Variant

Variant ID Consequence Effect Gene AC AN AF NS NHOM maxEAF
1-36396798-C-T c.-230C>T 5_prime_UTR_premature_start_codon_gain AGO3 1 30688 3.2586E-5 15344 0 9.6E-5
1-36396826-C-G c.-198-4C>G splice_region AGO3 1 45990 2.17439E-5 22995 0 NA
1-36396838-C-T c.-190C>T 5_prime_UTR_premature_start_codon_gain AGO3 24 51514 4.65893E-4 25757 0 6.39386E-5
1-36396874-C-G c.-598C>G 5_prime_UTR_premature_start_codon_gain AGO3 2 61886 3.23175E-5 30943 0 3.19366E-5
1-36396884-T-C c.-588T>C 5_prime_UTR_premature_start_codon_gain AGO3 1 63144 1.58368E-5 31572 0 NA
1-36396944-C-T c.-528C>T 5_prime_UTR_premature_start_codon_gain AGO3 1 72318 1.38278E-5 36159 0 3.19101E-5
1-36396961-C-T c.-511C>T 5_prime_UTR_premature_start_codon_gain AGO3 8 73738 1.08492E-4 36869 0 NA
1-36396977-C-T c.-495C>T 5_prime_UTR_premature_start_codon_gain AGO3 1 74446 1.34326E-5 37223 0 NA
1-36397012-C-G c.-460C>G 5_prime_UTR_premature_start_codon_gain AGO3 2 76192 2.62495E-5 38096 0 NA
1-36397054-A-G c.-426+8A>G splice_region AGO3 1 76800 1.30208E-5 38400 0 NA
1-36411298-G-A p.Ala9Thr missense AGO3 5 82852 6.03486E-5 41426 0 6.39591E-5
1-36411302-G-T p.Gly10Val missense AGO3 3 82974 3.61559E-5 41487 0 3.18959E-5
1-36411310-C-T p.Pro13Ser missense AGO3 3 83034 3.61298E-5 41517 0 3.18959E-5
1-36411321-G-A p.Met16Ile missense AGO3 1 83108 1.20325E-5 41554 0 8.25587E-6
1-36411341-A-G p.Tyr23Cys missense AGO3 1 83176 1.20227E-5 41588 0 4.77243E-5
1-36411346-A-G p.Thr25Ala missense AGO3 2 83200 2.40385E-5 41600 0 NA
1-36411354-C-T p.Gly27Gly synonymous AGO3 1 83242 1.20132E-5 41621 0 8.24144E-6
1-36411388-G-A p.Val39Ile missense AGO3 1 83254 1.20114E-5 41627 0 NA
1-36411426-A-G p.Val51Val synonymous AGO3 2 83190 2.40414E-5 41595 0 NA
1-36411440-A-G p.Asp56Gly missense AGO3 1 83132 1.20291E-5 41566 0 NA
1-36411441-C-T p.Asp56Asp synonymous AGO3 1 83122 1.20305E-5 41561 0 NA
1-36411465-G-GGAGGTGGTTGACTCAATGGTTCAGCATTT c.-254+1_-254+2insGAGGTGGTTGACTCAATGGTTCAGCATTT splice_donor AGO3 1 82820 1.20744E-5 41410 0 NA
1-36432546-CCTT-C c.192-9_192-7delCTT splice_region AGO3 4 82816 4.82998E-5 41408 0 4.25916E-5
1-36432572-A-G p.Met70Val missense AGO3 1 83092 1.20349E-5 41546 0 1.60613E-5
1-36432575-G-T p.Val71Phe missense AGO3 1 83094 1.20346E-5 41547 0 NA
1-36432590-G-A p.Val76Ile missense AGO3 1 83148 1.20267E-5 41574 0 NA
1-36432592-A-G p.Val76Val synonymous AGO3 2 83138 2.40564E-5 41569 0 8.25355E-6
1-36432593-A-G p.Thr77Ala missense AGO3 1 83150 1.20265E-5 41575 0 8.25518E-6
1-36432596-A-G p.Ile78Val missense AGO3 1 83162 1.20247E-5 41581 0 3.18532E-5
1-36432617-G-A p.Val85Ile missense AGO3 1 83170 1.20236E-5 41585 0 NA
1-36432636-G-A p.Ser91Asn missense AGO3 1 83160 1.2025E-5 41580 0 NA
1-36432646-C-T p.Thr94Thr synonymous AGO3 3 83124 3.60907E-5 41562 0 3.18903E-5
1-36432647-G-A p.Ala95Thr missense AGO3 1 83112 1.2032E-5 41556 0 NA
1-36432650-A-G p.Asn96Asp missense AGO3 1 83110 1.20322E-5 41555 0 3.99116E-6
1-36432651-A-G p.Asn96Ser missense AGO3 7 83110 8.42257E-5 41555 0 1.27647E-4
1-36432679-A-AGATTTAGACGTTACTTTACCTGGGG c.312+3_312+4insGATTTAGACGTTACTTTACCTGGGG splice_region AGO3 1 82914 1.20607E-5 41457 0 NA
1-36432683-T-TA c.312+7_312+8insA splice_region AGO3 1 82846 1.20706E-5 41423 0 8.31172E-6
1-36437619-C-A c.-253-6C>A splice_region AGO3 1 83006 1.20473E-5 41503 0 NA
1-36437626-T-A p.Val105Glu missense+splice_region AGO3 2 83116 2.40628E-5 41558 0 8.38785E-6
1-36437637-G-A p.Val109Ile missense AGO3 1 83208 1.20181E-5 41604 0 3.97981E-6
1-36437681-G-C p.Val123Val synonymous AGO3 2 83324 2.40027E-5 41662 0 2.47848E-5
1-36437681-G-A p.Val123Val synonymous AGO3 1 83324 1.20013E-5 41662 0 NA
1-36437685-A-G p.Ile125Val missense AGO3 1 83330 1.20005E-5 41665 0 1.19343E-5
1-36437698-C-G p.Ser129Cys missense AGO3 1 83326 1.20011E-5 41663 0 8.25518E-6
1-36437703-G-T p.Val131Leu missense AGO3 3 83334 3.59997E-5 41667 0 2.38684E-5
1-36437705-G-T p.Val131Val synonymous AGO3 1 83338 1.19993E-5 41669 0 NA
1-36437722-A-T p.His137Leu missense AGO3 2 83352 2.39946E-5 41676 0 6.37064E-5
1-36437726-A-C p.Glu138Asp missense AGO3 1 83346 1.19982E-5 41673 0 NA
1-36437739-C-T p.Arg143Trp missense AGO3 1 83340 1.1999E-5 41670 0 8.2481E-6
1-36437741-G-C p.Arg143Arg synonymous AGO3 1 83328 1.20008E-5 41664 0 6.37389E-5
1-36437743-C-A p.Thr144Asn missense AGO3 1 83336 1.19996E-5 41668 0 3.18674E-5
1-36437744-C-A p.Thr144Thr synonymous AGO3 15 83336 1.79994E-4 41668 0 6.25E-4
1-36437750-T-A p.Pro146Pro synonymous AGO3 2 83322 2.40033E-5 41661 0 2.38688E-5
1-36437756-A-G p.Pro148Pro synonymous AGO3 1 83332 1.20002E-5 41666 0 NA
1-36437774-A-G p.Pro154Pro synonymous AGO3 1 83348 1.19979E-5 41674 0 3.97788E-6
1-36437777-C-T p.Ile155Ile synonymous AGO3 1 83354 1.1997E-5 41677 0 NA
1-36437789-T-C p.Pro159Pro synonymous AGO3 1 83338 1.19993E-5 41669 0 NA
1-36437794-A-G p.His161Arg missense AGO3 1 83324 1.20013E-5 41662 0 NA
1-36437798-C-T c.-80C>T 5_prime_UTR_premature_start_codon_gain AGO3 1 83316 1.20025E-5 41658 0 3.97836E-5
1-36437805-G-A p.Val165Met missense AGO3 3 83306 3.60118E-5 41653 0 NA
1-36437822-G-A p.Leu170Leu synonymous AGO3 45 83218 5.40748E-4 41609 0 0.00124212
1-36437829-A-G p.Met173Val missense AGO3 1 83226 1.20155E-5 41613 0 NA
1-36437833-A-G p.Lys174Arg missense+splice_region AGO3 1 83144 1.20273E-5 41572 0 NA
1-36438976-A-G p.Lys174Lys splice_region+synonymous AGO3 1 79902 1.25153E-5 39951 0 NA
1-36438983-C-T p.Pro177Ser missense AGO3 1 81552 1.22621E-5 40776 0 NA
1-36438991-G-A p.Gly179Gly synonymous AGO3 3 81818 3.66667E-5 40909 0 3.18613E-5
1-36438992-C-T p.Arg180Cys missense AGO3 2 81786 2.44541E-5 40893 0 NA
1-36438997-A-C p.Ser181Ser synonymous AGO3 1 82160 1.21714E-5 41080 0 4.14453E-6
1-36439003-C-T p.Phe183Phe synonymous AGO3 1 82142 1.2174E-5 41071 0 4.13572E-6
1-36439006-C-T p.Ser184Ser synonymous AGO3 2 82016 2.43855E-5 41008 0 3.30617E-5
1-36439011-C-T p.Pro186Leu missense AGO3 3 82204 3.64946E-5 41102 0 1.22985E-5
1-36439027-C-T p.His191His synonymous AGO3 25 82544 3.02869E-4 41272 0 1.98013E-4
1-36439104-A-T p.Asn217Ile missense AGO3 1 81764 1.22303E-5 40882 0 1.23746E-5
1-36439106-A-G p.Ile218Val missense AGO3 1 81794 1.22258E-5 40897 0 4.14206E-6
1-36439111-TG-T c.658+1delG splice_donor AGO3 1 81588 1.22567E-5 40794 0 NA
1-36439112-G-GTTTCTGCCACTGCCTTCTACAAAGCACAACCT c.658_658+1insTTTCTGCCACTGCCTTCTACAAAGCACAACCT splice_donor AGO3 2 81570 2.45188E-5 40785 1 NA
1-36439112-G-GAAAGAGACCTCTGGCAGCAGTGTGGA c.658_658+1insAAAGAGACCTCTGGCAGCAGTGTGGA splice_donor AGO3 1 81570 1.22594E-5 40785 0 NA
1-36448230-C-T p.Leu223Phe missense AGO3 1 52614 1.90063E-5 26307 0 NA
1-36448311-C-T c.*58C>T splice_region AGO3 1 52504 1.90462E-5 26252 0 NA
1-36448312-A-G c.*59A>G splice_region AGO3 2 52496 3.80981E-5 26248 0 NA
1-36470014-T-C p.Ile10Thr missense AGO3 2 82648 2.4199E-5 41324 0 NA
1-36470018-T-C p.Asp11Asp synonymous AGO3 3 82582 3.63275E-5 41291 0 NA
1-36470037-A-G p.Thr18Ala missense AGO3 3 82410 3.64033E-5 41205 0 2.48295E-5
1-36470049-C-T p.Arg22Trp missense AGO3 1 82168 1.21702E-5 41084 0 4.01813E-6
1-36474313-T-C p.His38His synonymous AGO3 1 83222 1.20161E-5 41611 0 NA
1-36474327-G-A p.Arg43Lys missense AGO3 2 83226 2.4031E-5 41613 0 NA
1-36474355-A-G p.Thr52Thr synonymous AGO3 5 83298 6.00254E-5 41649 0 0.00254777
1-36474361-G-A p.Arg54Arg synonymous AGO3 1 83306 1.20039E-5 41653 0 8.26091E-6
1-36474378-CGTAAGAAAAGTTTGTCAGAGCAGCGATGGTGTGAGGCAGCTTGCTCTAGTTAGTGGGGTTGGGAGTTTTTCTGGCTCATAATGGGCAAGAATTGTTCATGTGTACTTTTTTTTCCTCAG-C c.179+1_180-1del splice_acceptor AGO3 4 83344 4.79939E-5 41672 0 NA
1-36474491-T-C c.180-7T>C splice_region AGO3 1 83348 1.19979E-5 41674 0 8.23764E-6
1-36474519-C-T p.Asn67Asn synonymous AGO3 3 83332 3.60006E-5 41666 0 5.03525E-4
1-36474520-G-A p.Gly68Ser missense AGO3 1 83330 1.20005E-5 41665 0 1.91339E-4
1-36474528-T-A p.Thr70Thr synonymous AGO3 1 83338 1.19993E-5 41669 0 NA
1-36474531-G-A p.Val71Val synonymous AGO3 1 83338 1.19993E-5 41669 0 NA
1-36474540-A-G p.Thr74Thr synonymous AGO3 2 83338 2.39987E-5 41669 0 3.9789E-6
1-36474546-G-A p.Ala76Ala synonymous AGO3 12 83322 1.4402E-4 41661 0 0.00302115
1-36474586-C-G p.Pro90Ala missense AGO3 1 83240 1.20135E-5 41620 0 NA
1-36474587-C-T p.Pro90Leu missense AGO3 1 83230 1.20149E-5 41615 0 3.66435E-5
1-36474588-G-A p.Pro90Pro synonymous AGO3 52 83230 6.24775E-4 41615 0 0.0010101
1-36474588-G-T p.Pro90Pro synonymous AGO3 3 83230 3.60447E-5 41615 0 4.0588E-6
1-36474597-C-A p.Pro93Pro synonymous AGO3 1 83204 1.20187E-5 41602 0 NA
1-36474612-G-A p.Gly98Gly synonymous AGO3 2 83070 2.40761E-5 41535 0 NA
1-36474618-A-G p.Glu100Glu synonymous AGO3 349 83030 0.0042033 41515 8 0.00815076
1-36474628-A-C p.Thr104Pro missense AGO3 2 82688 2.41873E-5 41344 0 0.217701
1-36474632-A-C p.Tyr105Ser missense AGO3 2 81598 2.45104E-5 40799 0 0.308749
1-36474633-C-T p.Tyr105Tyr synonymous AGO3 2 83022 2.409E-5 41511 0 4.77678E-6
1-36474647-T-TCTGTAATATTGTGGCAGGGCAACGATGTATC c.327+2_327+3insCTGTAATATTGTGGCAGGGCAACGATGTATC splice_region AGO3 1 82866 1.20677E-5 41433 0 NA
1-36475072-G-A c.328-4G>A splice_region AGO3 1 82216 1.21631E-5 41108 0 NA
1-36475078-C-G p.Val110Val splice_region+synonymous AGO3 1 82374 1.21398E-5 41187 0 4.02198E-6
1-36475099-A-G p.Gln117Gln synonymous AGO3 2 82572 2.42213E-5 41286 0 3.18695E-5
1-36475100-C-T p.Arg118* stop_gained AGO3 1 82554 1.21133E-5 41277 0 NA
1-36475136-A-G p.Thr130Ala missense AGO3 1 82776 1.20808E-5 41388 0 NA
1-36475148-G-A p.Ala134Thr missense AGO3 1 82772 1.20814E-5 41386 0 NA
1-36475171-T-C p.Asp141Asp synonymous AGO3 2 82774 2.41622E-5 41387 0 8.28693E-5
1-36479224-T-C c.448-7T>C splice_region AGO3 30 83228 3.60456E-4 41614 0 6.36862E-4
1-36479234-A-G p.Arg151Gly missense AGO3 3 83270 3.60274E-5 41635 0 NA
1-36479252-A-G p.Thr157Ala missense AGO3 4 83310 4.80134E-5 41655 0 1.91058E-4
1-36479269-G-A p.Gln162Gln synonymous AGO3 1 83318 1.20022E-5 41659 0 NA
1-36479288-C-T p.Arg169Trp missense AGO3 2 83314 2.40056E-5 41657 0 7.95482E-6
1-36479290-G-A p.Arg169Arg synonymous AGO3 402 83300 0.00482593 41650 2 0.00445671
1-36479295-A-G p.Glu171Gly missense AGO3 1 83322 1.20016E-5 41661 0 NA
1-36479317-C-T p.Arg178Arg synonymous AGO3 1 83282 1.20074E-5 41641 0 4.11882E-5
1-36479318-G-A p.Val179Ile missense AGO3 2 83284 2.40142E-5 41642 0 4.11889E-5
1-36479338-C-G p.Leu185Leu synonymous AGO3 4 83254 4.80457E-5 41627 0 6.36943E-5
1-36479353-G-GAATCGGACAGTAGCAACACCGAGCCATGGAGTATGGGACATGCGA c.570_570+1insAATCGGACAGTAGCAACACCGAGCCATGGAGTATGGGACATGCGA splice_donor AGO3 1 83190 1.20207E-5 41595 0 NA
1-36479510-G-A c.571-6G>A splice_region AGO3 1 82936 1.20575E-5 41468 0 1.21645E-5
1-36479533-A-C p.Thr196Thr synonymous AGO3 1 82990 1.20496E-5 41495 0 NA
1-36479569-A-G p.Gln208Gln synonymous AGO3 1 83032 1.20435E-5 41516 0 8.2375E-5
1-36479605-C-T p.Ile220Ile synonymous AGO3 1 83128 1.20296E-5 41564 0 6.37552E-5
1-36479635-A-G p.Arg230Arg synonymous AGO3 1 83160 1.2025E-5 41580 0 NA
1-36479642-A-G p.Ile233Val missense AGO3 4 83134 4.81151E-5 41567 0 2.23001E-4
1-36479650-G-GGGTTTCACAGACCAGCTGCGTAAGATTTC c.704+1_704+2insGGTTTCACAGACCAGCTGCGTAAGATTTC splice_donor AGO3 2 83088 2.40709E-5 41544 0 NA
1-36492731-C-T p.Leu241Leu synonymous AGO3 2 83380 2.39866E-5 41690 0 NA
1-36492735-G-A p.Arg242His missense AGO3 1 83382 1.1993E-5 41691 0 6.36699E-5
1-36492798-A-AG p.Ala265fs frameshift AGO3 1 83416 1.19881E-5 41708 0 NA
1-36492803-GC-TT p.Ala265Leu missense AGO3 1 83416 1.19881E-5 41708 0 NA
1-36492811-C-T p.Ser267Ser synonymous AGO3 7 83408 8.39248E-5 41704 0 1.59074E-5
1-36492826-C-T p.Phe272Phe synonymous AGO3 1 83420 1.19875E-5 41710 0 3.1841E-5
1-36492841-C-T p.Asn277Asn synonymous AGO3 1 83418 1.19878E-5 41709 0 NA
1-36492854-C-T p.Leu282Leu synonymous AGO3 1 83412 1.19887E-5 41706 0 NA
1-36492868-C-T p.Ile286Ile synonymous AGO3 1 83408 1.19893E-5 41704 0 2.3917E-5
1-36492868-C-G p.Ile286Met missense AGO3 1 83408 1.19893E-5 41704 0 NA
1-36492869-G-A p.Val287Ile missense AGO3 3 83414 3.59652E-5 41707 0 9.55475E-5
1-36492875-C-G p.Leu289Val missense AGO3 2 83414 2.39768E-5 41707 0 NA
1-36492877-G-T p.Leu289Leu synonymous AGO3 1 83404 1.19898E-5 41702 0 NA
1-36492880-G-A p.Pro290Pro synonymous AGO3 188 83396 0.0022543 41698 2 0.0020141
1-36492889-A-T p.Thr293Thr synonymous AGO3 5 83380 5.99664E-5 41690 0 3.59957E-5
1-36492899-G-GCGGAAGTGAAACGTGTAGGAGACACACTTTT c.889_889+1insCGGAAGTGAAACGTGTAGGAGACACACTTTT splice_donor AGO3 1 83356 1.19967E-5 41678 0 NA
1-36492906-A-G c.889+7A>G splice_region AGO3 1 83244 1.20129E-5 41622 0 NA
1-36499767-T-C c.890-8T>C splice_region AGO3 1 81184 1.23177E-5 40592 0 4.94179E-6
1-36499768-T-C c.890-7T>C splice_region AGO3 1 81326 1.22962E-5 40663 0 4.91304E-6
1-36499772-T-C c.890-3T>C splice_region AGO3 2 81286 2.46045E-5 40643 0 NA
1-36499819-C-A p.Gln312Lys missense AGO3 1 82636 1.21013E-5 41318 0 5.03863E-5
1-36499833-C-T p.Val316Val synonymous AGO3 5 82784 6.03981E-5 41392 0 1.10194E-4
1-36499839-T-C p.Asn318Asn synonymous AGO3 1 82834 1.20723E-5 41417 0 NA
1-36499843-A-G p.Ile320Val missense AGO3 70 82894 8.44452E-4 41447 0 6.18837E-4
1-36499844-T-TAA p.Thr322fs frameshift AGO3 1 82900 1.20627E-5 41450 0 NA
1-36499875-G-T p.Leu330Phe missense AGO3 1 83028 1.20441E-5 41514 0 NA
1-36499899-C-T p.Leu338Leu synonymous AGO3 6 82874 7.23991E-5 41437 0 3.32862E-5
1-36499921-G-C p.Val346Leu missense AGO3 2 82516 2.42377E-5 41258 0 8.41708E-6
1-36499934-G-GACCTTCTGTGTTCCAGCAACCAGTGATCTTTTTGGGAGCCGAT c.1049_1049+1insACCTTCTGTGTTCCAGCAACCAGTGATCTTTTTGGGAGCCGAT splice_donor AGO3 1 82078 1.21835E-5 41039 0 NA
1-36501771-G-T c.1050-7G>T splice_region AGO3 1 83062 1.20392E-5 41531 0 3.98187E-6
1-36501781-T-G p.Pro351Pro synonymous AGO3 1 83200 1.20192E-5 41600 0 NA
1-36501799-A-G p.Pro357Pro synonymous AGO3 45 83246 5.40567E-4 41623 0 0.0020141
1-36501817-C-T p.Ala363Ala synonymous AGO3 4 83256 4.80446E-5 41628 0 6.37877E-5
1-36501818-G-A p.Asp364Asn missense AGO3 1 83262 1.20103E-5 41631 0 NA
1-36501829-T-C p.His367His synonymous AGO3 58 83278 6.96462E-4 41639 0 5.0243E-4
1-36501853-G-A p.Lys375Lys synonymous AGO3 1 83218 1.20166E-5 41609 0 NA
1-36501854-C-A p.Pro376Thr missense AGO3 1 83220 1.20163E-5 41610 0 NA
1-36501869-G-GT c.1140+1_1140+2insT splice_donor AGO3 1 83156 1.20256E-5 41578 0 NA
1-36501870-T-TTGTAGGTAGTATGGATGCACACCCAAGCAGATACTGTGCCACA c.1140+2_1140+3insTGTAGGTAGTATGGATGCACACCCAAGCAGATACTGTGCCACA splice_region AGO3 1 83148 1.20267E-5 41574 0 NA
1-36501870-T-TTGTAGGTAGTATGGATGCACACCCAAGCAGATACTGTGCCACAGTAA c.1140+2_1140+3insTGTAGGTAGTATGGATGCACACCCAAGCAGATACTGTGCCACAGTAA splice_region AGO3 1 83148 1.20267E-5 41574 0 NA
1-36501870-T-TTGTAGGTAGTATGGATGCACACCCAAGCAGATACTGTGCCACAGTAAGAGTTCA c.1140+2_1140+3insTGTAGGTAGTATGGATGCACACCCAAGCAGATACTGTGCCACAGTAAGAGTTCA splice_region AGO3 1 83148 1.20267E-5 41574 0 NA
1-36505453-C-G p.Pro401Pro synonymous AGO3 3 83248 3.60369E-5 41624 0 NA
1-36505478-G-A p.Ala410Thr missense AGO3 1 83288 1.20065E-5 41644 0 3.18613E-5
1-36505501-T-C p.Leu417Leu synonymous AGO3 1 83326 1.20011E-5 41663 0 0.001875
1-36505507-A-G p.Gln419Gln synonymous AGO3 163 83328 0.00195613 41664 0 0.00208796
1-36505516-G-A p.Lys422Lys synonymous AGO3 2 83334 2.39998E-5 41667 0 NA
1-36505524-G-T p.Arg425Leu missense AGO3 2 83330 2.4001E-5 41665 0 NA
1-36505525-G-T p.Arg425Arg synonymous AGO3 2 83330 2.4001E-5 41665 0 7.95475E-6
1-36505534-T-C p.Pro428Pro synonymous AGO3 1 83328 1.20008E-5 41664 0 NA
1-36505554-G-C p.Arg435Pro missense AGO3 1 83308 1.20036E-5 41654 0 NA
1-36505560-G-A p.Gly437Asp missense AGO3 1 83306 1.20039E-5 41653 0 NA
1-36505576-G-A p.Gln442Gln synonymous AGO3 1 83270 1.20091E-5 41635 0 8.42758E-6
1-36505581-G-A p.Arg444Lys missense AGO3 2 83236 2.40281E-5 41618 0 NA
1-36505919-T-C p.Tyr449Tyr synonymous AGO3 1 83110 1.20322E-5 41555 0 NA
1-36505922-A-G p.Glu450Glu synonymous AGO3 1 83128 1.20296E-5 41564 0 NA
1-36505942-C-G p.Ala457Gly missense AGO3 2 83178 2.40448E-5 41589 0 3.97924E-6
1-36505997-G-A p.Gln475Gln synonymous AGO3 3 83198 3.60586E-5 41599 0 2.47154E-5
1-36506022-T-G p.Cys484Gly missense AGO3 1 83108 1.20325E-5 41554 0 NA
1-36506032-G-GATTCCATTTT p.Thr488fs frameshift AGO3 1 83082 1.20363E-5 41541 0 NA
1-36506033-G-A p.Arg487Arg synonymous AGO3 1 83074 1.20375E-5 41537 0 NA
1-36509065-T-C p.Asn496Asn synonymous AGO3 1 83128 1.20296E-5 41564 0 NA
1-36509116-C-T p.Phe513Phe synonymous AGO3 68 83116 8.18134E-4 41558 0 0.00108266
1-36509148-A-AG p.Ala521fs frameshift AGO3 1 82862 1.20683E-5 41431 0 NA
1-36509150-G-GGTACCAGTCGTCCTTCACACTATCATGTTTTA c.1572+1_1572+2insGTACCAGTCGTCCTTCACACTATCATGTTTTA splice_donor AGO3 1 82834 1.20723E-5 41417 0 NA
1-36520542-TA-T c.1573-4delA splice_region AGO3 1 82478 1.21244E-5 41239 0 8.24538E-6
1-36520544-T-C c.1573-3T>C splice_region AGO3 1 82496 1.21218E-5 41248 0 NA
1-36520571-C-A p.His533Asn missense AGO3 1 82992 1.20494E-5 41496 0 NA
1-36520573-T-C p.His533His synonymous AGO3 1 83012 1.20465E-5 41506 0 1.194E-5
1-36520579-A-G p.Leu535Leu synonymous AGO3 1 83024 1.20447E-5 41512 0 3.1841E-5
1-36520600-T-C p.Thr542Thr synonymous AGO3 2 83076 2.40743E-5 41538 0 NA
1-36520603-A-G p.Ala543Ala synonymous AGO3 1 83088 1.20354E-5 41544 0 NA
1-36520615-G-A p.Gln547Gln synonymous AGO3 627 83068 0.00754803 41534 27 0.0155384
1-36520624-T-C p.Thr550Thr synonymous AGO3 3 83066 3.61159E-5 41533 0 NA
1-36520645-C-T p.Tyr557Tyr synonymous AGO3 16 82948 1.92892E-4 41474 0 3.1837E-4
1-36520646-G-A p.Val558Ile missense AGO3 2 82946 2.41121E-5 41473 0 8.28349E-6
1-36520732-C-T p.Asp586Asp synonymous AGO3 2 80742 2.47703E-5 40371 0 NA
1-36520746-G-GTGCTGAAGGAAGTCACGTTTCA c.1772_1772+1insTGCTGAAGGAAGTCACGTTTCA splice_donor AGO3 1 79446 1.25872E-5 39723 0 NA
1-36520746-G-GTGCTGAAGGAA c.1772_1772+1insTGCTGAAGGAA splice_donor AGO3 3 79446 3.77615E-5 39723 1 NA
1-36520746-G-GTGCTGAAGGAAGTCACGTTTCAGGACAAAGCAATGGGC c.1772_1772+1insTGCTGAAGGAAGTCACGTTTCAGGACAAAGCAATGGGC splice_donor AGO3 1 79446 1.25872E-5 39723 0 NA
1-36520754-A-G c.1772+8A>G splice_region AGO3 1 78318 1.27685E-5 39159 0 NA
1-36521254-G-A p.Val597Ile missense AGO3 1 82900 1.20627E-5 41450 0 1.6478E-5
1-36521283-A-G p.Pro606Pro synonymous AGO3 4 82724 4.83536E-5 41362 0 1.3182E-4
1-36521289-T-C p.Ala608Ala synonymous AGO3 1 82700 1.20919E-5 41350 0 NA
1-36521295-C-G p.Ala610Ala synonymous AGO3 1 82678 1.20951E-5 41339 0 NA
1-36521307-G-A p.Gln614Gln synonymous AGO3 2 82654 2.41973E-5 41327 0 2.4719E-5
1-36521330-C-T p.Thr622Ile missense AGO3 1 82634 1.21016E-5 41317 0 NA
1-36521340-C-T p.Phe625Phe synonymous AGO3 334 82580 0.00404456 41290 2 0.0120846