Variant

Variant ID Consequence Effect Gene AC AN AF NS NHOM maxEAF
1-36273948-G-T c.-70G>T 5_prime_UTR_premature_start_codon_gain AGO4 18 17508 0.0010281 8754 0 0.0021518
1-36274019-T-C p.Met1? start_lost AGO4 1 27558 3.62871E-5 13779 0 NA
1-36274027-C-T p.Leu4Leu synonymous AGO4 400 27982 0.0142949 13991 2 0.015305
1-36274035-C-T p.Pro6Pro splice_region+synonymous AGO4 1 28068 3.56278E-5 14034 0 NA
1-36274037-G-GACCTCCGGCTAGCCTGTTTCAGCCACCTCGTCGTCCTGGCCT c.19+1_19+2insACCTCCGGCTAGCCTGTTTCAGCCACCTCGTCGTCCTGGCCT splice_donor AGO4 6 28080 2.13675E-4 14040 3 NA
1-36274037-G-GACCTCCGGCTAGCCTGTTTCAGCCACCTCGTCGTCC c.19+1_19+2insACCTCCGGCTAGCCTGTTTCAGCCACCTCGTCGTCC splice_donor AGO4 4 28080 1.4245E-4 14040 2 NA
1-36282490-G-A p.Pro9Pro synonymous AGO4 1 83212 1.20175E-5 41606 0 NA
1-36282495-G-A p.Ser11Asn missense AGO4 5 83310 6.00168E-5 41655 1 8.24661E-6
1-36282509-C-T p.Pro16Ser missense AGO4 1 83328 1.20008E-5 41664 0 9.59447E-5
1-36282509-C-G p.Pro16Ala missense AGO4 1 83328 1.20008E-5 41664 0 NA
1-36282512-C-T p.Arg17Cys missense AGO4 1 83338 1.19993E-5 41669 0 5.18003E-5
1-36282513-G-A p.Arg17His missense AGO4 1 83332 1.20002E-5 41666 0 3.98457E-6
1-36282515-C-T p.Arg18Cys missense AGO4 1 83348 1.19979E-5 41674 0 6.3861E-5
1-36282544-A-G p.Pro27Pro synonymous AGO4 7 83350 8.39832E-5 41675 0 6.37227E-5
1-36282551-C-T p.Leu30Leu synonymous AGO4 1 83342 1.19988E-5 41671 0 8.23696E-6
1-36282561-AT-A p.His34fs frameshift AGO4 1 83334 1.19999E-5 41667 0 NA
1-36282588-T-C p.Ile42Thr missense AGO4 2 83272 2.40177E-5 41636 0 7.95501E-6
1-36282626-A-C p.Lys55Gln missense AGO4 1 83084 1.2036E-5 41542 0 3.18654E-5
1-36282629-C-T p.Arg56Trp missense AGO4 1 82942 1.20566E-5 41471 0 NA
1-36282630-G-A p.Arg56Gln missense AGO4 5 82920 6.02991E-5 41460 0 8.25614E-6
1-36288470-G-T p.Val65Leu missense AGO4 1 83318 1.20022E-5 41659 0 3.1835E-5
1-36288474-A-G p.Asp66Gly missense AGO4 2 83330 2.4001E-5 41665 0 3.97766E-6
1-36288482-G-A p.Val69Met missense AGO4 1 83316 1.20025E-5 41658 0 3.97779E-6
1-36288486-G-A p.Arg70Gln missense AGO4 2 83318 2.40044E-5 41659 0 1.19337E-5
1-36288489-A-G p.His71Arg missense AGO4 1 83332 1.20002E-5 41666 0 NA
1-36288493-C-T p.Phe72Phe synonymous AGO4 3 83348 3.59937E-5 41674 0 8.23764E-6
1-36288547-G-T p.Met90Ile missense AGO4 1 83384 1.19927E-5 41692 0 NA
1-36288553-A-G p.Thr92Thr synonymous AGO4 1 83368 1.1995E-5 41684 0 9.55049E-5
1-36288575-C-T p.Arg100Trp missense AGO4 2 83334 2.39998E-5 41667 0 NA
1-36288575-C-G p.Arg100Gly missense AGO4 1 83334 1.19999E-5 41667 0 2.47313E-5
1-36290921-T-C p.Met105Thr missense AGO4 5 83306 6.00197E-5 41653 0 3.18492E-5
1-36290940-C-A p.Gly111Gly synonymous AGO4 1 83354 1.1997E-5 41677 0 3.98064E-6
1-36290940-C-T p.Gly111Gly synonymous AGO4 3 83354 3.59911E-5 41677 0 3.18593E-5
1-36290943-G-A p.Glu112Glu synonymous AGO4 2 83372 2.39889E-5 41686 0 3.97845E-6
1-36290952-C-T p.Asp115Asp synonymous AGO4 1 83392 1.19916E-5 41696 0 NA
1-36290968-T-G p.Ser121Ala missense AGO4 1 83402 1.19901E-5 41701 0 NA
1-36291009-A-T p.Leu134Phe missense AGO4 2 83398 2.39814E-5 41699 0 NA
1-36291010-G-A p.Glu135Lys missense AGO4 2 83400 2.39808E-5 41700 0 8.23723E-6
1-36291027-C-A p.His140Gln missense AGO4 5 83390 5.99592E-5 41695 0 6.36943E-5
1-36291031-A-T p.Asn142Tyr missense AGO4 3 83404 3.59695E-5 41702 0 NA
1-36291043-G-A p.Asp146Asn missense AGO4 1 83394 1.19913E-5 41697 0 1.19302E-5
1-36291100-G-C c.488+5G>C splice_region AGO4 1 83334 1.19999E-5 41667 0 3.1841E-5
1-36291102-A-G c.488+7A>G splice_region AGO4 1 83322 1.20016E-5 41661 0 1.65486E-5
1-36291263-AACTCTTATTT-A c.489-16_489-7delACTCTTATTT splice_region AGO4 1 82954 1.20549E-5 41477 0 NA
1-36291274-C-CA c.489-6_489-5insA splice_region AGO4 1 83074 1.20375E-5 41537 0 NA
1-36291286-C-A p.Thr165Thr synonymous AGO4 3 83184 3.60646E-5 41592 0 1.5342E-5
1-36291289-A-G p.Pro166Pro synonymous AGO4 1 83198 1.20195E-5 41599 0 3.1841E-5
1-36291292-G-A p.Val167Val synonymous AGO4 3 83204 3.6056E-5 41602 0 3.58044E-5
1-36291297-GT-G p.Ser170fs frameshift AGO4 1 83244 1.20129E-5 41622 0 NA
1-36291310-A-G p.Ser173Ser synonymous AGO4 1 83270 1.20091E-5 41635 0 2.87109E-5
1-36291313-C-A p.Pro174Pro synonymous AGO4 2 83300 2.40096E-5 41650 0 1.83675E-5
1-36291316-G-A p.Pro175Pro synonymous AGO4 8 83306 9.60315E-5 41653 0 1.5949E-4
1-36291317-G-C p.Glu176Gln missense AGO4 3 83310 3.60101E-5 41655 0 9.55718E-5
1-36291352-G-A p.Glu187Glu synonymous AGO4 1 83374 1.19941E-5 41687 0 NA
1-36291389-A-C p.Met200Leu missense AGO4 1 83402 1.19901E-5 41701 0 1.7557E-5
1-36291410-A-C p.Ile207Leu missense AGO4 1 83406 1.19895E-5 41703 0 NA
1-36291420-G-C c.625+4G>C splice_region AGO4 1 83398 1.19907E-5 41699 0 NA
1-36291535-A-G p.Thr212Ala missense AGO4 1 83350 1.19976E-5 41675 0 NA
1-36291548-G-A p.Arg216Gln missense AGO4 1 83340 1.1999E-5 41670 0 NA
1-36291558-T-C p.Pro219Pro synonymous AGO4 1 83336 1.19996E-5 41668 0 3.97871E-6
1-36291566-A-C p.Glu222Ala missense AGO4 1 83328 1.20008E-5 41664 0 NA
1-36291579-G-A p.Glu226Glu synonymous AGO4 1 83290 1.20062E-5 41645 0 8.23818E-6
1-36291597-C-T p.Asn232Asn synonymous AGO4 32 83250 3.84384E-4 41625 0 2.70576E-4
1-36291658-A-G p.Arg253Gly missense AGO4 1 82998 1.20485E-5 41499 0 NA
1-36291661-G-A p.Gly254Ser missense+splice_region AGO4 1 82968 1.20528E-5 41484 0 NA
1-36292342-A-AT c.761-7_761-6insT splice_region AGO4 1 83136 1.20285E-5 41568 0 1.07678E-4
1-36292349-G-T p.Gly254Val missense+splice_region AGO4 1 83178 1.20224E-5 41589 0 NA
1-36292351-C-A p.Leu255Ile missense+splice_region AGO4 1 83204 1.20187E-5 41602 0 NA
1-36292379-A-G p.Gln264Arg missense AGO4 1 83296 1.20054E-5 41648 0 NA
1-36292386-A-G p.Lys266Lys synonymous AGO4 1 83294 1.20057E-5 41647 0 NA
1-36292415-G-A p.Arg276Lys missense AGO4 1 83294 1.20057E-5 41647 0 NA
1-36292419-G-A p.Arg277Arg synonymous AGO4 1 83284 1.20071E-5 41642 0 NA
1-36292427-G-A p.Ser280Asn missense AGO4 1 83282 1.20074E-5 41641 0 NA
1-36292439-A-G c.848+3A>G splice_region AGO4 1 83248 1.20123E-5 41624 0 NA
1-36297024-A-G c.849-4A>G splice_region AGO4 1 82916 1.20604E-5 41458 0 9.55779E-5
1-36297041-C-T p.Leu288Leu synonymous AGO4 1 83090 1.20351E-5 41545 0 8.25723E-6
1-36297045-A-G p.Glu289Gly missense AGO4 1 83122 1.20305E-5 41561 0 NA
1-36297049-C-T p.Asn290Asn synonymous AGO4 14 83116 1.68439E-4 41558 0 0.00201613
1-36297059-A-G p.Met294Val missense AGO4 1 83188 1.2021E-5 41594 0 8.24729E-6
1-36297067-T-C p.Cys296Cys synonymous AGO4 1 83224 1.20158E-5 41612 0 1.64878E-5
1-36297087-A-G p.Lys303Arg missense AGO4 2 83268 2.40188E-5 41634 0 3.9788E-6
1-36297090-A-T p.Gln304Leu missense AGO4 1 83274 1.20085E-5 41637 0 2.38719E-4
1-36297106-A-G p.Gln309Gln synonymous AGO4 1 83270 1.20091E-5 41635 0 5.03525E-4
1-36297109-G-A p.Leu310Leu synonymous AGO4 1 83276 1.20083E-5 41638 0 3.97864E-6
1-36297114-A-AG p.Tyr312fs frameshift AGO4 1 83268 1.20094E-5 41634 0 NA
1-36297119-C-A p.His314Asn missense AGO4 4 83278 4.80319E-5 41639 0 3.29582E-5
1-36297125-C-T p.Pro316Ser missense AGO4 2 83282 2.40148E-5 41641 0 NA
1-36297154-G-A p.Lys325Lys synonymous AGO4 1 83246 1.20126E-5 41623 0 4.00946E-6
1-36297172-C-T p.Leu331Leu synonymous AGO4 4 83182 4.80873E-5 41591 0 3.18573E-5
1-36297178-A-C c.996+3A>C splice_region AGO4 1 83180 1.20221E-5 41590 0 NA
1-36297179-A-T c.996+4A>T splice_region AGO4 1 83180 1.20221E-5 41590 0 NA
1-36297181-TTA-T c.996+7_996+8delTA splice_region AGO4 1 83164 1.20244E-5 41582 0 NA
1-36297409-G-T c.997-4G>T splice_region AGO4 1 82966 1.20531E-5 41483 0 NA
1-36297434-C-T p.Gln340* stop_gained AGO4 1 82688 1.20937E-5 41344 0 NA
1-36297436-G-A p.Gln340Gln synonymous AGO4 2 82690 2.41867E-5 41345 0 0.00151668
1-36297478-G-T p.Met354Ile missense AGO4 1 82788 1.2079E-5 41394 0 NA
1-36297490-A-G p.Thr358Thr synonymous AGO4 5 82800 6.03865E-5 41400 0 1.47332E-4
1-36297490-A-T p.Thr358Thr synonymous AGO4 2 82800 2.41546E-5 41400 0 NA
1-36297501-C-T p.Ala362Val missense AGO4 1 82790 1.20788E-5 41395 0 NA
1-36297527-A-G p.Arg371Gly missense AGO4 3 82896 3.61899E-5 41448 0 3.58506E-5
1-36297652-C-T c.1117-6C>T splice_region AGO4 1 83128 1.20296E-5 41564 0 1.65777E-5
1-36297668-A-G p.Asn376Ser missense AGO4 1 83054 1.20404E-5 41527 0 NA
1-36297673-A-G p.Met378Val missense AGO4 10 83004 1.20476E-4 41502 0 8.39255E-5
1-36297678-G-A p.Val379Val synonymous AGO4 1 82956 1.20546E-5 41478 0 1.99413E-5
1-36297681-T-C p.Gly380Gly synonymous AGO4 1 82950 1.20555E-5 41475 0 1.99413E-5
1-36297690-T-A p.Asp383Glu missense AGO4 1 82880 1.20656E-5 41440 0 NA
1-36297709-G-T p.Gly390Cys missense AGO4 5 82638 6.05049E-5 41319 0 9.55292E-5
1-36297722-A-G p.His394Arg missense AGO4 2 82442 2.42595E-5 41221 0 NA
1-36297725-A-G p.Asn395Ser missense AGO4 2 82370 2.42807E-5 41185 0 3.98692E-5
1-36297758-C-T p.Pro406Leu missense AGO4 2 80750 2.47678E-5 40375 0 NA
1-36297766-A-G p.Met409Val missense AGO4 1 80240 1.24626E-5 40120 0 8.26023E-6
1-36297774-A-G p.Gln411Gln synonymous AGO4 1 79614 1.25606E-5 39807 0 1.65308E-5
1-36297777-T-A p.Tyr412* stop_gained AGO4 1 79332 1.26053E-5 39666 0 NA
1-36297784-C-T p.Arg415Trp missense+splice_region AGO4 1 78160 1.27943E-5 39080 0 NA
1-36298033-C-T c.1246-5C>T splice_region AGO4 1 81406 1.22841E-5 40703 0 0.00117679
1-36298034-A-T c.1246-4A>T splice_region AGO4 1 81818 1.22222E-5 40909 0 NA
1-36298046-A-T p.Thr418Thr synonymous AGO4 2 82482 2.42477E-5 41241 0 3.30885E-5
1-36298060-A-G p.Asn423Ser missense AGO4 3 82776 3.62424E-5 41388 0 6.75995E-5
1-36298080-C-A p.Arg430Arg synonymous AGO4 1 82926 1.20589E-5 41463 0 NA
1-36298123-C-A p.Ala444Glu missense AGO4 1 83166 1.20241E-5 41583 0 NA
1-36298136-T-C p.Phe448Phe synonymous AGO4 2 83104 2.40662E-5 41552 0 NA
1-36298152-T-C p.Cys454Arg missense AGO4 1 82982 1.20508E-5 41491 0 NA
1-36299583-T-C c.1380-8T>C splice_region AGO4 5 79648 6.27762E-5 39824 0 8.74554E-6
1-36299585-T-C c.1380-6T>C splice_region AGO4 2 79842 2.50495E-5 39921 0 3.18451E-5
1-36299610-C-T p.Arg467Cys missense AGO4 1 81940 1.22041E-5 40970 0 1.68285E-5
1-36299611-G-A p.Arg467His missense AGO4 3 81934 3.66148E-5 40967 0 3.35762E-5
1-36299613-A-G p.Lys468Glu missense AGO4 2 82032 2.43807E-5 41016 0 NA
1-36299620-C-T p.Ser470Phe missense AGO4 1 82212 1.21637E-5 41106 0 NA
1-36299644-A-G p.Gln478Arg missense AGO4 1 82996 1.20488E-5 41498 0 NA
1-36299653-C-T p.Pro481Leu missense AGO4 1 83056 1.20401E-5 41528 0 NA
1-36299675-A-T p.Gln488His missense AGO4 1 83032 1.20435E-5 41516 0 8.02394E-6
1-36299706-C-T p.His499Tyr missense AGO4 1 83056 1.20401E-5 41528 0 NA
1-36299723-T-C p.Tyr504Tyr synonymous AGO4 1 83042 1.20421E-5 41521 0 9.5511E-5
1-36299750-C-T p.Ile513Ile synonymous AGO4 2 82938 2.41144E-5 41469 0 NA
1-36299761-A-G p.Lys517Arg missense AGO4 2 82786 2.41587E-5 41393 0 1.67123E-5
1-36299762-G-A p.Lys517Lys synonymous AGO4 1 82782 1.20799E-5 41391 0 NA
1-36299778-A-C c.1564+3A>C splice_region AGO4 1 82324 1.21471E-5 41162 0 NA
1-36301436-G-A p.Ala522Ala splice_region+synonymous AGO4 1 83156 1.20256E-5 41578 0 6.37186E-5
1-36301448-T-C p.Arg526Arg synonymous AGO4 1 83234 1.20143E-5 41617 0 NA
1-36301473-G-A p.Ala535Thr missense AGO4 1 83274 1.20085E-5 41637 0 1.65445E-5
1-36301474-C-G p.Ala535Gly missense AGO4 2 83270 2.40183E-5 41635 0 NA
1-36301492-T-TA p.Asn543fs frameshift AGO4 1 83282 1.20074E-5 41641 0 NA
1-36301504-T-G p.Val545Gly missense AGO4 1 83296 1.20054E-5 41648 0 3.97905E-6
1-36301571-C-CTTTATAACCTACTAT p.Asn567_Asn568insPheIleThrTyrTyr conservative_inframe_insertion AGO4 1 83212 1.20175E-5 41606 0 NA
1-36301572-A-G p.Asn568Asp missense AGO4 1 83218 1.20166E-5 41609 0 NA
1-36301573-A-G p.Asn568Ser missense AGO4 3 83206 3.60551E-5 41603 0 3.30044E-5
1-36301584-C-T p.Pro572Ser missense AGO4 1 83184 1.20215E-5 41592 0 3.18573E-5
1-36306762-G-A c.1725-4G>A splice_region AGO4 2 82846 2.41412E-5 41423 0 NA
1-36306771-C-T p.Ser577Leu missense AGO4 4 82854 4.82777E-5 41427 0 1.19773E-5
1-36306772-G-A p.Ser577Ser synonymous AGO4 2 82870 2.41342E-5 41435 0 6.37064E-5
1-36306793-C-A p.Ile584Ile synonymous AGO4 1 82914 1.20607E-5 41457 0 4.97084E-5
1-36306803-G-T p.Ala588Ser missense AGO4 2 82880 2.41313E-5 41440 0 1.19508E-5
1-36306805-G-A p.Ala588Ala synonymous AGO4 3 82906 3.61856E-5 41453 0 5.78972E-5
1-36306818-C-T p.Pro593Ser missense AGO4 1 82922 1.20595E-5 41461 0 3.98257E-6
1-36306887-C-T p.Arg616Trp missense AGO4 2 83016 2.40917E-5 41508 0 3.98042E-6
1-36306888-G-A p.Arg616Gln missense AGO4 3 83018 3.61367E-5 41509 0 8.24511E-6
1-36306901-C-T p.Thr620Thr synonymous AGO4 321 83048 0.00386523 41524 3 0.0125881
1-36306908-G-T p.Val623Leu missense AGO4 1 83028 1.20441E-5 41514 0 NA
1-36306910-G-A p.Val623Val synonymous AGO4 2 83028 2.40883E-5 41514 0 8.24212E-6
1-36306920-C-G p.Arg627Gly missense AGO4 12 83022 1.4454E-4 41511 0 8.75713E-5
1-36306921-G-A p.Arg627Gln missense AGO4 1 83022 1.2045E-5 41511 0 2.38833E-5
1-36306922-G-A p.Arg627Arg synonymous AGO4 6 83012 7.22787E-5 41506 0 8.24131E-6
1-36306926-G-A p.Glu629Lys missense AGO4 1 83012 1.20465E-5 41506 0 NA
1-36306927-A-G p.Glu629Gly missense AGO4 1 83014 1.20462E-5 41507 0 NA
1-36306930-T-C p.Ile630Thr missense AGO4 1 83006 1.20473E-5 41503 0 NA
1-36306946-C-G p.Leu635Leu synonymous AGO4 2 82986 2.41005E-5 41493 0 3.98076E-6
1-36306949-C-T p.Tyr636Tyr synonymous AGO4 1 82982 1.20508E-5 41491 0 NA
1-36306959-G-A p.Val640Ile missense AGO4 1 82934 1.20578E-5 41467 0 8.2394E-6
1-36306964-C-T p.Ile641Ile synonymous AGO4 1 82922 1.20595E-5 41461 0 NA
1-36306975-C-T p.Thr645Ile missense AGO4 2 82894 2.41272E-5 41447 0 3.18492E-5
1-36306979-C-T p.Asn646Asn synonymous AGO4 1 82872 1.20668E-5 41436 0 NA
1-36306987-G-A p.Arg649Gln missense AGO4 2 82844 2.41418E-5 41422 0 3.18552E-5
1-36306995-C-T p.Leu652Leu synonymous AGO4 2 82868 2.41348E-5 41434 0 NA
1-36306997-G-T p.Leu652Leu synonymous AGO4 1 82868 1.20674E-5 41434 0 NA
1-36307019-C-T p.Arg660Cys missense AGO4 2 82920 2.41196E-5 41460 0 2.4717E-5
1-36307020-G-A p.Arg660His missense AGO4 7 82930 8.44085E-5 41465 0 5.03525E-4
1-36307037-A-T p.Ile666Phe missense AGO4 1 82998 1.20485E-5 41499 0 NA
1-36307044-A-G p.Tyr668Cys missense AGO4 1 83020 1.20453E-5 41510 0 1.19432E-5
1-36307050-G-A p.Arg670His missense AGO4 2 83036 2.40859E-5 41518 0 3.98203E-6
1-36307075-G-C p.Met678Ile missense AGO4 2 83094 2.40691E-5 41547 0 NA
1-36307079-CAGGTACTCTCATTATCCCTGTTGCCCTTCGGGGCCCCTAGGAGTCTGAGGGAGATTCCTCTCATCTACCATTCTGGGTAGATCTGAGAGATACTAGGCAAATTCTCAATTAAACATAATTCCATTTCTGTCTTCT-C p.Gln680fs frameshift AGO4 1 83096 1.20343E-5 41548 0 NA
1-36307089-C-A c.2040+8C>A splice_region AGO4 2 83086 2.40714E-5 41543 0 NA
1-36307214-T-C c.2041-3T>C splice_region AGO4 2 82844 2.41418E-5 41422 0 3.18674E-5
1-36307225-G-T p.Trp683Cys missense AGO4 1 82810 1.20758E-5 41405 0 NA
1-36307244-C-A p.Arg690Arg synonymous AGO4 10 82738 1.20863E-4 41369 0 1.1153E-4
1-36307259-A-T p.Ser695Cys missense AGO4 1 82718 1.20893E-5 41359 0 NA
1-36307267-A-G p.Glu697Glu synonymous AGO4 3 82756 3.62511E-5 41378 0 3.29614E-5
1-36307272-A-T p.Asp699Val missense AGO4 11 82764 1.32908E-4 41382 0 5.57565E-5
1-36307278-G-A p.Arg701Gln missense AGO4 2 82756 2.41674E-5 41378 0 8.24158E-6
1-36307294-T-C p.Tyr706Tyr synonymous AGO4 4 82788 4.83162E-5 41394 0 7.41901E-5
1-36307297-T-C p.Ile707Ile synonymous AGO4 1 82788 1.2079E-5 41394 0 NA
1-36307306-A-G p.Gln710Gln synonymous AGO4 1 82856 1.20691E-5 41428 0 3.98191E-6
1-36307358-A-G c.2175+7A>G splice_region AGO4 1 82700 1.20919E-5 41350 0 3.98705E-6
1-36315754-G-T c.2176-4G>T splice_region AGO4 2 82338 2.42901E-5 41169 0 6.25E-4
1-36315774-A-G p.Asn731Ser missense AGO4 1 82676 1.20954E-5 41338 0 1.34936E-5
1-36315790-T-C p.Thr736Thr synonymous AGO4 1 82910 1.20613E-5 41455 0 NA
1-36315800-A-G p.Ser740Gly missense AGO4 3 82978 3.61542E-5 41489 0 4.78118E-5
1-36315801-G-C p.Ser740Thr missense AGO4 7 82966 8.43719E-5 41483 0 1.91241E-4
1-36315814-T-A p.His744Gln missense AGO4 1 82944 1.20563E-5 41472 0 NA
1-36315841-T-C p.Cys753Cys synonymous AGO4 1 82878 1.20659E-5 41439 0 7.95551E-6
1-36315853-A-T p.Gly757Gly synonymous AGO4 6 82794 7.2469E-5 41397 0 6.37024E-5
1-36315862-A-AACCAGCCGTCCCTCAC c.2277+3_2277+4insACCAGCCGTCCCTCAC splice_region AGO4 1 82612 1.21048E-5 41306 0 NA
1-36315865-T-TAGTCA c.2277+6_2277+7insAGTCA splice_region AGO4 1 82598 1.21068E-5 41299 0 NA
1-36315867-G-C c.2277+8G>C splice_region AGO4 1 82562 1.21121E-5 41281 0 NA
1-36316447-C-G c.2278-8C>G splice_region AGO4 2 80188 2.49414E-5 40094 0 NA
1-36316448-T-C c.2278-7T>C splice_region AGO4 5 80186 6.2355E-5 40093 0 1.2611E-5
1-36316464-C-T p.Arg763Cys missense AGO4 1 80552 1.24143E-5 40276 0 NA
1-36316479-C-G p.Gln768Glu missense AGO4 1 80858 1.23674E-5 40429 0 8.00288E-6
1-36316480-A-G p.Gln768Arg missense AGO4 1 80870 1.23655E-5 40435 0 NA
1-36316505-C-G p.Phe776Leu missense AGO4 1 81224 1.23116E-5 40612 0 NA
1-36316523-G-C p.Gln782His missense AGO4 1 81720 1.22369E-5 40860 0 8.23764E-6
1-36316529-G-A p.Leu784Leu synonymous AGO4 14 81872 1.70999E-4 40936 0 1.27698E-4
1-36316531-C-T p.Thr785Ile missense AGO4 1 81870 1.22145E-5 40935 0 NA
1-36316571-A-C p.Ser798Ser synonymous AGO4 58938 80964 0.727953 40482 23123 0.746875
1-36316571-A-T p.Ser798Ser synonymous AGO4 3 82146 3.65203E-5 41073 0 4.12562E-5
1-36316603-G-A p.Arg809Gln missense AGO4 1 82224 1.21619E-5 41112 0 3.98498E-6
1-36316621-C-A p.Ala815Glu missense AGO4 1 81926 1.22061E-5 40963 0 NA
1-36316648-A-G p.His824Arg missense AGO4 1 81292 1.23013E-5 40646 0 NA
1-36319098-T-C p.Ser826Ser splice_region+synonymous AGO4 2 82880 2.41313E-5 41440 0 NA
1-36319100-C-T p.Ala827Val missense+splice_region AGO4 22 82876 2.65457E-4 41438 0 1.89599E-4
1-36319101-G-A p.Ala827Ala synonymous AGO4 4 82920 4.82393E-5 41460 0 9.67134E-5
1-36319111-C-T p.His831Tyr missense AGO4 1 83028 1.20441E-5 41514 0 1.20387E-5
1-36319113-T-C p.His831His synonymous AGO4 1 83038 1.20427E-5 41519 0 NA
1-36319130-A-G p.Asn837Ser missense AGO4 1 83120 1.20308E-5 41560 0 NA
1-36319131-C-T p.Asn837Asn synonymous AGO4 1 83122 1.20305E-5 41561 0 1.5949E-5
1-36319135-C-T p.Arg839Trp missense AGO4 1 83130 1.20294E-5 41565 0 1.65972E-5
1-36319148-C-T p.Ala843Val missense AGO4 3 83168 3.60716E-5 41584 0 NA
1-36319148-C-A p.Ala843Asp missense AGO4 1 83168 1.20239E-5 41584 0 8.28734E-6
1-36319152-G-A p.Leu844Leu synonymous AGO4 1 83186 1.20213E-5 41593 0 NA
1-36319154-C-G p.Ala845Gly missense AGO4 1 83186 1.20213E-5 41593 0 NA
1-36319158-G-A p.Lys846Lys synonymous AGO4 2 83196 2.40396E-5 41598 0 7.96305E-6
1-36319167-A-G p.Gln849Gln synonymous AGO4 1 83210 1.20178E-5 41605 0 NA
1-36319176-T-C p.His852His synonymous AGO4 2 83232 2.40292E-5 41616 0 1.19413E-5
1-36319179-T-C p.Asp853Asp synonymous AGO4 1 83226 1.20155E-5 41613 0 NA
1-36319190-C-A p.Thr857Lys missense AGO4 2 83242 2.40263E-5 41621 0 NA
1-36319191-G-A p.Thr857Thr synonymous AGO4 1 83258 1.20109E-5 41629 0 3.18593E-5
1-36320278-T-C n.216T>C splice_region AGO4 1 44514 2.24648E-5 22257 0 NA