Variant

Variant ID Consequence Effect Gene AC AN AF NS NHOM maxEAF
9-139567849-C-T c.*352+3G>A splice_region AGPAT2 2 4924 4.06174E-4 2462 0 6.37796E-5
9-139568213-C-T p.Pro244Pro synonymous AGPAT2 2 80702 2.47825E-5 40351 0 8.98392E-6
9-139568214-G-A p.Pro244Leu missense AGPAT2 3 80730 3.71609E-5 40365 0 1.59307E-4
9-139568222-G-A p.Gly241Gly synonymous AGPAT2 3 80880 3.7092E-5 40440 0 1.02669E-4
9-139568226-G-C p.Ser240Cys missense AGPAT2 1 80964 1.23512E-5 40482 0 NA
9-139568228-C-A p.Gly239Gly synonymous AGPAT2 1 80996 1.23463E-5 40498 0 6.37308E-5
9-139568228-C-T p.Gly239Gly synonymous AGPAT2 1 80996 1.23463E-5 40498 0 8.61267E-6
9-139568231-C-T p.Ala238Ala synonymous AGPAT2 2 81050 2.46761E-5 40525 0 7.73228E-5
9-139568232-G-A p.Ala238Val missense AGPAT2 232 81048 0.0028625 40524 1 0.00618149
9-139568234-A-G p.Thr237Thr synonymous AGPAT2 2 81088 2.46646E-5 40544 0 8.52036E-6
9-139568238-G-A p.Ala236Val missense AGPAT2 1 81150 1.23229E-5 40575 0 2.96225E-4
9-139568246-C-T p.Glu233Glu synonymous AGPAT2 1 81242 1.23089E-5 40621 0 1.32521E-5
9-139568247-T-C p.Glu233Gly missense AGPAT2 2 81244 2.46172E-5 40622 0 NA
9-139568253-G-A p.Pro231Leu missense AGPAT2 9 81300 1.10701E-4 40650 0 0.00101523
9-139568255-G-T p.Thr230Thr synonymous AGPAT2 2 81280 2.46063E-5 40640 0 9.5584E-5
9-139568255-G-A p.Thr230Thr synonymous AGPAT2 1 81280 1.23031E-5 40640 0 5.08647E-4
9-139568256-G-A p.Thr230Ile missense AGPAT2 3 81252 3.69222E-5 40626 0 2.52723E-5
9-139568264-G-A p.Ile227Ile synonymous AGPAT2 1 81276 1.23038E-5 40638 0 3.18593E-5
9-139568265-A-G p.Ile227Thr missense AGPAT2 2 81260 2.46124E-5 40630 0 NA
9-139568276-G-A p.Thr223Thr synonymous AGPAT2 1 81268 1.2305E-5 40634 0 NA
9-139568277-G-A p.Thr223Ile missense AGPAT2 2 81254 2.46142E-5 40627 0 4.17338E-6
9-139568279-G-A p.Thr222Thr synonymous AGPAT2 39 81234 4.80095E-4 40617 0 6.25E-4
9-139568280-G-A p.Thr222Ile missense AGPAT2 11 81236 1.35408E-4 40618 0 6.37349E-4
9-139568283-C-T p.Arg221Lys missense AGPAT2 2 81232 2.46208E-5 40616 0 1.23347E-5
9-139568292-C-T p.Arg218Gln missense AGPAT2 3 81096 3.69932E-5 40548 0 1.49347E-4
9-139568292-C-CGGTGGCAGGTGTCCACGAGCGCAG p.Pro210_His217dup conservative_inframe_insertion AGPAT2 1 81096 1.23311E-5 40548 0 NA
9-139568293-G-A p.Arg218Trp missense AGPAT2 8 81102 9.86412E-5 40551 0 0.003125
9-139568300-G-A p.Thr215Thr synonymous AGPAT2 7 81002 8.64176E-5 40501 1 4.37631E-4
9-139568301-G-A p.Thr215Ile missense AGPAT2 1 80976 1.23493E-5 40488 0 8.44466E-6
9-139568304-T-C p.Asp214Gly missense AGPAT2 1 80872 1.23652E-5 40436 0 NA
9-139568308-C-T p.Val213Met missense AGPAT2 1 80792 1.23775E-5 40396 0 6.37674E-5
9-139568308-C-G p.Val213Leu missense AGPAT2 2 80792 2.47549E-5 40396 0 4.23531E-6
9-139568309-G-A p.Leu212Leu synonymous AGPAT2 68 80736 8.42251E-4 40368 0 0.00125
9-139568312-C-T p.Ala211Ala synonymous AGPAT2 12 80642 1.48806E-4 40321 0 1.59479E-4
9-139568312-C-A p.Ala211Ala synonymous AGPAT2 1 80644 1.24002E-5 40322 0 1.28406E-5
9-139568317-G-C p.Pro210Ala missense AGPAT2 2 80642 2.4801E-5 40321 0 6.25E-4
9-139568320-C-G p.Val209Leu missense AGPAT2 2 80426 2.48676E-5 40213 0 6.37918E-5
9-139568320-C-T p.Val209Ile missense AGPAT2 1 80426 1.24338E-5 40213 0 6.55377E-5
9-139568321-G-A p.Asp208Asp synonymous AGPAT2 3 80322 3.73497E-5 40161 0 1.05591E-4
9-139568324-C-T p.Ala207Ala synonymous AGPAT2 4 80354 4.97797E-5 40177 0 2.43861E-4
9-139568325-G-A p.Ala207Val missense AGPAT2 111 80248 0.00138321 40124 0 0.00341177
9-139568327-C-T p.Ala206Ala synonymous AGPAT2 8 80228 9.97158E-5 40114 0 5.14403E-4
9-139568328-G-A p.Ala206Val missense AGPAT2 8 80158 9.98029E-5 40079 0 9.35379E-5
9-139568328-G-C p.Ala206Gly missense AGPAT2 9 80158 1.12278E-4 40079 0 5.34502E-5
9-139568329-CAGTGA-C p.Leu204fs frameshift AGPAT2 1 80164 1.24744E-5 40082 0 NA
9-139568338-C-T p.Gly203Ser missense AGPAT2 5 79882 6.25923E-5 39941 0 8.34655E-5
9-139568339-G-A p.Ser202Ser synonymous AGPAT2 985 79830 0.0123387 39915 3 0.0161837
9-139568343-G-A p.Thr201Ile missense AGPAT2 2 79840 2.50501E-5 39920 0 2.297E-4
9-139568363-C-T p.Gln194Gln synonymous AGPAT2 1 79030 1.26534E-5 39515 0 4.67355E-6
9-139568367-A-G p.Val193Ala missense AGPAT2 1 78866 1.26797E-5 39433 0 3.19203E-5
9-139568374-C-G p.Val191Leu missense AGPAT2 1 78678 1.271E-5 39339 0 3.19183E-5
9-139568378-TC-T p.Gly189fs frameshift AGPAT2 4 78466 5.09775E-5 39233 0 1.96363E-5
9-139568384-G-T c.566-5C>A splice_region AGPAT2 3 78144 3.83907E-5 39072 0 2.17259E-5
9-139568384-G-C c.566-5C>G splice_region AGPAT2 8 78144 1.02375E-4 39072 0 7.82133E-4
9-139568385-G-A c.566-6C>T splice_region AGPAT2 1 78106 1.28031E-5 39053 0 5.52242E-6
9-139569179-G-T c.565+8C>A splice_region AGPAT2 2 80192 2.49401E-5 40096 0 1.827E-5
9-139569179-G-A c.565+8C>T splice_region AGPAT2 1 80192 1.24701E-5 40096 0 2.24145E-5
9-139569180-G-A c.565+7C>T splice_region AGPAT2 2 80236 2.49265E-5 40118 0 NA
9-139569187-CTGAAG-C p.Thr187fs frameshift AGPAT2 1 80416 1.24353E-5 40208 0 NA
9-139569199-ACTT-A p.Lys184del conservative_inframe_deletion AGPAT2 6 80698 7.43513E-5 40349 0 5.05051E-4
9-139569201-TT-AA p.Lys184Leu missense AGPAT2 38 80766 4.70495E-4 40383 0 NA
9-139569202-T-A p.Lys184* stop_gained AGPAT2 1 80764 1.23818E-5 40382 0 0.00101989
9-139569208-T-C p.Lys182Glu missense AGPAT2 46 80890 5.68673E-4 40445 0 7.64916E-4
9-139569210-G-A p.Thr181Ile missense AGPAT2 1 80878 1.23643E-5 40439 0 1.07855E-5
9-139569213-T-G p.Asn180Thr missense AGPAT2 2 80948 2.47072E-5 40474 0 2.05558E-5
9-139569215-G-A p.Tyr179Tyr synonymous AGPAT2 1 80990 1.23472E-5 40495 0 5.27387E-6
9-139569216-T-C p.Tyr179Cys missense AGPAT2 4 80906 4.94401E-5 40453 0 NA
9-139569219-AAGG-A p.Ser177del disruptive_inframe_deletion AGPAT2 1 80996 1.23463E-5 40498 0 1.02415E-4
9-139569219-A-G p.Phe178Ser missense AGPAT2 1 80996 1.23463E-5 40498 0 9.56267E-5
9-139569224-G-A p.Ser176Ser synonymous AGPAT2 4 80944 4.94169E-5 40472 0 NA
9-139569225-G-A p.Ser176Phe missense AGPAT2 1 80974 1.23496E-5 40487 0 5.04541E-4
9-139569230-G-A p.Ser174Ser synonymous AGPAT2 1 80912 1.23591E-5 40456 0 9.15025E-5
9-139569236-G-A p.Tyr172Tyr synonymous AGPAT2 2 80930 2.47127E-5 40465 0 1.02404E-5
9-139569241-C-A p.Val171Leu missense AGPAT2 1 80924 1.23573E-5 40462 0 NA
9-139569250-C-G p.Val168Leu missense AGPAT2 1 80774 1.23802E-5 40387 0 1.0433E-5
9-139569251-G-A p.Ile167Ile synonymous AGPAT2 2 80792 2.47549E-5 40396 0 3.18939E-5
9-139569261-T-C c.493-2A>G splice_acceptor AGPAT2 14 80484 1.73948E-4 40242 0 4.46429E-4
9-139569262-GCAGGCAGGGAGACGCACAGCTGAGGCAGCCCTGGGGACAGGCCAGGCACACC-G c.493-55_493-4delGGTGTGCCTGGCCTGTCCCCAGGGCTGCCTCAGCTGTGCGTCTCCCTGCCTG splice_region AGPAT2 1 80450 1.24301E-5 40225 0 NA
9-139571045-G-A p.Gln194* stop_gained AGPAT2 1 82388 1.21377E-5 41194 0 3.99014E-6
9-139571061-G-A p.Ala188Ala synonymous AGPAT2 2 82662 2.41949E-5 41331 0 8.3091E-6
9-139571079-C-A p.Leu182Leu synonymous AGPAT2 1 82806 1.20764E-5 41403 0 NA
9-139571081-G-A p.Leu182Leu synonymous AGPAT2 12 82798 1.44931E-4 41399 0 4.14462E-4
9-139571084-G-A p.Leu181Leu synonymous AGPAT2 1 82806 1.20764E-5 41403 0 NA
9-139571097-G-T p.Asn176Lys missense AGPAT2 2 82816 2.41499E-5 41408 0 NA
9-139571101-C-T p.Arg175His missense AGPAT2 1 82796 1.20779E-5 41398 0 NA
9-139571102-G-A p.Arg175Cys missense AGPAT2 1 82814 1.20753E-5 41407 0 2.39126E-5
9-139571108-C-T p.Gly173Ser missense AGPAT2 1 82782 1.20799E-5 41391 0 3.18837E-5
9-139571111-C-T p.Glu172Lys missense AGPAT2 1 82788 1.2079E-5 41394 0 8.30441E-6
9-139571133-C-G c.493-1G>C splice_acceptor AGPAT2 2 82560 2.42248E-5 41280 0 3.991E-6
9-139571403-GCA-G c.492+8_492+9delTG splice_region AGPAT2 1 79778 1.25348E-5 39889 0 5.26158E-5
9-139571412-C-T c.492+1G>A splice_donor AGPAT2 1 80106 1.24835E-5 40053 0 1.61501E-5
9-139571420-C-T p.Arg162Lys missense AGPAT2 1 80374 1.24418E-5 40187 0 NA
9-139571422-G-A p.Val161Val synonymous AGPAT2 6 80344 7.46789E-5 40172 0 2.52785E-4
9-139571425-C-T p.Met160Ile missense AGPAT2 1 80410 1.24363E-5 40205 0 1.20861E-5
9-139571426-A-G p.Met160Thr missense AGPAT2 1 80404 1.24372E-5 40202 0 NA
9-139571429-C-A p.Arg159Leu missense AGPAT2 6 80342 7.46807E-5 40171 0 6.25E-4
9-139571430-G-A p.Arg159Cys missense AGPAT2 580 80288 0.00722399 40144 1 0.01375
9-139571431-C-T p.Glu158Glu synonymous AGPAT2 1 80348 1.24459E-5 40174 0 3.20718E-5
9-139571434-G-A p.Gly157Gly synonymous AGPAT2 1 80308 1.24521E-5 40154 0 4.1971E-5
9-139571444-G-T p.Ala154Asp missense AGPAT2 14 80524 1.73861E-4 40262 0 9.61723E-5
9-139571450-A-G p.Val152Ala missense AGPAT2 1 80688 1.23934E-5 40344 0 6.44496E-5
9-139571453-G-C p.Thr151Arg missense AGPAT2 1 80718 1.23888E-5 40359 0 NA
9-139571466-T-C p.Ser147Gly missense AGPAT2 1 80802 1.23759E-5 40401 0 NA
9-139571471-C-T p.Arg145His missense AGPAT2 7 80760 8.66766E-5 40380 0 2.00831E-5
9-139571472-G-T p.Arg145Ser missense AGPAT2 1 80770 1.23808E-5 40385 0 3.19652E-5
9-139571472-G-A p.Arg145Cys missense AGPAT2 1 80770 1.23808E-5 40385 0 3.33979E-5
9-139571473-C-T p.Gln144Gln synonymous AGPAT2 12 80804 1.48508E-4 40402 0 1.9173E-4
9-139571477-C-T p.Arg143Gln missense AGPAT2 1 80800 1.23762E-5 40400 0 2.00787E-5
9-139571480-T-G p.Asn142Thr missense AGPAT2 2 80812 2.47488E-5 40406 0 3.20082E-5
9-139571490-A-C p.Phe139Val missense AGPAT2 13 80914 1.60664E-4 40457 0 1.2839E-4
9-139571491-G-T p.Val138Val synonymous AGPAT2 1 80892 1.23622E-5 40446 0 NA
9-139571493-C-T p.Val138Ile missense AGPAT2 1 80860 1.23671E-5 40430 0 1.66767E-5
9-139571494-G-A p.Gly137Gly synonymous AGPAT2 2 80834 2.47421E-5 40417 0 1.334E-4
9-139571494-GC-G p.Gly137fs frameshift AGPAT2 1 80834 1.2371E-5 40417 0 NA
9-139571497-C-T p.Gly136Gly synonymous AGPAT2 9 80866 1.11295E-4 40433 0 5.03525E-4
9-139571500-G-A p.Leu135Leu synonymous AGPAT2 3 80768 3.71434E-5 40384 0 1.25067E-4
9-139571500-G-T p.Leu135Leu synonymous AGPAT2 2 80768 2.47623E-5 40384 0 8.33778E-6
9-139571508-T-C p.Met133Val missense AGPAT2 1 80736 1.2386E-5 40368 0 8.33834E-6
9-139571511-T-G p.Ile132Leu missense AGPAT2 2 80716 2.47782E-5 40358 0 1.66803E-5
9-139571521-G-A p.Pro128Pro synonymous AGPAT2 6 80548 7.44897E-5 40274 0 3.33717E-5
9-139571526-C-A p.Gly127Trp missense AGPAT2 1 80514 1.24202E-5 40257 0 8.34418E-6
9-139571527-C-CA p.Pro128fs frameshift AGPAT2 1 80516 1.24199E-5 40258 0 9.55962E-5
9-139571532-AGAGC-A p.Leu124fs frameshift AGPAT2 1 80524 1.24187E-5 40262 0 NA
9-139571544-G-A p.Arg121Trp missense AGPAT2 1 80298 1.24536E-5 40149 0 9.56328E-5
9-139571545-C-T p.Lys120Lys synonymous AGPAT2 1 80298 1.24536E-5 40149 0 NA
9-139571546-T-C p.Lys120Arg missense AGPAT2 58 80254 7.22705E-4 40127 0 0.00143513
9-139571550-C-T p.Ala119Thr missense AGPAT2 1 80186 1.2471E-5 40093 0 4.02651E-6
9-139571551-G-A p.Ile118Ile synonymous AGPAT2 1 80178 1.24722E-5 40089 0 2.51096E-5
9-139571560-G-A p.Cys115Cys synonymous AGPAT2 616 80012 0.00769885 40006 12 0.0166163
9-139571564-C-T p.Arg114His missense AGPAT2 2 79878 2.50382E-5 39939 0 6.37511E-5
9-139571564-C-A p.Arg114Leu missense AGPAT2 1 79878 1.25191E-5 39939 0 NA
9-139571565-G-A p.Arg114Cys missense AGPAT2 54 79808 6.76624E-4 39904 2 0.00191229
9-139571573-A-G p.Leu111Pro missense AGPAT2 2 79638 2.51136E-5 39819 0 NA
9-139571582-A-G p.Met108Thr missense AGPAT2 4 79406 5.0374E-5 39703 0 8.0994E-6
9-139571592-G-A c.317-4C>T splice_region AGPAT2 1 79060 1.26486E-5 39530 0 NA
9-139571595-G-A c.317-7C>T splice_region AGPAT2 587 78922 0.00743772 39461 15 0.0152934
9-139571867-C-T c.316+8G>A splice_region AGPAT2 2 81256 2.46136E-5 40628 0 5.05655E-5
9-139571876-C-A p.Met105Ile missense+splice_region AGPAT2 1 81632 1.22501E-5 40816 0 6.25E-4
9-139571881-T-C p.Met104Val missense AGPAT2 2 81750 2.44648E-5 40875 0 2.00125E-5
9-139571891-G-A p.Ser100Ser synonymous AGPAT2 4 82018 4.87698E-5 41009 0 9.55779E-5
9-139571892-C-T p.Ser100Asn missense AGPAT2 2 82064 2.43712E-5 41032 0 8.39151E-6
9-139571909-G-A p.Ile94Ile synonymous AGPAT2 3 82158 3.6515E-5 41079 0 3.60006E-5
9-139571918-G-C p.Pro91Pro synonymous AGPAT2 7 82186 8.51727E-5 41093 0 4.16226E-4
9-139571921-A-G p.Arg90Arg synonymous AGPAT2 1 82080 1.21832E-5 41040 0 NA
9-139571922-C-T p.Arg90His missense AGPAT2 18 82054 2.19368E-4 41027 0 6.05211E-4
9-139571922-C-G p.Arg90Pro missense AGPAT2 5 82054 6.09355E-5 41027 0 4.20203E-5
9-139571936-C-A p.Arg85Ser missense AGPAT2 1 82168 1.21702E-5 41084 0 NA
9-139571940-C-T p.Arg84His missense AGPAT2 2 82092 2.43629E-5 41046 0 2.00252E-5
9-139571941-G-A p.Arg84Cys missense AGPAT2 2 82090 2.43635E-5 41045 0 2.80312E-5
9-139571943-G-A p.Pro83Leu missense AGPAT2 1 82102 1.218E-5 41051 0 5.03525E-4
9-139571950-G-A p.Arg81Trp missense AGPAT2 4 81990 4.87864E-5 40995 0 0.00151057
9-139571956-C-T p.Glu79Lys missense AGPAT2 2 81934 2.44099E-5 40967 0 6.36983E-5
9-139571957-G-T p.Phe78Leu missense AGPAT2 3 81928 3.66175E-5 40964 0 6.36902E-5
9-139571957-G-A p.Phe78Phe synonymous AGPAT2 5 81928 6.10292E-5 40964 0 6.73923E-5
9-139571961-C-T p.Arg77His missense AGPAT2 10 81878 1.22133E-4 40939 0 2.23015E-4
9-139571962-G-A p.Arg77Cys missense AGPAT2 25 81938 3.05109E-4 40969 0 2.22916E-4
9-139571968-C-T p.Gly75Arg missense AGPAT2 1 81804 1.22243E-5 40902 0 5.21724E-5
9-139571969-G-A p.Tyr74Tyr synonymous AGPAT2 1 81788 1.22267E-5 40894 0 1.60532E-5
9-139571972-A-G p.Phe73Phe synonymous AGPAT2 2 81828 2.44415E-5 40914 0 NA
9-139571983-A-C p.Phe70Val missense AGPAT2 5 81546 6.13151E-5 40773 0 2.22958E-4
9-139571989-G-C p.Arg68Gly missense AGPAT2 1 80896 1.23616E-5 40448 0 NA
9-139571989-G-A p.Arg68* stop_gained AGPAT2 1 80896 1.23616E-5 40448 0 3.18634E-5
9-139571992-C-T p.Val67Met missense AGPAT2 36 80792 4.45589E-4 40396 1 0.00177002
9-139571993-G-A p.Phe66Phe synonymous AGPAT2 2 80806 2.47506E-5 40403 0 4.06253E-6
9-139571995-A-C p.Phe66Val missense AGPAT2 1 80582 1.24097E-5 40291 0 0.0272727
9-139572001-C-T p.Gly64Ser missense AGPAT2 2 81154 2.46445E-5 40577 0 3.18492E-5
9-139572002-G-A p.Ile63Ile synonymous AGPAT2 61 81098 7.52176E-4 40549 1 0.00526218
9-139572003-A-G p.Ile63Thr missense AGPAT2 2 81054 2.46749E-5 40527 0 2.54259E-5
9-139572005-G-A p.Ile62Ile synonymous AGPAT2 1 81040 1.23396E-5 40520 0 NA
9-139572006-A-C p.Ile62Ser missense+splice_region AGPAT2 2 81004 2.46901E-5 40502 0 3.18552E-5
9-139581620-G-A c.182+8C>T splice_region AGPAT2 79 44380 0.00178008 22190 1 0.0024726
9-139581622-C-T c.182+6G>A splice_region AGPAT2 129 44692 0.00288642 22346 0 0.00261546
9-139581631-A-C p.Met60Arg missense AGPAT2 1 45322 2.20643E-5 22661 0 1.10084E-5
9-139581631-A-T p.Met60Lys missense AGPAT2 2 45322 4.41287E-5 22661 0 2.20167E-5
9-139581632-T-C p.Met60Val missense AGPAT2 1 45422 2.20158E-5 22711 0 1.09397E-5
9-139581642-C-T p.Thr56Thr synonymous AGPAT2 1 45818 2.18255E-5 22909 0 3.19346E-5
9-139581646-CGGCCGCCGTGGCGCAGCA-C p.Leu49_Gly54del disruptive_inframe_deletion AGPAT2 1 45804 2.18322E-5 22902 0 NA
9-139581647-G-C p.Arg55Gly missense AGPAT2 2 45564 4.38943E-5 22782 0 NA
9-139581659-G-A p.Arg51Cys missense AGPAT2 3 45786 6.55222E-5 22893 0 0.00156904
9-139581660-C-G p.Leu50Leu synonymous AGPAT2 1 45866 2.18026E-5 22933 0 NA
9-139581666-G-A p.Cys48Cys synonymous AGPAT2 1 46210 2.16403E-5 23105 0 4.72237E-6
9-139581672-G-C p.Leu46Leu synonymous AGPAT2 1 46160 2.16638E-5 23080 0 4.69048E-6
9-139581678-G-A p.Ala44Ala synonymous AGPAT2 1 46350 2.1575E-5 23175 0 NA
9-139581690-C-T p.Val40Val synonymous AGPAT2 1 46256 2.16188E-5 23128 0 NA
9-139581693-C-T p.Thr39Thr synonymous AGPAT2 1 46206 2.16422E-5 23103 0 NA
9-139581707-C-T p.Ala35Thr missense AGPAT2 11 45886 2.39725E-4 22943 0 7.43218E-5
9-139581715-A-G p.Leu32Pro missense AGPAT2 1 45702 2.18809E-5 22851 0 NA
9-139581720-G-A p.Val30Val synonymous AGPAT2 1 45354 2.20488E-5 22677 0 NA
9-139581729-G-A p.Tyr27Tyr synonymous AGPAT2 5 44930 1.11284E-4 22465 0 7.77665E-5
9-139581756-C-T p.Val18Val synonymous AGPAT2 2 43074 4.64317E-5 21537 0 5.2356E-4
9-139581757-A-G p.Val18Ala missense AGPAT2 2 42998 4.65138E-5 21499 0 NA
9-139581758-C-CCAG p.Leu17dup conservative_inframe_insertion AGPAT2 3727 42974 0.0867269 21487 155 0.0807774
9-139581758-CCAG-C p.Leu17del conservative_inframe_deletion AGPAT2 3 43048 6.96896E-5 21524 0 3.1973E-4
9-139581767-G-GCAGCAA p.Leu13_Leu14dup conservative_inframe_insertion AGPAT2 1 42736 2.33995E-5 21368 0 NA
9-139581769-A-C p.Leu14Arg missense AGPAT2 1 42602 2.34731E-5 21301 0 NA
9-139581770-G-GCAA p.Leu13dup conservative_inframe_insertion AGPAT2 2 42568 4.69836E-5 21284 0 NA
9-139581773-A-G p.Leu13Leu synonymous AGPAT2 1 42252 2.36675E-5 21126 0 3.29131E-5
9-139581776-G-A p.Leu12Leu synonymous AGPAT2 1 42038 2.3788E-5 21019 0 1.35292E-5
9-139581778-AGCGCC-A p.Leu11fs frameshift AGPAT2 1 41930 2.38493E-5 20965 0 NA
9-139581781-G-C p.Ala10Gly missense AGPAT2 1 41670 2.39981E-5 20835 0 3.20246E-5
9-139581783-C-A p.Ala9Ala synonymous AGPAT2 1 41562 2.40604E-5 20781 0 NA
9-139581784-G-A p.Ala9Val missense AGPAT2 1 41516 2.40871E-5 20758 0 NA
9-139581786-G-C p.Ala8Ala synonymous AGPAT2 1 41468 2.4115E-5 20734 0 6.41733E-6
9-139581827-G-A c.-18C>T 5_prime_UTR_premature_start_codon_gain AGPAT2 3 39348 7.62428E-5 19674 0 3.88923E-4
9-139581861-C-A c.-52G>T 5_prime_UTR_premature_start_codon_gain AGPAT2 1 37788 2.64634E-5 18894 0 NA