1 82710 1.20904E-5 41355 0 NA
1-979572-G-C p.Asp695His missense AGRN 1 82736 1.20866E-5 41368 0 NA
1-979578-G-A p.Asp697Asn missense AGRN 2 82724 2.41768E-5 41362 0 8.32196E-6
1-979582-C-T p.Ser698Leu missense AGRN 2 82680 2.41896E-5 41340 0 7.58628E-5
1-979589-C-T p.Asp700Asp synonymous AGRN 15 82696 1.81387E-4 41348 0 3.19326E-4
1-979590-G-A p.Gly701Arg missense AGRN 2 82710 2.41809E-5 41355 0 3.19224E-5
1-979594-C-T p.Pro702Leu missense AGRN 33 82692 3.99071E-4 41346 0 4.95117E-4
1-979605-G-A p.Asp706Asn missense AGRN 1 82732 1.20872E-5 41366 0 NA
1-979623-G-A p.Val712Ile missense AGRN 1 82630 1.21021E-5 41315 0 1.66658E-5
1-979631-C-G p.Gly714Gly synonymous AGRN 1 82566 1.21115E-5 41283 0 8.33889E-6
1-979634-C-T p.Ser715Ser synonymous AGRN 2 82542 2.42301E-5 41271 0 3.19224E-5
1-979636-CGGTGAGCTCTGTACCCCTGGCTCTCGGCGGGCGGCGGGGACGGGGCTGCGGCCGCTCACACTGACACCACCCTCCA-C p.Val717fs frameshift AGRN 4 82522 4.84719E-5 41261 2 NA
1-979636-C-T p.Pro716Leu missense+splice_region AGRN 4 82528 4.84684E-5 41264 0 6.38733E-5
1-979645-C-G c.2148+8C>G splice_region AGRN 3 82444 3.63883E-5 41222 0 3.19081E-5
1-979645-C-T c.2148+8C>T splice_region AGRN 1 82444 1.21294E-5 41222 0 NA
1-979720-G-A p.Gly719Ser missense AGRN 56 82098 6.82112E-4 41049 0 0.00133954
1-979731-G-A p.Gly722Gly synonymous AGRN 2 82142 2.43481E-5 41071 0 NA
1-979732-G-T p.Val723Phe missense AGRN 1 82130 1.21758E-5 41065 0 5.03525E-4
1-979746-C-T p.Thr727Thr synonymous AGRN 3 82116 3.65337E-5 41058 0 5.03525E-4
1-979748-A-T p.Glu728Val missense AGRN 2882 82078 0.0351129 41039 52 0.041875
1-979756-C-G p.Leu731Val missense AGRN 2 82088 2.43641E-5 41044 0 4.01564E-6
1-979767-C-T p.Ala734Ala synonymous AGRN 1 82046 1.21883E-5 41023 0 4.02233E-6
1-979784-G-A p.Arg740Gln missense AGRN 24 81784 2.93456E-4 40892 0 0.001875
1-979795-G-A p.Val744Ile missense AGRN 1 81582 1.22576E-5 40791 0 2.09705E-5
1-979800-G-T p.Ala745Ala synonymous AGRN 2 81432 2.45604E-5 40716 0 5.06073E-4
1-979806-G-C p.Gln747His missense AGRN 6 81396 7.37137E-5 40698 0 9.56267E-5
1-979811-C-G p.Ala749Gly missense AGRN 2 81228 2.46221E-5 40614 0 3.18979E-5
1-979817-G-A p.Arg751Gln missense+splice_region AGRN 1 81114 1.23283E-5 40557 0 5.06073E-4
1-979820-G-GCCCCACCTTCGCCCCGCTGCCGCCTGTGGCCCCCTTACAC c.2254+1_2254+2insCCCCACCTTCGCCCCGCTGCCGCCTGTGGCCCCCTTACAC splice_donor AGRN 5 80992 6.17345E-5 40496 2 NA
1-979823-A-G c.2254+4A>G splice_region AGRN 1 80830 1.23716E-5 40415 0 1.34235E-5
1-979826-C-T c.2254+7C>T splice_region AGRN 6 80666 7.43808E-5 40333 0 4.17885E-5
1-980533-T-C c.2255-8T>C splice_region AGRN 1 70604 1.41635E-5 35302 0 8.48191E-6
1-980538-C-T c.2255-3C>T splice_region AGRN 3 71010 4.22476E-5 35505 0 3.39622E-5
1-980551-C-T p.Phe755Phe synonymous AGRN 2 72072 2.775E-5 36036 0 1.62815E-5
1-980552-G-A p.Ala756Thr missense AGRN 104 71794 0.00144859 35897 1 0.0131579
1-980556-C-T p.Pro757Leu missense AGRN 5 72562 6.89066E-5 36281 0 3.41866E-4
1-980556-C-A p.Pro757Gln missense AGRN 1 72562 1.37813E-5 36281 0 NA
1-980556-C-G p.Pro757Arg missense AGRN 1 72562 1.37813E-5 36281 0 4.26127E-5
1-980557-G-A p.Pro757Pro synonymous AGRN 15 72534 2.068E-4 36267 0 1.79192E-4
1-980562-C-T p.Pro759Leu missense AGRN 3 73208 4.09791E-5 36604 0 8.13332E-6
1-980563-G-A p.Pro759Pro synonymous AGRN 78 73166 0.00106607 36583 0 0.00101112
1-980570-G-T p.Ala762Ser missense AGRN 2 73520 2.72035E-5 36760 0 1.70891E-5
1-980577-T-C p.Leu764Ser missense AGRN 1 73864 1.35384E-5 36932 0 1.7118E-5
1-980580-A-G p.His765Arg missense AGRN 3 73816 4.06416E-5 36908 0 4.28515E-5
1-980592-C-T p.Thr769Met missense AGRN 6 73292 8.18643E-5 36646 0 6.25782E-4
1-980595-C-T p.Pro770Leu missense AGRN 9 73318 1.22753E-4 36659 0 3.50653E-4
1-980599-C-T p.Tyr771Tyr synonymous AGRN 2 73140 2.73448E-5 36570 0 3.18837E-5
1-980600-G-A p.Gly772Ser missense AGRN 2 72860 2.74499E-5 36430 0 3.18756E-5
1-980615-A-C p.Asn777His missense AGRN 1 72254 1.38401E-5 36127 0 6.12081E-5
1-980615-A-G p.Asn777Asp missense AGRN 1 72254 1.38401E-5 36127 0 NA
1-980620-C-T p.Ile778Ile synonymous AGRN 1 71914 1.39055E-5 35957 0 3.18695E-5
1-980623-C-T p.Thr779Thr synonymous AGRN 10 71404 1.40048E-4 35702 0 1.91217E-4
1-980624-G-A p.Ala780Thr missense AGRN 7 70932 9.86861E-5 35466 0 1.07059E-4
1-980628-C-A p.Ala781Asp missense AGRN 3 70666 4.24532E-5 35333 1 4.15683E-6
1-980630-C-T p.Arg782Trp missense AGRN 1 70360 1.42126E-5 35180 0 4.16493E-6
1-980631-G-A p.Arg782Gln missense AGRN 1 70192 1.42466E-5 35096 0 9.5645E-5
1-980631-G-C p.Arg782Pro missense AGRN 1 70192 1.42466E-5 35096 0 NA
1-980635-C-T p.Gly783Gly synonymous AGRN 2 69652 2.87142E-5 34826 0 0.00251762
1-980636-G-A p.Val784Met missense AGRN 1 69926 1.43008E-5 34963 0 1.16398E-4
1-980648-G-C p.Gly788Arg missense AGRN 1 70268 1.42312E-5 35134 0 8.98456E-6
1-980655-C-T p.Pro790Leu missense+splice_region AGRN 2 70066 2.85445E-5 35033 0 NA
1-980657-AGTGAGTACCTGAGCTCAGCCCCGACCCCGGGCCTGGTGCGGCTGTGCGGCCACGTGACCTTGTCCTGCCCTGGCCTTTCAG-A c.2371+1_2372-1delGTGAGTACCTGAGCTCAGCCCCGACCCCGGGCCTGGTGCGGCTGTGCGGCCACGTGACCTTGTCCTGCCCTGGCCTTTCAG splice_acceptor AGRN 6 69872 8.58713E-5 34936 3 NA
1-980734-T-G c.2372-5T>G splice_region AGRN 1 76016 1.31551E-5 38008 0 4.08924E-6
1-980748-A-C p.Gln794Pro missense AGRN 2 77520 2.57998E-5 38760 0 NA
1-980749-G-A p.Gln794Gln synonymous AGRN 1 77552 1.28946E-5 38776 0 NA
1-980757-C-G p.Pro797Arg missense AGRN 2 78262 2.55552E-5 39131 0 1.62583E-5
1-980760-A-G p.His798Arg missense AGRN 2 78560 2.54582E-5 39280 0 NA
1-980767-T-C p.Ser800Ser synonymous AGRN 20 78936 2.5337E-4 39468 0 6.25E-4
1-980771-G-A p.Gly802Ser missense AGRN 5 78694 6.35372E-5 39347 0 5.47206E-5
1-980773-C-T p.Gly802Gly synonymous AGRN 353 78734 0.00448345 39367 2 0.0108099
1-980773-C-A p.Gly802Gly synonymous AGRN 1 78760 1.26968E-5 39380 0 NA
1-980788-A-G p.Pro807Pro synonymous AGRN 3 79182 3.78874E-5 39591 0 3.18817E-5
1-980810-C-T p.Arg815Cys missense AGRN 1 80360 1.2444E-5 40180 0 8.56326E-6
1-980811-G-A p.Arg815His missense AGRN 4 80274 4.98293E-5 40137 0 6.25E-4
1-980816-G-A p.Gly817Ser missense AGRN 1 80744 1.23848E-5 40372 0 2.00987E-5
1-980824-G-C p.Gly819Gly synonymous AGRN 834 81106 0.0102828 40553 13 0.0209768
1-980824-G-A p.Gly819Gly synonymous AGRN 21 81164 2.58735E-4 40582 1 7.33231E-4
1-980839-C-A p.Asp824Glu missense AGRN 1 81816 1.22225E-5 40908 0 8.00743E-6
1-980840-C-G p.Arg825Gly missense AGRN 1 81846 1.22181E-5 40923 0 NA
1-980840-C-T p.Arg825Cys missense AGRN 3 81846 3.66542E-5 40923 0 5.89513E-5
1-980841-G-A p.Arg825His missense AGRN 2 81878 2.44266E-5 40939 0 6.25E-4
1-980842-C-T p.Arg825Arg synonymous AGRN 3 81974 3.6597E-5 40987 0 8.41723E-6
1-980847-A-T p.Glu827Val missense AGRN 2 82164 2.43416E-5 41082 0 NA
1-980849-C-G p.Pro828Ala missense AGRN 10 82190 1.21669E-4 41095 0 6.25E-4
1-980849-C-T p.Pro828Ser missense AGRN 8 82190 9.73354E-5 41095 0 1.68141E-5
1-980857-C-T p.Phe830Phe synonymous AGRN 3 82410 3.64033E-5 41205 1 NA
1-980861-A-G p.Asn832Asp missense AGRN 2 82428 2.42636E-5 41214 0 1.59946E-5
1-980863-C-G p.Asn832Lys missense AGRN 4 82488 4.84919E-5 41244 0 2.22973E-4
1-980866-T-C p.Phe833Phe synonymous AGRN 1 82510 1.21197E-5 41255 0 3.18634E-5
1-980866-T-A p.Phe833Leu missense AGRN 1 82510 1.21197E-5 41255 0 NA
1-980867-C-G p.Arg834Gly missense AGRN 1 82514 1.21192E-5 41257 0 NA
1-980868-G-A p.Arg834Gln missense AGRN 57 82518 6.90758E-4 41259 0 0.00131057
1-980868-G-C p.Arg834Pro missense AGRN 2 82518 2.42371E-5 41259 0 NA
1-980875-C-T p.Ile836Ile synonymous AGRN 42 82602 5.08462E-4 41301 0 0.00252016
1-980876-G-A p.Val837Ile missense AGRN 1 82608 1.21054E-5 41304 0 6.25E-4
1-980881-C-T p.Thr838Thr synonymous AGRN 12 82618 1.45247E-4 41309 0 6.37227E-5
1-980881-C-A p.Thr838Thr synonymous AGRN 3 82620 3.63108E-5 41310 0 4.00333E-6
1-980882-G-A p.Asp839Asn missense AGRN 8 82612 9.68382E-5 41306 0 1.59307E-4
1-980888-C-T p.Arg841Trp missense AGRN 1 82614 1.21045E-5 41307 0 3.37132E-5
1-980889-G-A p.Arg841Gln missense AGRN 2 82624 2.4206E-5 41312 0 6.25E-4
1-980892-G-A p.Ser842Asn missense AGRN 1 82614 1.21045E-5 41307 0 4.00827E-6
1-980903-C-T p.Pro846Ser missense+splice_region AGRN 12 82480 1.4549E-4 41240 0 3.50609E-4
1-981109-A-C c.2537-4A>C splice_region AGRN 14 82972 1.68732E-4 41486 1 7.98492E-5
1-981114-C-G p.Pro846Pro splice_region+synonymous AGRN 4 82986 4.82009E-5 41493 0 6.37267E-5
1-981118-A-G p.Ser848Gly missense AGRN 1 83002 1.20479E-5 41501 0 NA
1-981131-A-G p.Gln852Arg missense AGRN 1028 83014 0.0123835 41507 21 0.0247705
1-981135-C-T p.Gly853Gly synonymous AGRN 4 83028 4.81765E-5 41514 0 6.77934E-5
1-981136-G-A p.Ala854Thr missense AGRN 1 83020 1.20453E-5 41510 0 6.63416E-5
1-981138-C-G p.Ala854Ala synonymous AGRN 2 83032 2.40871E-5 41516 0 6.37511E-5
1-981139-G-A p.Val855Met missense AGRN 3 83032 3.61306E-5 41516 0 2.73655E-4
1-981142-C-T p.Arg856Trp missense AGRN 4 83048 4.81649E-5 41524 0 3.19005E-5
1-981142-C-G p.Arg856Gly missense AGRN 2 83048 2.40825E-5 41524 0 NA
1-981143-G-A p.Arg856Gln missense AGRN 3 83048 3.61237E-5 41524 0 1.65854E-5
1-981145-G-A p.Asp857Asn missense AGRN 2 83062 2.40784E-5 41531 0 1.19602E-5
1-981164-C-T p.Thr863Met missense AGRN 1 83008 1.2047E-5 41504 0 2.48987E-5
1-981165-G-A p.Thr863Thr synonymous AGRN 4 83000 4.81928E-5 41500 0 1.65983E-5
1-981176-C-T p.Ser867Leu missense AGRN 1 82978 1.20514E-5 41489 0 3.18837E-5
1-981177-G-A p.Ser867Ser synonymous AGRN 12 82980 1.44613E-4 41490 0 2.54988E-4
1-981177-G-C p.Ser867Ser synonymous AGRN 3 82980 3.61533E-5 41490 0 5.03525E-4
1-981177-G-T p.Ser867Ser synonymous AGRN 1 82980 1.20511E-5 41490 0 2.49132E-5
1-981178-T-C p.Cys868Arg missense AGRN 1 82968 1.20528E-5 41484 0 NA
1-981182-A-G p.Lys869Arg missense AGRN 1 82972 1.20523E-5 41486 0 NA
1-981186-C-T p.Pro870Pro synonymous AGRN 8 82930 9.64669E-5 41465 0 1.91253E-4
1-981189-G-C p.Gly871Gly synonymous AGRN 1 82916 1.20604E-5 41458 0 NA
1-981193-G-T p.Ala873Ser missense AGRN 1 82886 1.20648E-5 41443 0 NA
1-981195-T-C p.Ala873Ala synonymous AGRN 2 82892 2.41278E-5 41446 0 9.56328E-5
1-981215-G-A p.Cys880Tyr missense AGRN 1 82760 1.20831E-5 41380 0 NA
1-981222-C-T p.Asp882Asp synonymous AGRN 3 82664 3.62915E-5 41332 0 1.68938E-4
1-981223-G-A p.Gly883Ser missense AGRN 18 82618 2.1787E-4 41309 0 2.73505E-4
1-981226-C-T p.Arg884Cys missense AGRN 4 82568 4.84449E-5 41284 0 2.50874E-5
1-981226-C-G p.Arg884Gly missense AGRN 1 82568 1.21112E-5 41284 0 3.18878E-5
1-981227-G-A p.Arg884His missense AGRN 3 82596 3.63214E-5 41298 0 1.2751E-4
1-981235-G-T p.Gly887Cys missense AGRN 1 82546 1.21145E-5 41273 0 3.35396E-5
1-981238-C-T p.Pro888Ser missense AGRN 6 82512 7.27167E-5 41256 0 6.46742E-5
1-981240-C-T p.Pro888Pro synonymous AGRN 4 82434 4.85237E-5 41217 0 5.03221E-5
1-981241-G-A p.Ala889Thr missense AGRN 1 82438 1.21303E-5 41219 0 3.35542E-5
1-981242-C-T p.Ala889Val missense AGRN 3 82392 3.64113E-5 41196 0 6.37877E-5
1-981243-G-A p.Ala889Ala synonymous AGRN 11 82424 1.33456E-4 41212 0 0.00100705
1-981244-G-C p.Gly890Arg missense AGRN 1 82402 1.21356E-5 41201 0 4.04514E-6
1-981252-A-G p.Glu892Glu synonymous AGRN 1 82388 1.21377E-5 41194 0 4.04839E-6
1-981255-TGGTGAGTGAGGGCCAGCGCTACCCTGGGGCTTCATGGGGTGGGGTGGGGTCACCCGAGCCACAGAGGTTTCCCATGCCCGTGCCCCA-T p.Asp894fs frameshift AGRN 8 82360 9.71345E-5 41180 2 NA
1-981262-T-C c.2680+6T>C splice_region AGRN 4 82206 4.86583E-5 41103 0 1.68039E-5
1-981340-C-T c.2681-4C>T splice_region AGRN 104 82340 0.00126306 41170 0 0.0012437
1-981345-C-T p.Asp894Asp splice_region+synonymous AGRN 46 82358 5.58537E-4 41179 0 0.0020141
1-981346-G-A p.Ala895Thr missense+splice_region AGRN 2 82378 2.42783E-5 41189 0 6.6778E-5
1-981347-C-T p.Ala895Val missense AGRN 1 82406 1.2135E-5 41203 0 NA
1-981353-C-T p.Ala897Val missense AGRN 131 82452 0.0015888 41226 0 0.00209341
1-981356-C-T p.Pro898Leu missense AGRN 1 82548 1.21142E-5 41274 0 NA
1-981359-C-T p.Ala899Val missense AGRN 2 82544 2.42295E-5 41272 0 1.59803E-5
1-981360-G-A p.Ala899Ala synonymous AGRN 5 82594 6.05371E-5 41297 0 3.59502E-5
1-981362-C-T p.Thr900Ile missense AGRN 2 82620 2.42072E-5 41310 0 7.98703E-6
1-981366-T-C p.Cys901Cys synonymous AGRN 1 82652 1.20989E-5 41326 0 NA
1-981368-C-T p.Ala902Val missense AGRN 1 82654 1.20986E-5 41327 0 3.59362E-5
1-981376-C-T p.Arg905Cys missense AGRN 30 82700 3.62757E-4 41350 0 3.57636E-4
1-981376-C-G p.Arg905Gly missense AGRN 5 82700 6.04595E-5 41350 0 6.37349E-5
1-981378-C-G p.Arg905Arg synonymous AGRN 3 82724 3.62652E-5 41362 0 3.59155E-5
1-981387-C-T p.Phe908Phe synonymous AGRN 3 82766 3.62468E-5 41383 0 3.18674E-5
1-981388-G-A p.Gly909Ser missense AGRN 6 82770 7.249E-5 41385 0 3.59193E-5
1-981392-C-T p.Ala910Val missense AGRN 2 82768 2.41639E-5 41384 0 6.37349E-5
1-981394-C-T p.Arg911Trp missense AGRN 1 82770 1.20817E-5 41385 0 3.32369E-5
1-981400-G-A p.Val913Met missense AGRN 13 82824 1.56959E-4 41412 0 1.66121E-4
1-981407-A-G p.Glu915Gly missense AGRN 1 82882 1.20653E-5 41441 0 1.66091E-5
1-981415-T-C p.Ser918Pro missense AGRN 2 82882 2.41307E-5 41441 0 NA
1-981426-T-C p.Cys921Cys synonymous AGRN 3 82920 3.61795E-5 41460 0 3.18695E-5
1-981434-C-T p.Pro924Leu missense AGRN 3 82856 3.62074E-5 41428 0 3.18695E-5
1-981458-A-G p.Asn932Ser missense AGRN 1 82758 1.20834E-5 41379 0 NA
1-981459-C-T p.Asn932Asn synonymous AGRN 91 82728 0.00109999 41364 1 0.00956697
1-981460-G-A p.Ala933Thr missense AGRN 1 82740 1.20861E-5 41370 0 3.31477E-5
1-981462-T-A p.Ala933Ala synonymous AGRN 3 82740 3.62582E-5 41370 0 3.98489E-6
1-981466-AAGGTGAGGGGTGTGGGATGTGAAGGGGAGTGGGGAGGAGGCCTCGCCTTGAACATCCTTGTTCTCTGCCCC-A p.Lys935fs frameshift AGRN 5 82750 6.0423E-5 41375 0 NA
1-981475-G-A c.2805+7G>A splice_region AGRN 71 82694 8.58587E-4 41347 0 0.00207257
1-981532-T-C c.2806-8T>C splice_region AGRN 1 82784 1.20796E-5 41392 0 NA
1-981534-C-T c.2806-6C>T splice_region AGRN 1 82758 1.20834E-5 41379 0 NA
1-981535-C-T c.2806-5C>T splice_region AGRN 2 82780 2.41604E-5 41390 0 1.65366E-5
1-981550-C-T p.Ser939Leu missense AGRN 2 82800 2.41546E-5 41400 0 NA
1-981563-A-G p.Thr943Thr synonymous AGRN 1 82810 1.20758E-5 41405 0 6.37999E-5
1-981567-G-A p.Gly945Ser missense AGRN 3 82778 3.62415E-5 41389 0 NA
1-981582-C-T p.Leu950Leu synonymous AGRN 1 82794 1.20782E-5 41397 0 1.65462E-5
1-981594-G-A p.Ala954Thr missense AGRN 7 82676 8.46679E-5 41338 0 6.38366E-5
1-981599-C-T p.Cys955Cys synonymous AGRN 1 82714 1.20899E-5 41357 0 NA
1-981600-C-T p.Arg956Cys missense AGRN 1 82718 1.20893E-5 41359 0 3.31214E-5
1-981601-G-A p.Arg956His missense AGRN 2 82660 2.41955E-5 41330 0 2.48451E-5
1-981617-C-T p.Ile961Ile synonymous AGRN 4 82662 4.83898E-5 41331 0 NA
1-981625-A-G p.Gln964Arg missense AGRN 1 82598 1.21068E-5 41299 0 NA
1-981628-G-A p.Ser965Asn missense AGRN 2 82530 2.42336E-5 41265 0 8.30096E-5
1-981636-C-T p.Pro968Ser missense AGRN 1 82394 1.21368E-5 41197 0 NA
1-981637-C-T p.Pro968Leu missense AGRN 1 82344 1.21442E-5 41172 0 8.31034E-6
1-981638-G-A p.Pro968Pro synonymous AGRN 4 82318 4.8592E-5 41159 0 1.27689E-4
1-981638-G-C p.Pro968Pro synonymous AGRN 2 82318 2.4296E-5 41159 0 2.39454E-5
1-981645-G-GAGGCTGTTGCTCCCAGCACTCACCCGACATCTGCCTCC c.2911_2911+1insAGGCTGTTGCTCCCAGCACTCACCCGACATCTGCCTCC splice_donor AGRN 1 82274 1.21545E-5 41137 0 NA
1-981647-T-C c.2911+2T>C splice_donor AGRN 1 82214 1.21634E-5 41107 0 NA
1-981652-C-T c.2911+7C>T splice_region AGRN 1 82114 1.21782E-5 41057 0 1.66728E-5
1-981653-CT-AA c.2911+8_2911+9delCTinsAA splice_region AGRN 1 82108 1.21791E-5 41054 0 NA
1-981778-G-A p.Glu971Glu splice_region+synonymous AGRN 2 80412 2.48719E-5 40206 0 4.09339E-5
1-981802-G-A p.Pro979Pro synonymous AGRN 1 80376 1.24415E-5 40188 0 9.04683E-6
1-981804-C-T p.Thr980Ile missense AGRN 1 80448 1.24304E-5 40224 0 9.0225E-6
1-981807-C-T p.Ser981Phe missense AGRN 1 80462 1.24282E-5 40231 0 3.59958E-5
1-981815-G-A p.Val984Met missense AGRN 24 80362 2.98649E-4 40181 0 5.04032E-4
1-981836-C-T p.Leu991Phe missense AGRN 6 80132 7.48765E-5 40066 0 7.34089E-5
1-981852-C-A p.Ala996Glu missense AGRN 29 80064 3.6221E-4 40032 0 6.00208E-4
1-981858-C-T p.Pro998Leu missense AGRN 23 79886 2.8791E-4 39943 0 0.0012649
1-981858-C-A p.Pro998Gln missense AGRN 1 79886 1.25178E-5 39943 0 NA
1-981859-G-A p.Pro998Pro synonymous AGRN 3 79776 3.76053E-5 39888 0 6.35855E-5
1-981860-GC-G p.Gly1002fs frameshift AGRN 1 79716 1.25445E-5 39858 0 0.00128431
1-981860-G-GC p.Gly1002fs frameshift AGRN 4 79720 5.01756E-5 39860 0 0.0156408
1-981862-C-A p.Ala999Ala synonymous AGRN 11 79840 1.37776E-4 39920 0 1.27747E-4
1-981866-C-A p.Pro1001Thr missense AGRN 11 79964 1.37562E-4 39982 0 0.00100806
1-981866-C-G p.Pro1001Ala missense AGRN 2 79964 2.50113E-5 39982 0 3.19E-5
1-981866-C-T p.Pro1001Ser missense AGRN 4 79964 5.00225E-5 39982 0 1.276E-4
1-981868-C-T p.Pro1001Pro synonymous AGRN 30 79802 3.7593E-4 39901 0 0.00628931
1-981869-G-C p.Gly1002Arg missense AGRN 3 78840 3.80518E-5 39420 0 0.00353179
1-981869-G-A p.Gly1002Ser missense AGRN 3 78968 3.79901E-5 39484 0 7.69474E-5
1-981871-C-T p.Gly1002Gly synonymous AGRN 2 79108 2.52819E-5 39554 0 3.6361E-5
1-981872-G-A p.Ala1003Thr missense AGRN 1 78928 1.26698E-5 39464 0 9.08265E-6
1-981875-C-G p.Leu1004Val missense AGRN 2 79532 2.51471E-5 39766 0 4.12269E-6
1-981876-T-C p.Leu1004Pro missense AGRN 1 79092 1.26435E-5 39546 0 9.14545E-6
1-981880-C-A p.Pro1005Pro synonymous AGRN 2 79616 2.51206E-5 39808 0 4.10189E-6
1-981880-C-G p.Pro1005Pro synonymous AGRN 1 79616 1.25603E-5 39808 0 NA
1-981881-C-G p.Leu1006Val missense AGRN 1 79624 1.2559E-5 39812 0 NA
1-981898-C-T p.Thr1011Thr synonymous AGRN 1 79330 1.26056E-5 39665 0 9.58099E-5
1-981899-G-A p.Ala1012Thr missense AGRN 2 79154 2.52672E-5 39577 0 7.15781E-5
1-981899-G-T p.Ala1012Ser missense AGRN 1 79156 1.26333E-5 39578 0 NA
1-981904-C-T p.His1013His synonymous AGRN 3 79406 3.77805E-5 39703 0 0.00125
1-981904-C-G p.His1013Gln missense AGRN 1 79406 1.25935E-5 39703 0 NA
1-981907-C-T p.Ser1014Ser synonymous AGRN 1 79306 1.26094E-5 39653 0 NA
1-981915-C-T p.Thr1017Ile missense AGRN 1 79264 1.26161E-5 39632 0 NA
1-981918-C-G p.Pro1018Arg missense AGRN 2 79280 2.5227E-5 39640 0 NA
1-981918-C-T p.Pro1018Leu missense AGRN 3 79280 3.78406E-5 39640 0 3.1904E-5
1-981921-C-T p.Pro1019Leu missense AGRN 2 79168 2.52627E-5 39584 0 1.14924E-4
1-981922-G-A p.Pro1019Pro synonymous AGRN 1 78950 1.26662E-5 39475 0 5.72138E-5
1-981922-G-T p.Pro1019Pro synonymous AGRN 1 78950 1.26662E-5 39475 0 8.84048E-6
1-981930-C-T p.Ser1022Leu missense AGRN 1 78924 1.26704E-5 39462 0 4.40661E-5
1-981931-A-G p.Ser1022Ser synonymous AGRN 65280 76854 0.849403 38427 28308 0.886542
1-981932-C-T p.Arg1023* stop_gained AGRN 1 78792 1.26916E-5 39396 0 1.22896E-5
1-981933-G-A p.Arg1023Gln missense AGRN 6 78664 7.62738E-5 39332 0 2.46009E-5
1-981935-C-T p.Pro1024Ser missense AGRN 2 78824 2.5373E-5 39412 0 8.19632E-6
1-981939-G-A p.Arg1025Gln missense AGRN 10 78536 1.2733E-4 39268 0 6.39795E-5
1-981942-C-A p.Thr1026Asn missense AGRN 370 78594 0.00470774 39297 1 0.0101578
1-981942-C-T p.Thr1026Ile missense AGRN 1 78624 1.27188E-5 39312 0 8.22402E-6
1-981946-T-TGCCAGCGTCCCCAGGACCACC p.Ala1028_Thr1034dup disruptive_inframe_insertion AGRN 1 78680 1.27097E-5 39340 0 4.11272E-6
1-981952-C-T p.Ser1029Ser synonymous AGRN 1 78464 1.27447E-5 39232 0 3.19448E-5
1-981953-G-A p.Val1030Ile missense AGRN 2 78342 2.55291E-5 39171 0 1.65261E-5
1-981959-A-T p.Arg1032Trp missense AGRN 1 78422 1.27515E-5 39211 0 NA
1-981959-A-G p.Arg1032Gly missense AGRN 3 78422 3.82546E-5 39211 0 NA
1-981972-G-T p.Trp1036Leu missense AGRN 3 78022 3.84507E-5 39011 0 6.37151E-5
1-981976-C-T p.Pro1037Pro synonymous AGRN 2 77694 2.5742E-5 38847 0 4.5785E-5
1-981977-G-A p.Val1038Met missense AGRN 5 77598 6.44347E-5 38799 0 4.63455E-5
1-981984-C-T p.Thr1040Met missense AGRN 8 77188 1.03643E-4 38594 0 2.03395E-4
1-981985-G-C p.Thr1040Thr synonymous AGRN 5 77026 6.49131E-5 38513 0 3.19061E-5
1-981985-G-A p.Thr1040Thr synonymous AGRN 1 77026 1.29826E-5 38513 0 9.25001E-6
1-981986-G-A p.Val1041Met missense AGRN 1 76952 1.29951E-5 38476 0 9.25326E-6
1-981997-G-A p.Thr1044Thr synonymous AGRN 1 75888 1.31773E-5 37944 0 1.59672E-4
1-982017-G-A p.Ser1051Asn missense AGRN 6 74944 8.00598E-5 37472 0 4.31124E-6
1-982021-G-A p.Leu1052Leu synonymous AGRN 1 74810 1.33672E-5 37405 0 2.16276E-5
1-982025-G-T p.Ala1054Ser missense AGRN 1 74182 1.34804E-5 37091 0 NA
1-982026-C-T p.Ala1054Val missense AGRN 1 74056 1.35033E-5 37028 0 1.59551E-4
1-982027-G-A p.Ala1054Ala synonymous AGRN 2 74000 2.7027E-5 37000 0 2.17964E-5
1-982031-G-A p.Ala1056Thr missense AGRN 7 73704 9.49745E-5 36852 0 1.27584E-4
1-982038-G-C p.Gly1058Ala missense AGRN 1 73752 1.3559E-5 36876 0 1.99964E-5
1-982050-G-A p.Ser1062Asn missense AGRN 1 73138 1.36728E-5 36569 0 3.18735E-5
1-982067-G-A p.Asp1068Asn missense AGRN 1 72612 1.37718E-5 36306 0 NA
1-982070-G-A p.Glu1069Lys missense AGRN 3 72726 4.12507E-5 36363 0 3.18715E-5
1-982081-C-T p.Ser1072Ser synonymous AGRN 1 72388 1.38144E-5 36194 0 6.38121E-5
1-982087-C-T p.Asp1074Asp synonymous AGRN 2 72578 2.75566E-5 36289 0 3.71987E-5
1-982099-T-C p.Ser1078Ser synonymous AGRN 5 73196 6.83097E-5 36598 0 3.20492E-5
1-982107-G-T p.Gly1081Val missense AGRN 1 73530 1.35999E-5 36765 0 NA
1-982108-C-G p.Gly1081Gly synonymous AGRN 1 73562 1.3594E-5 36781 0 1.50263E-5
1-982112-G-T p.Gly1083Trp missense AGRN 2 74110 2.69869E-5 37055 0 NA
1-982116-G-T c.3250+1G>T splice_donor AGRN 1 74276 1.34633E-5 37138 0 NA
1-982202-C-T p.Leu1085Phe missense+splice_region AGRN 1 80174 1.24729E-5 40087 0 NA
1-982204-C-T p.Leu1085Leu synonymous AGRN 1 80208 1.24676E-5 40104 0 7.29927E-5
1-982205-G-A p.Glu1086Lys missense AGRN 5 80188 6.23535E-5 40094 0 0.00102354
1-982207-G-T p.Glu1086Asp missense AGRN 2 80378 2.48824E-5 40189 0 3.19142E-5
1-982210-C-A p.Pro1087Pro synonymous AGRN 1 80504 1.24217E-5 40252 0 NA
1-982213-G-C p.Leu1088Phe missense AGRN 892 80542 0.011075 40271 9 0.019898
1-982213-G-T p.Leu1088Phe missense AGRN 14 80568 1.73766E-4 40284 0 2.87228E-4
1-982221-G-A p.Ser1091Asn missense AGRN 1 80722 1.23882E-5 40361 0 4.95796E-6
1-982225-C-T p.Ser1092Ser synonymous AGRN 13 80738 1.61015E-4 40369 0 0.00168358
1-982234-C-G p.Thr1095Thr synonymous AGRN 49 80882 6.05821E-4 40441 0 0.0017872
1-982235-C-T p.Pro1096Ser missense AGRN 4 80880 4.9456E-5 40440 0 1.44669E-4
1-982245-C-T p.Pro1099Leu missense AGRN 2 80998 2.4692E-5 40499 0 4.82067E-5
1-982249-C-T p.Val1100Val synonymous AGRN 3 81020 3.70279E-5 40510 0 9.88875E-6
1-982250-G-A p.Glu1101Lys missense AGRN 1 81066 1.23356E-5 40533 0 4.83793E-5
1-982269-A-G p.Asn1107Ser missense AGRN 2 81128 2.46524E-5 40564 0 2.53949E-5
1-982273-C-T p.Ser1108Ser synonymous AGRN 4 81148 4.92927E-5 40574 0 1.57142E-4
1-982274-G-A p.Ala1109Thr missense AGRN 1 81150 1.23229E-5 40575 0 3.19122E-5
1-982275-C-A p.Ala1109Glu missense AGRN 1 81146 1.23235E-5 40573 0 NA
1-982275-C-T p.Ala1109Val missense AGRN 1 81146 1.23235E-5 40573 0 5.3251E-5
1-982276-G-A p.Ala1109Ala synonymous AGRN 4 81148 4.92927E-5 40574 0 1.27592E-4
1-982277-T-C p.Leu1110Leu synonymous AGRN 4 81160 4.92854E-5 40580 0 NA
1-982287-G-C p.Cys1113Ser missense AGRN 1 81202 1.2315E-5 40601 0 NA
1-982302-C-A p.Thr1118Lys missense AGRN 107 81100 0.00131936 40550 0 0.0021458
1-982302-C-T p.Thr1118Met missense AGRN 1 81104 1.23298E-5 40552 0 1.0482E-5
1-982315-C-T p.Asp1122Asp synonymous AGRN 5 80994 6.1733E-5 40497 0 3.33515E-4
1-982317-C-T p.Ala1123Val missense AGRN 1 80994 1.23466E-5 40497 0 5.18086E-6
1-982319-G-C p.Glu1124Gln missense AGRN 1 80988 1.23475E-5 40494 0 3.18898E-5
1-982323-G-T p.Gly1125Val missense AGRN 1 80946 1.23539E-5 40473 0 1.27543E-4
1-982329-A-G p.Asn1127Ser missense AGRN 3 80862 3.71002E-5 40431 0 6.3804E-5
1-982329-A-C p.Asn1127Thr missense AGRN 2 80862 2.47335E-5 40431 0 5.20822E-6
1-982330-C-G p.Asn1127Lys missense AGRN 1 80852 1.23683E-5 40426 0 NA
1-982336-C-T p.Pro1129Pro splice_region+synonymous AGRN 13 80774 1.60943E-4 40387 0 9.67243E-5
1-982337-G-GCCACCAAGGT c.3388_3388+1insCCACCAAGGT splice_donor AGRN 1 80766 1.23814E-5 40383 0 NA
1-982338-G-A c.3388+1G>A splice_donor AGRN 1 80738 1.23857E-5 40369 0 NA
1-982712-A-C p.Lys1132Gln missense AGRN 2 82652 2.41978E-5 41326 0 4.15045E-6
1-982715-G-A p.Val1133Met missense AGRN 1 82682 1.20945E-5 41341 0 NA
1-982722-A-G p.Gln1135Arg missense AGRN 917 82692 0.0110893 41346 13 0.036875
1-982726-C-T p.Gly1136Gly synonymous AGRN 1 82728 1.20878E-5 41364 0 1.63507E-5
1-982727-G-A p.Val1137Ile missense AGRN 1 82756 1.20837E-5 41378 0 3.18695E-5
1-982728-TC-AA p.Val1137Glu missense AGRN 1 82764 1.20825E-5 41382 0 NA
1-982735-G-A p.Glu1139Glu synonymous AGRN 2 82834 2.41447E-5 41417 0 2.55093E-5
1-982744-C-T p.Gly1142Gly synonymous AGRN 1 82850 1.207E-5 41425 0 1.01586E-4
1-982745-G-A p.Val1143Ile missense AGRN 1 82842 1.20712E-5 41421 0 1.20825E-5
1-982770-C-T p.Thr1151Met missense AGRN 3 82894 3.61908E-5 41447 0 1.67485E-5
1-982771-G-A p.Thr1151Thr synonymous AGRN 1 82896 1.20633E-5 41448 0 4.0008E-6
1-982774-C-T p.Pro1152Pro synonymous AGRN 2 82900 2.41255E-5 41450 0 2.79991E-5
1-982775-G-A p.Glu1153Lys missense AGRN 1 82914 1.20607E-5 41457 0 3.99907E-6
1-982778-A-G p.Met1154Val missense AGRN 4 82910 4.82451E-5 41455 0 3.34459E-5
1-982783-T-C p.Ala1155Ala synonymous AGRN 595 82874 0.00717957 41437 1 0.00704935
1-982786-C-T p.Asp1156Asp synonymous AGRN 1 82864 1.2068E-5 41432 0 3.18939E-5
1-982804-C-G p.Phe1162Leu missense AGRN 1 82774 1.20811E-5 41387 0 4.00026E-6
1-982815-C-G p.Ala1166Gly missense AGRN 1 82734 1.20869E-5 41367 0 NA
1-982819-G-T p.Arg1167Ser missense AGRN 2 82736 2.41733E-5 41368 0 8.35799E-6
1-982834-CGTAAGACGGGGGCGCAGCCCCCACCTACCCACTGGCCTTCCTCCCCAGATACCCAGAGCAGCACCAGGGCAGCCCGGCTTGGGCGGCCCCCCAAGTCCTTGCCTACTCCCTGCCACAG-C c.3516+1_3517-1del splice_acceptor AGRN 2 82594 2.42148E-5 41297 0 NA
1-982834-C-T p.Thr1172Thr splice_region+synonymous AGRN 2 82594 2.42148E-5 41297 0 1.24284E-4
1-982841-C-T c.3516+7C>T splice_region AGRN 4 82504 4.84825E-5 41252 0 2.01525E-4
1-982842-G-A c.3516+8G>A splice_region AGRN 3 82526 3.63522E-5 41263 0 1.27608E-4
1-982945-TG-T c.3517-7delG splice_region AGRN 13 82828 1.56952E-4 41414 0 1.32326E-4
1-982947-C-T c.3517-6C>T splice_region AGRN 19 82828 2.29391E-4 41414 0 1.91205E-4
1-982958-C-T p.Asp1174Asp synonymous AGRN 7 82900 8.44391E-5 41450 0 5.03525E-4
1-982959-G-A p.Asp1175Asn missense AGRN 2 82898 2.4126E-5 41449 0 3.33795E-5
1-982960-A-G p.Asp1175Gly missense AGRN 1 82924 1.20592E-5 41462 0 1.44051E-4
1-982968-C-T p.Arg1178Trp missense AGRN 7 82944 8.43943E-5 41472 0 5.00359E-5
1-982969-G-A p.Arg1178Gln missense AGRN 83 82964 0.00100043 41482 1 0.00290012
1-982975-C-T p.Ser1180Leu missense AGRN 1 82992 1.20494E-5 41496 0 NA
1-982979-C-T p.Asp1181Asp synonymous AGRN 3 82998 3.61454E-5 41499 0 3.19458E-5
1-982985-G-C p.Lys1183Asn missense AGRN 1 83002 1.20479E-5 41501 0 NA
1-982988-G-A p.Lys1184Lys synonymous AGRN 3 83014 3.61385E-5 41507 0 4.99684E-5
1-982994-T-C p.Phe1186Phe synonymous AGRN 72081 82796 0.870586 41398 31918 0.91375
1-982995-C-T p.Arg1187Trp missense AGRN 1 83026 1.20444E-5 41513 0 2.49422E-5
1-982996-G-A p.Arg1187Gln missense AGRN 3 83034 3.61298E-5 41517 0 3.32552E-5
1-983004-C-T p.Arg1190Cys missense AGRN 2 83026 2.40888E-5 41513 0 8.31615E-6
1-983005-G-A p.Arg1190His missense AGRN 6 83030 7.2263E-5 41515 0 8.31642E-5
1-983006-C-T p.Arg1190Arg synonymous AGRN 406 83014 0.00489074 41507 6 0.0116672
1-983006-C-A p.Arg1190Arg synonymous AGRN 1 83022 1.2045E-5 41511 0 NA
1-983010-C-T p.Arg1192Trp missense AGRN 2 83010 2.40935E-5 41505 0 1.1967E-5
1-983011-G-A p.Arg1192Gln missense AGRN 24 83014 2.89108E-4 41507 0 4.14673E-4
1-983024-C-T p.Pro1196Pro synonymous AGRN 1 83006 1.20473E-5 41503 0 8.32418E-6
1-983034-G-A p.Val1200Ile missense AGRN 7 83008 8.43292E-5 41504 0 3.99036E-5
1-983034-G-T p.Val1200Phe missense AGRN 1 83008 1.2047E-5 41504 0 NA
1-983036-C-T p.Val1200Val synonymous AGRN 2 83008 2.40941E-5 41504 0 NA
1-983037-C-T p.Arg1201Cys missense AGRN 1 83016 1.20459E-5 41508 0 7.98155E-6
1-983038-G-A p.Arg1201His missense AGRN 1 83008 1.2047E-5 41504 0 3.19361E-5
1-983044-T-C p.Ile1203Thr missense AGRN 2 83020 2.40906E-5 41510 0 6.25E-4
1-983050-A-G p.Asp1205Gly missense AGRN 1 83000 1.20482E-5 41500 0 NA
1-983063-C-T p.Asp1209Asp synonymous AGRN 1 82952 1.20552E-5 41476 0 8.37268E-6
1-983067-AGTGAGACCTGCACCCTGGACCCTTCCTGGGAGGCAATGGGTGGGGGATGCCTGGGGCTCTGCCATGCTCAGAGCTCCCTCCTCCCCAG-A c.3631+1_3632-1delGTGAGACCTGCACCCTGGACCCTTCCTGGGAGGCAATGGGTGGGGGATGCCTGGGGCTCTGCCATGCTCAGAGCTCCCTCCTCCCCAG splice_acceptor AGRN 3 82922 3.61786E-5 41461 1 NA
1-983152-C-G c.3632-4C>G splice_region AGRN 1 81766 1.223E-5 40883 0 4.24232E-6
1-983166-C-T