Variant

Variant ID Consequence Effect Gene AC AN AF NS NHOM maxEAF
6-32135988-ATCTC-A c.*1061_*1064delGAGA splice_region AGPAT1 2 58194 3.43678E-5 29097 0 4.78225E-4
6-32135988-A-ATC c.*1063_*1064dupGA splice_region AGPAT1 1 58186 1.71863E-5 29093 0 NA
6-32135990-C-T c.*1063G>A splice_region AGPAT1 2 58024 3.44685E-5 29012 0 NA
6-32137061-C-T p.Gly282Ser missense AGPAT1 4 79092 5.0574E-5 39546 0 9.58589E-5
6-32137070-G-T p.Pro279Thr missense AGPAT1 2 79098 2.52851E-5 39549 0 4.32593E-5
6-32137096-C-G p.Arg270Pro missense AGPAT1 2 77324 2.58652E-5 38662 0 1.74541E-4
6-32137097-G-A p.Arg270Trp missense AGPAT1 1 77184 1.29561E-5 38592 0 4.06012E-6
6-32137104-A-G p.Thr267Thr synonymous AGPAT1 1 76262 1.31127E-5 38131 0 NA
6-32137112-T-C p.Ile265Val missense AGPAT1 1 74754 1.33772E-5 37377 0 NA
6-32137117-C-T p.Arg263Gln missense AGPAT1 1 73474 1.36103E-5 36737 0 4.06557E-6
6-32137118-G-A p.Arg263Trp missense AGPAT1 32 73212 4.37087E-4 36606 0 3.46789E-5
6-32137161-T-C p.Pro248Pro synonymous AGPAT1 1 59124 1.69136E-5 29562 0 NA
6-32137166-C-T p.Val247Ile missense AGPAT1 1 57116 1.75082E-5 28558 0 NA
6-32137171-T-A p.Asp245Val missense AGPAT1 1 55562 1.79979E-5 27781 0 NA
6-32137210-C-T p.Arg232Gln missense AGPAT1 1 46886 2.13283E-5 23443 0 4.15289E-6
6-32137211-G-A p.Arg232Trp missense AGPAT1 1 46520 2.14961E-5 23260 0 8.30868E-6
6-32137736-C-T c.679+7G>A splice_region AGPAT1 3 80788 3.71342E-5 40394 0 8.71338E-6
6-32137757-C-T p.Arg222His missense AGPAT1 2 80958 2.47042E-5 40479 0 3.18593E-5
6-32137758-G-A p.Arg222Cys missense AGPAT1 2 80976 2.46987E-5 40488 0 NA
6-32137763-T-C p.Lys220Arg missense AGPAT1 1 81070 1.2335E-5 40535 0 1.71553E-5
6-32137792-C-T p.Met210Ile missense AGPAT1 1 81192 1.23165E-5 40596 0 8.52428E-6
6-32137801-G-A p.Pro207Pro synonymous AGPAT1 98 81252 0.00120612 40626 0 0.00257962
6-32137807-A-G p.Ile205Ile synonymous AGPAT1 15 81282 1.84543E-4 40641 0 0.00375
6-32137813-AACCTGGGGAAGGGTTAAAGCAGGTCAGTCCACAGCTCTCTTCAGAGACTCCTACAATAAGCCCCTGCCCAGAGATGAGGGAATGGTGGGGGTTGGCAGCTGAGTAGCAGAACGAAGAGCAGTAGTC-A p.Val203fs frameshift AGPAT1 9 81348 1.10636E-4 40674 4 NA
6-32137818-G-A c.607-3C>T splice_region AGPAT1 1 81394 1.22859E-5 40697 0 3.99731E-6
6-32137950-G-T p.Gln200Lys missense AGPAT1 2 82992 2.40987E-5 41496 0 3.98124E-6
6-32137969-G-A p.Gly193Gly synonymous AGPAT1 1 82934 1.20578E-5 41467 0 3.3365E-5
6-32137997-T-C p.Asn184Ser missense AGPAT1 1 82928 1.20587E-5 41464 0 7.97321E-6
6-32138008-C-T p.Thr180Thr synonymous AGPAT1 2 82840 2.41429E-5 41420 0 3.44056E-5
6-32138025-C-A p.Val175Leu missense AGPAT1 1 82812 1.20755E-5 41406 0 NA
6-32138034-T-G p.Arg172Arg synonymous AGPAT1 1 82776 1.20808E-5 41388 0 4.02894E-6
6-32138037-C-A p.Val171Leu missense+splice_region AGPAT1 1 82810 1.20758E-5 41405 0 1.21211E-5
6-32138195-G-A c.510+7C>T splice_region AGPAT1 1 81338 1.22944E-5 40669 0 4.04416E-6
6-32138211-G-A p.Leu167Leu synonymous AGPAT1 2 81348 2.45857E-5 40674 0 1.61876E-5
6-32138233-G-T p.Ser160Tyr missense AGPAT1 1 81342 1.22938E-5 40671 0 NA
6-32138256-C-T p.Thr152Thr synonymous AGPAT1 1 81254 1.23071E-5 40627 0 3.18532E-5
6-32138257-G-A p.Thr152Met missense AGPAT1 2 81228 2.46221E-5 40614 0 8.60793E-6
6-32138270-C-T p.Asp148Asn missense AGPAT1 1 81114 1.23283E-5 40557 0 NA
6-32138271-G-A p.Ile147Ile synonymous AGPAT1 1 81108 1.23292E-5 40554 0 8.6143E-6
6-32138307-G-A p.Ala135Ala synonymous AGPAT1 1 80792 1.23775E-5 40396 0 1.72616E-5
6-32138331-G-A p.Arg127Arg synonymous AGPAT1 20 80072 2.49775E-4 40036 0 3.25709E-5
6-32138332-C-T p.Arg127His missense AGPAT1 1 80042 1.24934E-5 40021 0 NA
6-32138343-G-A p.Pro123Pro synonymous AGPAT1 1 79624 1.2559E-5 39812 0 NA
6-32138356-C-T p.Gly119Asp missense AGPAT1 1 78100 1.28041E-5 39050 0 NA
6-32138361-C-A p.Leu117Leu synonymous AGPAT1 2 77542 2.57925E-5 38771 0 3.18552E-5
6-32138367-C-T p.Glu115Glu synonymous AGPAT1 19 76796 2.47409E-4 38398 0 1.48295E-4
6-32138385-A-T c.335-8T>A splice_region AGPAT1 1 73762 1.35571E-5 36881 0 NA
6-32138706-G-A c.334+8C>T splice_region AGPAT1 1 79056 1.26493E-5 39528 0 NA
6-32138724-G-A p.Leu108Leu synonymous AGPAT1 1 80230 1.24642E-5 40115 0 4.06732E-5
6-32138736-G-A p.His104His synonymous AGPAT1 14 80730 1.73418E-4 40365 0 2.2477E-4
6-32138744-A-C p.Ser102Ala missense AGPAT1 1 80904 1.23603E-5 40452 0 NA
6-32138763-C-A p.Ser95Ser synonymous AGPAT1 7 81178 8.62303E-5 40589 0 6.49488E-5
6-32138766-G-A p.Pro94Pro synonymous AGPAT1 1 81274 1.23041E-5 40637 0 NA
6-32138800-C-T p.Arg83Gln missense AGPAT1 2 81428 2.45616E-5 40714 0 3.19591E-5
6-32138822-T-C p.Ile76Val missense AGPAT1 1 81472 1.22742E-5 40736 0 3.19346E-5
6-32138827-A-C p.Leu74Arg missense AGPAT1 1 81468 1.22748E-5 40734 0 NA
6-32138837-G-C p.Leu71Val missense AGPAT1 1 81466 1.22751E-5 40733 0 4.06045E-6
6-32138844-G-A p.Ile68Ile synonymous AGPAT1 1 81468 1.22748E-5 40734 0 NA
6-32139022-C-G n.340+5G>C splice_region AGPAT1 1 81462 1.22757E-5 40731 0 NA
6-32139026-C-T n.340+1G>A splice_donor AGPAT1 1 81478 1.22733E-5 40739 0 NA
6-32139066-C-T c.200+8G>A splice_region AGPAT1 1 81484 1.22723E-5 40742 0 4.0539E-6
6-32139068-C-A c.200+6G>T splice_region AGPAT1 2 81484 2.45447E-5 40742 0 NA
6-32139082-C-T p.Glu64Glu synonymous AGPAT1 1 81490 1.22714E-5 40745 0 4.05229E-6
6-32139087-C-T p.Val63Ile missense AGPAT1 11 81490 1.34986E-4 40745 0 6.36983E-4
6-32139102-C-T p.Val58Met missense AGPAT1 3 81482 3.68179E-5 40741 0 3.18451E-5
6-32139121-G-A c.-50C>T 5_prime_UTR_premature_start_codon_gain AGPAT1 3 81474 3.68216E-5 40737 0 8.09999E-6
6-32139135-A-G p.Phe47Leu missense AGPAT1 1 81472 1.22742E-5 40736 0 2.57936E-5
6-32139158-G-C p.Ala39Gly missense AGPAT1 1 81472 1.22742E-5 40736 0 3.18532E-5
6-32139186-G-A p.Pro30Ser missense AGPAT1 78 81410 9.58113E-4 40705 0 0.00544662
6-32139204-T-C p.Thr24Ala missense AGPAT1 4 81294 4.92041E-5 40647 0 NA
6-32139206-GGCAGCAGGAAGAGCA-G p.Leu18_Leu22del disruptive_inframe_deletion AGPAT1 5 81298 6.15021E-5 40649 0 9.55536E-5
6-32139211-C-G p.Leu21Leu synonymous AGPAT1 4 81262 4.92235E-5 40631 0 4.06977E-5
6-32139232-GAGC-G p.Leu14del disruptive_inframe_deletion AGPAT1 1 80936 1.23554E-5 40468 0 2.26562E-5
6-32139232-G-GAGC p.Leu14dup disruptive_inframe_insertion AGPAT1 3 80978 3.70471E-5 40489 0 2.26562E-5
6-32139232-G-A p.Leu14Leu synonymous AGPAT1 1 80978 1.2349E-5 40489 0 NA
6-32139233-A-G p.Leu14Pro missense AGPAT1 5 80944 6.17711E-5 40472 0 6.37349E-5
6-32139254-G-A p.Ala7Val missense AGPAT1 1 80036 1.24944E-5 40018 0 9.10258E-6
6-32139255-C-T p.Ala7Thr missense AGPAT1 1 80008 1.24988E-5 40004 0 NA
6-32139285-G-GC c.-9-4dupG splice_region AGPAT1 2 77234 2.58953E-5 38617 0 1.22272E-4
6-32143774-G-A c.-193C>T 5_prime_UTR_premature_start_codon_gain AGPAT1 1 26802 3.73106E-5 13401 0 NA
6-32144428-C-T c.-151G>A 5_prime_UTR_premature_start_codon_gain AGPAT1 1 21162 4.72545E-5 10581 0 NA
6-32145778-C-G c.-10G>C splice_region AGPAT1 1 2960 3.37838E-4 1480 0 5.41884E-4