Variant

Variant ID Consequence Effect Gene AC AN AF NS NHOM maxEAF
8-141542169-T-A p.Thr852Ser missense AGO2 1 83380 1.19933E-5 41690 0 NA
8-141542188-C-T p.Ala845Ala synonymous AGO2 6 83386 7.19545E-5 41693 0 5.16993E-5
8-141542195-G-A p.Ala843Val missense AGO2 2 83384 2.39854E-5 41692 1 NA
8-141542218-G-A p.Asn835Asn synonymous AGO2 3 83378 3.59807E-5 41689 0 3.18492E-5
8-141542222-C-T p.Ser834Asn missense AGO2 1 83376 1.19939E-5 41688 0 2.47133E-5
8-141542254-G-GTCATGTTCCTTATCCACCAGGTGGTACCTGGCCCGGAAGGC c.2472-4_2472-3insGCCTTCCGGGCCAGGTACCACCTGGTGGATAAGGAACATGA splice_region AGO2 2 83304 2.40085E-5 41652 1 NA
8-141542255-C-G c.2472-4G>C splice_region AGO2 1 83290 1.20062E-5 41645 0 6.59207E-5
8-141542259-G-T c.2472-8C>A splice_region AGO2 1 83266 1.20097E-5 41633 0 3.1837E-5
8-141542510-C-T c.2471+5G>A splice_region AGO2 1 82532 1.21165E-5 41266 0 NA
8-141542511-T-C c.2471+4A>G splice_region AGO2 6 82556 7.26779E-5 41278 0 1.27397E-4
8-141542535-C-T p.Leu817Leu synonymous AGO2 9 82896 1.0857E-4 41448 0 1.27348E-4
8-141542541-G-A p.Tyr815Tyr synonymous AGO2 1 82926 1.20589E-5 41463 0 NA
8-141542544-C-T p.Arg814Arg synonymous AGO2 19 82948 2.29059E-4 41474 0 0.00101136
8-141542550-C-T p.Arg812Arg synonymous AGO2 1 82976 1.20517E-5 41488 0 NA
8-141542571-G-A p.Tyr805Tyr synonymous AGO2 1 83026 1.20444E-5 41513 0 3.1835E-5
8-141542583-C-T p.Ala801Ala synonymous AGO2 2 83072 2.40755E-5 41536 0 6.25E-4
8-141542598-G-A p.Ser796Ser synonymous AGO2 3 83092 3.61046E-5 41546 0 3.57964E-5
8-141542616-G-A p.Tyr790Tyr synonymous AGO2 1 83056 1.20401E-5 41528 0 1.59084E-5
8-141542634-G-A n.612C>T splice_region AGO2 3 83144 3.6082E-5 41572 0 2.4748E-5
8-141542668-C-T p.Arg773His missense AGO2 1 83234 1.20143E-5 41617 0 3.1839E-5
8-141542676-G-A p.Asp770Asp synonymous AGO2 4 83226 4.80619E-5 41613 0 3.30284E-5
8-141542682-G-C p.Leu768Leu synonymous AGO2 1 83216 1.20169E-5 41608 0 3.97716E-6
8-141542697-C-T p.Ser763Ser synonymous AGO2 2 83156 2.40512E-5 41578 0 1.1937E-5
8-141542706-G-C p.Ser760Arg missense AGO2 1 83130 1.20294E-5 41565 0 NA
8-141542712-C-A p.Gly758Gly splice_region+synonymous AGO2 3 83080 3.61098E-5 41540 0 2.50054E-5
8-141542718-A-G c.2272-4T>C splice_region AGO2 1 83044 1.20418E-5 41522 0 3.98235E-6
8-141545491-G-A n.308C>T splice_region AGO2 1 79840 1.2525E-5 39920 0 NA
8-141545559-G-C c.2271+8C>G splice_region AGO2 7 83036 8.43008E-5 41518 0 1.59215E-4
8-141545578-C-T p.Ala754Thr missense AGO2 2 83190 2.40414E-5 41595 0 3.18431E-5
8-141545606-G-A p.Thr744Thr synonymous AGO2 1 83270 1.20091E-5 41635 0 5.03525E-4
8-141545608-T-C p.Thr744Ala missense AGO2 1 83260 1.20106E-5 41630 0 3.97652E-6
8-141545614-G-A p.His742Tyr missense AGO2 1 83270 1.20091E-5 41635 0 3.97662E-6
8-141545624-C-T p.Thr738Thr synonymous AGO2 155 83244 0.001862 41622 1 0.00117308
8-141545625-G-A p.Thr738Met missense AGO2 1 83250 1.2012E-5 41625 0 2.47174E-5
8-141545633-A-C p.Thr735Thr synonymous AGO2 34 83276 4.08281E-4 41638 0 9.94162E-5
8-141545636-C-T p.Thr734Thr synonymous AGO2 3 83272 3.60265E-5 41636 0 NA
8-141545639-G-A p.Gly733Gly synonymous AGO2 1 83260 1.20106E-5 41630 0 NA
8-141545672-C-T c.2170-4G>A splice_region AGO2 2 83144 2.40547E-5 41572 0 4.94756E-5
8-141545673-G-A c.2170-5C>T splice_region AGO2 2 83126 2.40599E-5 41563 0 3.18431E-5
8-141549412-A-G c.2169+7T>C splice_region AGO2 396 82490 0.00480058 41245 3 0.0110395
8-141549434-A-G p.Thr718Thr synonymous AGO2 1 82876 1.20662E-5 41438 0 NA
8-141549440-G-A p.Phe716Phe synonymous AGO2 1 82924 1.20592E-5 41462 0 3.99795E-6
8-141549458-C-T p.Arg710Arg synonymous AGO2 1 83010 1.20467E-5 41505 0 1.65711E-5
8-141549464-C-T p.Gln708Gln synonymous AGO2 8 83068 9.63066E-5 41534 0 3.18471E-5
8-141549488-G-A p.Pro700Pro synonymous AGO2 1 83134 1.20288E-5 41567 0 1.64997E-5
8-141549494-G-A p.Tyr698Tyr synonymous AGO2 1 83210 1.20178E-5 41605 0 3.18552E-5
8-141549512-G-A p.Ile692Ile synonymous AGO2 11 83206 1.32202E-4 41603 0 0.00286752
8-141549529-T-C p.Ile687Val missense AGO2 2 83176 2.40454E-5 41588 0 NA
8-141549530-G-A p.Ala686Ala synonymous AGO2 1 83182 1.20218E-5 41591 0 3.98384E-6
8-141549533-C-A p.Leu685Leu synonymous AGO2 1 83166 1.20241E-5 41583 0 NA
8-141549542-G-A p.His682His synonymous AGO2 2 83110 2.40645E-5 41555 0 3.99218E-6
8-141549561-T-C c.2035-8A>G splice_region AGO2 1 82874 1.20665E-5 41437 0 6.25E-4
8-141551257-G-A c.2034+6C>T splice_region AGO2 2 82018 2.43849E-5 41009 0 3.2575E-5
8-141551290-G-A p.Asp669Asp synonymous AGO2 3 82348 3.64308E-5 41174 0 1.13216E-4
8-141551293-G-A p.Arg668Arg synonymous AGO2 13 82354 1.57855E-4 41177 0 3.81997E-4
8-141551314-G-A p.Pro661Pro synonymous AGO2 93 82434 0.00112818 41217 7 0.0128867
8-141551326-C-T p.Thr657Thr synonymous AGO2 2 82472 2.42507E-5 41236 0 8.21882E-5
8-141551344-G-A p.Ile651Ile synonymous AGO2 1 82624 1.2103E-5 41312 0 NA
8-141551347-G-A p.Leu650Leu synonymous AGO2 1 82646 1.20998E-5 41323 0 6.3674E-5
8-141551350-G-A p.Leu649Leu synonymous AGO2 1 82624 1.2103E-5 41312 0 8.02035E-5
8-141551368-G-A p.Ala643Ala synonymous AGO2 167 82610 0.00202155 41305 2 0.00525578
8-141551374-G-T p.Asp641Glu missense AGO2 1 82588 1.21083E-5 41294 0 NA
8-141551395-G-A p.His634His synonymous AGO2 2 82588 2.42166E-5 41294 0 NA
8-141551407-G-A p.Arg630Arg synonymous AGO2 19733 81834 0.241134 40917 2465 0.267658
8-141551416-G-A p.Ala627Ala synonymous AGO2 18 82262 2.18813E-4 41131 0 2.54745E-4
8-141551431-G-T p.Pro622Pro synonymous AGO2 3 81918 3.6622E-5 40959 0 3.7183E-5
8-141551437-G-T p.Ala620Ala synonymous AGO2 1 81716 1.22375E-5 40858 0 NA
8-141551440-G-A p.Asp619Asp synonymous AGO2 5 81570 6.1297E-5 40785 0 6.36943E-5
8-141551461-C-T c.1840-4G>A splice_region AGO2 1 80974 1.23496E-5 40487 0 1.03528E-5
8-141554311-C-T c.1839+1G>A splice_donor AGO2 1 82560 1.21124E-5 41280 0 NA
8-141554315-G-A p.Ala612Ala synonymous AGO2 4 82596 4.84285E-5 41298 0 3.18593E-5
8-141554321-G-A p.Ser610Ser synonymous AGO2 9 82606 1.08951E-4 41303 0 6.25E-4
8-141554339-C-T p.Gly604Gly synonymous AGO2 1 82642 1.21004E-5 41321 0 6.25E-4
8-141554342-G-A p.Ala603Ala synonymous AGO2 13 82554 1.57473E-4 41277 0 6.25E-4
8-141554344-C-CG p.Ala603fs frameshift AGO2 2 82526 2.42348E-5 41263 0 1.5729E-4
8-141554345-G-T p.Pro602Pro synonymous AGO2 50 82586 6.05429E-4 41293 0 0.00453172
8-141554345-G-C p.Pro602Pro synonymous AGO2 2 82586 2.42172E-5 41293 0 3.51543E-5
8-141554345-G-A p.Pro602Pro synonymous AGO2 2 82586 2.42172E-5 41293 0 4.1423E-5
8-141554359-C-T p.Val598Ile missense AGO2 1 82484 1.21236E-5 41242 0 8.38701E-6
8-141554360-G-A p.Asp597Asp synonymous AGO2 1 82490 1.21227E-5 41245 0 3.18593E-5
8-141554369-C-T p.Leu594Leu synonymous AGO2 20 82460 2.42542E-4 41230 1 5.03525E-4
8-141554380-C-G p.Val591Leu missense AGO2 1 82392 1.21371E-5 41196 0 NA
8-141554381-G-A p.Pro590Pro synonymous AGO2 2 82396 2.4273E-5 41198 0 NA
8-141554396-C-T p.Pro585Pro synonymous AGO2 5 82184 6.08391E-5 41092 0 0.001875
8-141554396-C-G p.Pro585Pro synonymous AGO2 1 82186 1.21675E-5 41093 0 NA
8-141554406-C-T c.1749-4G>A splice_region AGO2 125 81896 0.00152633 40948 0 0.00146359
8-141554408-G-A c.1749-6C>T splice_region AGO2 2 81914 2.44159E-5 40957 0 NA
8-141554410-G-C c.1749-8C>G splice_region AGO2 1 81896 1.22106E-5 40948 0 8.33167E-6
8-141557559-G-C c.1748+8C>G splice_region AGO2 1 81252 1.23074E-5 40626 0 NA
8-141557575-G-C p.Pro580Pro synonymous AGO2 1 81806 1.2224E-5 40903 0 NA
8-141557596-G-A p.Gly573Gly synonymous AGO2 2 82368 2.42813E-5 41184 0 6.37064E-5
8-141557608-G-C p.Val569Val synonymous AGO2 385 82546 0.00466407 41273 2 0.0108613
8-141557610-C-T p.Val569Ile missense AGO2 1 82578 1.21098E-5 41289 0 3.98184E-6
8-141557611-G-A p.Asn568Asn synonymous AGO2 1 82574 1.21103E-5 41287 0 NA
8-141557647-C-T p.Thr556Thr synonymous AGO2 5 82512 6.05972E-5 41256 0 3.98238E-5
8-141557662-G-A p.Asn551Asn synonymous AGO2 7 82512 8.48361E-5 41256 0 1.40586E-4
8-141557676-C-T p.Val547Met missense AGO2 2 82332 2.42919E-5 41166 0 NA
8-141557677-G-A p.Cys546Cys synonymous AGO2 1 82298 1.2151E-5 41149 0 3.18471E-5
8-141557683-C-T p.Thr544Thr synonymous AGO2 3 82120 3.65319E-5 41060 0 5.98755E-5
8-141557713-G-A p.Arg534Arg synonymous AGO2 1 80654 1.23986E-5 40327 0 6.37064E-5
8-141557725-G-A p.Ala530Ala splice_region+synonymous AGO2 3 79280 3.78406E-5 39640 0 1.3527E-4
8-141557730-A-C c.1589-4T>G splice_region AGO2 15 78674 1.9066E-4 39337 0 0.00125
8-141559214-G-A p.Tyr529Tyr splice_region+synonymous AGO2 2 81624 2.45026E-5 40812 0 3.18492E-5
8-141559220-G-A p.Pro527Pro synonymous AGO2 8 81518 9.81378E-5 40759 0 1.91095E-4
8-141559223-C-T p.Thr526Thr synonymous AGO2 1 81458 1.22763E-5 40729 0 8.68946E-6
8-141559232-G-A p.Pro523Pro synonymous AGO2 19 81510 2.331E-4 40755 0 6.26566E-4
8-141559262-C-T p.Ala513Ala synonymous AGO2 11 81458 1.35039E-4 40729 0 7.19902E-5
8-141559268-C-T p.Thr511Thr synonymous AGO2 416 81504 0.00510404 40752 5 0.0115953
8-141559295-C-A p.Glu502Asp missense AGO2 1 81906 1.22091E-5 40953 0 NA
8-141559307-C-T p.Ala498Ala synonymous AGO2 7 82008 8.53575E-5 41004 0 0.00125
8-141559334-C-T p.Pro489Pro synonymous AGO2 23 82200 2.79805E-4 41100 0 6.25E-4
8-141559344-T-G p.Gln486Pro missense AGO2 1 82198 1.21657E-5 41099 0 NA
8-141559358-G-A p.Ala481Ala synonymous AGO2 31745 81108 0.391392 40554 6273 0.426864
8-141559361-G-A p.Asp480Asp synonymous AGO2 3 82160 3.65141E-5 41080 0 6.7891E-5
8-141559367-C-T p.Ser478Ser synonymous AGO2 9 82102 1.0962E-4 41051 0 6.01979E-5
8-141559394-G-T p.Ser469Ser synonymous AGO2 1 81762 1.22306E-5 40881 0 3.52734E-5
8-141559404-G-A c.1404-7C>T splice_region AGO2 1 81332 1.22953E-5 40666 0 8.94055E-6
8-141561393-GG-CA c.1403+8_1403+9delCCinsTG splice_region AGO2 1 81380 1.2288E-5 40690 0 NA
8-141561394-G-A c.1403+8C>T splice_region AGO2 1 81356 1.22917E-5 40678 0 3.58339E-5
8-141561406-G-A p.Leu467Leu synonymous AGO2 12 81370 1.47474E-4 40685 0 4.4607E-5
8-141561417-G-A p.Thr463Met missense AGO2 4 82044 4.87543E-5 41022 0 NA
8-141561437-G-A p.Phe456Phe synonymous AGO2 7 82566 8.47807E-5 41283 0 8.34885E-5
8-141561443-C-T p.Ala454Ala synonymous AGO2 2 82714 2.41797E-5 41357 0 1.65756E-5
8-141561457-C-T p.Val450Met missense AGO2 2 82952 2.41103E-5 41476 0 NA
8-141561467-G-A p.Ile446Ile synonymous AGO2 8 83020 9.63623E-5 41510 0 2.22845E-4
8-141561506-G-A p.Gly433Gly synonymous AGO2 3 82910 3.61838E-5 41455 0 8.37605E-6
8-141561521-C-T p.Ala428Ala synonymous AGO2 1 82622 1.21033E-5 41311 0 3.1839E-5
8-141565988-C-T c.1269+7G>A splice_region AGO2 1 82950 1.20555E-5 41475 0 NA
8-141565991-G-A c.1269+4C>T splice_region AGO2 150 82984 0.00180758 41492 0 0.00196448
8-141565999-C-T p.Gly422Asp missense AGO2 2 83102 2.40668E-5 41551 0 3.18552E-5
8-141566003-C-T p.Gly421Arg missense AGO2 1 83120 1.20308E-5 41560 0 NA
8-141566019-C-T p.Pro415Pro synonymous AGO2 98 83210 0.00117774 41605 0 0.00453172
8-141566081-G-A p.Arg395Cys missense AGO2 1 83356 1.19967E-5 41678 0 3.18573E-5
8-141566085-G-A p.Tyr393Tyr synonymous AGO2 1 83350 1.19976E-5 41675 0 3.18593E-5
8-141566105-T-G p.Ser387Arg missense AGO2 3 83350 3.59928E-5 41675 0 6.37105E-5
8-141566117-TCTGGCAAAGGGAAACAAGAAAACGCACGGAGTGGGTGGAGGCCTCCCATCTCTCTAGCAGCTGCGTCCGTTCCAAGCATCAGAGGTTTCTGTGCCAGGGCAACCGGACTGGATTCCACAGGGCAGCCCTGCCCGGGACTGACACTCAC-T c.1146+1_1147-1del splice_acceptor AGO2 2 83320 2.40038E-5 41660 1 NA
8-141566118-C-CAATT c.1147-2_1147-1insAATT splice_acceptor AGO2 2 83310 2.40067E-5 41655 1 NA
8-141566275-A-T p.Ile379Ile synonymous AGO2 1 83328 1.20008E-5 41664 0 NA
8-141566284-T-A p.Gln376His missense AGO2 1 83348 1.19979E-5 41674 0 NA
8-141566284-T-C p.Gln376Gln synonymous AGO2 1 83346 1.19982E-5 41673 0 NA
8-141566293-G-T p.Pro373Pro synonymous AGO2 1 83344 1.19985E-5 41672 0 6.36821E-5
8-141566293-G-A p.Pro373Pro synonymous AGO2 2 83344 2.39969E-5 41672 0 7.15763E-5
8-141566296-C-T p.Ala372Ala synonymous AGO2 2 83334 2.39998E-5 41667 0 3.97643E-6
8-141566297-G-A p.Ala372Val missense AGO2 1 83338 1.19993E-5 41669 0 NA
8-141566299-C-T p.Ser371Ser synonymous AGO2 22 83342 2.63973E-4 41671 0 3.1839E-4
8-141566311-C-T p.Ala367Ala synonymous AGO2 30880 83146 0.371395 41573 5946 0.421718
8-141566319-T-A p.Ile365Phe missense AGO2 1 83338 1.19993E-5 41669 0 NA
8-141566341-C-T p.Thr357Thr synonymous AGO2 3 83304 3.60127E-5 41652 0 2.38607E-5
8-141566342-G-A p.Thr357Met missense AGO2 1 83294 1.20057E-5 41647 0 NA
8-141566353-A-G p.Ile353Ile synonymous AGO2 1 83272 1.20088E-5 41636 0 8.24565E-6
8-141566387-T-TCCAGGGGAAGGTAG c.1027-3_1027-2insCTACCTTCCCCTGG splice_region AGO2 1 83068 1.20383E-5 41534 0 NA
8-141567203-G-A p.Thr337Thr synonymous AGO2 1 83272 1.20088E-5 41636 0 NA
8-141567215-C-T p.Glu333Glu synonymous AGO2 3 83296 3.60161E-5 41648 0 1.65772E-5
8-141567258-A-T p.Val319Asp missense AGO2 1 83308 1.20036E-5 41654 0 NA
8-141567262-A-G p.Leu318Leu synonymous AGO2 2 83310 2.40067E-5 41655 0 7.9552E-6
8-141567275-C-G p.Lys313Asn missense AGO2 1 83302 1.20045E-5 41651 0 NA
8-141567293-C-T p.Thr307Thr synonymous AGO2 7 83206 8.41286E-5 41603 0 1.19373E-4
8-141567306-G-A p.Thr303Met missense AGO2 1 83172 1.20233E-5 41586 0 NA
8-141567314-G-A p.Ser300Ser synonymous AGO2 2 83082 2.40726E-5 41541 0 0.0015121
8-141567323-C-T p.Gln297Gln synonymous AGO2 1 83080 1.20366E-5 41540 0 NA
8-141567329-C-T p.Pro295Pro synonymous AGO2 3 83008 3.61411E-5 41504 0 3.35475E-5
8-141568576-C-T c.878+8G>A splice_region AGO2 2 83176 2.40454E-5 41588 0 2.38675E-5
8-141568586-T-C p.Gln292Gln splice_region+synonymous AGO2 1 83250 1.2012E-5 41625 0 5.03525E-4
8-141568589-G-A p.His291His synonymous AGO2 1 83256 1.20111E-5 41628 0 1.1931E-5
8-141568598-G-A p.Pro288Pro synonymous AGO2 6 83268 7.20565E-5 41634 0 1.15418E-4
8-141568622-G-A p.Arg280Arg synonymous AGO2 46944 82562 0.568591 41281 13705 0.605529
8-141568623-C-T p.Arg280His missense AGO2 1 83292 1.2006E-5 41646 0 NA
8-141568644-C-G p.Gly273Ala missense AGO2 1 83272 1.20088E-5 41636 0 NA
8-141568652-C-T p.Thr270Thr synonymous AGO2 1 83264 1.201E-5 41632 0 8.2371E-6
8-141568653-G-A p.Thr270Met missense AGO2 1 83264 1.201E-5 41632 0 NA
8-141568664-C-T p.Lys266Lys synonymous AGO2 2 83258 2.40217E-5 41629 0 1.64742E-5
8-141569560-TTTTAAAATCCAAAACTTCACA-T p.Cys235_Lys241del conservative_inframe_deletion AGO2 1 83414 1.19884E-5 41707 0 NA
8-141569591-G-A p.Ile231Ile synonymous AGO2 2 83410 2.39779E-5 41705 0 6.25E-4
8-141569606-C-T p.Lys226Lys synonymous AGO2 1 83388 1.19921E-5 41694 0 3.18471E-5
8-141569607-T-C p.Lys226Arg missense AGO2 2 83388 2.39843E-5 41694 0 8.24429E-6
8-141569609-G-A p.Tyr225Tyr synonymous AGO2 2 83386 2.39848E-5 41693 0 3.1841E-5
8-141569615-C-T p.Ala223Ala synonymous AGO2 1 83376 1.19939E-5 41688 0 3.18431E-5
8-141569633-A-G c.656-5T>C splice_region AGO2 1 83242 1.20132E-5 41621 0 NA
8-141570466-T-C c.655+7A>G splice_region AGO2 1 82926 1.20589E-5 41463 0 NA
8-141570474-A-G p.Asp218Asp splice_region+synonymous AGO2 1 83082 1.20363E-5 41541 0 6.25E-4
8-141570498-G-A p.Leu210Leu synonymous AGO2 5 83200 6.00962E-5 41600 0 3.97763E-6
8-141570500-G-A p.Leu210Phe missense AGO2 1 83204 1.20187E-5 41602 0 NA
8-141570507-C-T p.Arg207Arg synonymous AGO2 1 83214 1.20172E-5 41607 0 9.55597E-5
8-141570512-C-T p.Val206Ile missense AGO2 1 83218 1.20166E-5 41609 0 NA
8-141570513-G-T p.Ser205Ser synonymous AGO2 174 83212 0.00209104 41606 1 0.00627428
8-141570513-G-A p.Ser205Ser synonymous AGO2 1 83216 1.20169E-5 41608 0 3.29658E-5
8-141570516-C-T p.Gln204Gln synonymous AGO2 1 83228 1.20152E-5 41614 0 7.95418E-6
8-141570549-G-A p.Gly193Gly synonymous AGO2 3 83204 3.6056E-5 41602 0 9.55292E-5
8-141570558-G-C p.Asn190Lys missense AGO2 1 83188 1.2021E-5 41594 0 NA
8-141570568-C-G p.Gly187Ala missense AGO2 2 83162 2.40494E-5 41581 0 NA
8-141570573-G-A p.Ser185Ser synonymous AGO2 5 83108 6.01627E-5 41554 0 6.37064E-5
8-141570576-C-T p.Ala184Ala synonymous AGO2 63 83064 7.58451E-4 41532 0 0.005625
8-141570578-C-T p.Ala184Thr missense AGO2 2 83002 2.40958E-5 41501 0 NA
8-141570588-G-A p.Ser180Ser synonymous AGO2 2 82880 2.41313E-5 41440 0 6.36983E-5
8-141570600-G-A p.Pro176Pro synonymous AGO2 1 82604 1.2106E-5 41302 0 2.49406E-5
8-141570611-T-TCATGGATGGCAAGTGCCTCATGACCACGTCCA c.519-3_519-2insTGGACGTGGTCATGAGGCACTTGCCATCCATG splice_region AGO2 1 82342 1.21445E-5 41171 0 NA
8-141572544-G-A c.518+8C>T splice_region AGO2 2 82574 2.42207E-5 41287 0 0.00125156
8-141572546-C-T c.518+6G>A splice_region AGO2 1 82676 1.20954E-5 41338 0 NA
8-141572556-TG-T p.Met172fs frameshift AGO2 1 82844 1.20709E-5 41422 0 NA
8-141572581-G-A p.Asp163Asp synonymous AGO2 5 82998 6.02424E-5 41499 0 7.44713E-5
8-141572584-C-T p.Leu162Leu synonymous AGO2 1 83038 1.20427E-5 41519 0 5.03525E-4
8-141572596-C-T p.Thr158Thr synonymous AGO2 3 83076 3.61115E-5 41538 0 6.37105E-5
8-141572596-C-G p.Thr158Thr synonymous AGO2 1 83076 1.20372E-5 41538 0 NA
8-141572597-G-A p.Thr158Met missense AGO2 1 83072 1.20378E-5 41536 0 1.65153E-5
8-141572611-G-A p.Ser153Ser synonymous AGO2 7 83062 8.42744E-5 41531 0 1.27405E-4
8-141572622-G-A p.Arg150Trp missense AGO2 1 83054 1.20404E-5 41527 0 8.24974E-6
8-141572626-T-A p.Ser148Ser synonymous AGO2 9 83086 1.08321E-4 41543 0 1.27405E-4
8-141572638-G-A p.His144His synonymous AGO2 74 83058 8.90944E-4 41529 0 0.0020141
8-141572645-G-A p.Ala142Val missense AGO2 1 83030 1.20438E-5 41515 0 3.18253E-5
8-141572646-C-T p.Ala142Thr missense AGO2 1 83026 1.20444E-5 41513 0 8.24769E-6
8-141572659-G-A p.Ala73Val missense AGO2 2 82980 2.41022E-5 41490 0 4.12432E-5
8-141572669-C-G p.Trp134Ser missense AGO2 1 82974 1.2052E-5 41487 0 NA
8-141572680-C-T p.Cys66Tyr missense AGO2 1 82926 1.20589E-5 41463 0 3.97874E-6
8-141572735-TGC-T c.337-4_337-3delGC splice_region AGO2 1 81862 1.22157E-5 40931 0 NA
8-141572735-T-TTGTCCCTCCCAATCGGAAGGGGCATGGCTGTGTATAGATTCTTCCTGCC c.337-3_337-2insGGCAGGAAGAATCTATACACAGCCATGCCCCTTCCGATTGGGAGGGACA splice_region AGO2 2 81860 2.4432E-5 40930 1 NA
8-141572736-G-A c.337-3C>T splice_region AGO2 2 81784 2.44547E-5 40892 0 NA
8-141572737-C-T c.337-4G>A splice_region AGO2 8 81654 9.79744E-5 40827 0 3.99971E-6
8-141572737-C-A c.337-4G>T splice_region AGO2 1 81656 1.22465E-5 40828 0 NA
8-141572738-G-A c.337-5C>T splice_region AGO2 2 81640 2.44978E-5 40820 0 6.40082E-5
8-141572740-G-A c.337-7C>T splice_region AGO2 3 81556 3.67845E-5 40778 0 9.55414E-5
8-141582658-T-TAA n.419_420dupTT splice_region AGO2 2 34362 5.82038E-5 17181 0 NA
8-141582699-GGACCTA-G n.377-3_379delTAGGTC splice_acceptor AGO2 2 52570 3.80445E-5 26285 0 NA
8-141582903-G-A c.336+8C>T splice_region AGO2 2 83264 2.402E-5 41632 0 1.59418E-4
8-141582926-C-T p.Arg43Gln missense AGO2 16 83352 1.91957E-4 41676 0 6.4082E-5
8-141582932-G-A p.Pro41Leu missense AGO2 1 83378 1.19936E-5 41689 0 NA
8-141582935-C-T p.Met104Ile missense AGO2 1 83382 1.1993E-5 41691 0 8.24022E-6
8-141582939-G-A p.Ala103Val missense AGO2 1 83386 1.19924E-5 41693 0 NA
8-141582947-T-C p.Tyr36Cys missense AGO2 6 83380 7.19597E-5 41690 0 2.54923E-4
8-141582961-C-T p.Gly96Ser missense AGO2 1 83396 1.1991E-5 41698 0 NA
8-141582962-G-A p.Thr31Met missense AGO2 14 83392 1.67882E-4 41696 0 6.25E-4
8-141582971-G-A p.Pro28Leu missense AGO2 4 83398 4.79628E-5 41699 0 9.55597E-5
8-141582971-G-C p.Pro28Arg missense AGO2 2 83398 2.39814E-5 41699 0 1.56533E-4
8-141582978-C-T p.Arg90Gln missense AGO2 2 83402 2.39802E-5 41701 0 1.1932E-5
8-141582980-A-T p.Asp89Glu missense AGO2 1 83406 1.19895E-5 41703 0 NA
8-141582984-C-A p.Gly88Val missense AGO2 1 83410 1.1989E-5 41705 0 3.18573E-4
8-141582989-G-T p.Ser22Tyr missense AGO2 1 83406 1.19895E-5 41703 0 8.23954E-6
8-141582989-G-A p.Ser22Phe missense AGO2 1 83406 1.19895E-5 41703 0 3.18593E-5
8-141595211-G-A c.215+7C>T splice_region AGO2 5 83354 5.99851E-5 41677 0 6.36983E-5
8-141595232-C-T p.Pro67Pro synonymous AGO2 1 83404 1.19898E-5 41702 0 6.25E-4
8-141595252-T-C p.Ile61Val missense AGO2 2 83420 2.39751E-5 41710 0 3.1839E-5
8-141595257-A-G p.Leu59Ser missense AGO2 1 83418 1.19878E-5 41709 0 NA
8-141595273-T-C p.Ile54Val missense AGO2 1 83412 1.19887E-5 41706 0 NA
8-141595281-T-C p.Lys51Arg missense AGO2 1 83420 1.19875E-5 41710 0 3.97646E-6
8-141595283-G-C p.Pro50Pro synonymous AGO2 1 83420 1.19875E-5 41710 0 3.18573E-5
8-141595291-C-T p.Asp48Asn missense AGO2 1 83422 1.19872E-5 41711 0 NA
8-141595297-C-T p.Glu46Lys missense AGO2 2 83416 2.39762E-5 41708 0 NA
8-141595298-G-A c.-4C>T 5_prime_UTR_premature_start_codon_gain AGO2 6 83416 7.19286E-5 41708 0 6.05057E-4
8-141595331-G-A c.-37C>T 5_prime_UTR_premature_start_codon_gain AGO2 13 83410 1.55857E-4 41705 0 0.00251762
8-141595335-G-C p.Thr33Ser missense AGO2 1 83412 1.19887E-5 41706 0 NA
8-141595345-C-T p.Asp30Asn missense AGO2 2 83414 2.39768E-5 41707 0 6.37064E-5
8-141595346-G-A c.-52C>T 5_prime_UTR_premature_start_codon_gain AGO2 14 83414 1.67838E-4 41707 0 0.00125
8-141595352-A-C p.Pro27Pro synonymous AGO2 1 83414 1.19884E-5 41707 0 1.98853E-5
8-141595353-G-A p.Pro27Leu missense AGO2 2 83412 2.39774E-5 41706 0 NA
8-141595357-G-A p.Pro26Ser missense AGO2 1 83412 1.19887E-5 41706 0 NA
8-141595364-G-GA p.Lys24fs frameshift AGO2 1 83404 1.19898E-5 41702 0 NA
8-141595365-A-C p.Phe23Cys missense AGO2 2 83398 2.39814E-5 41699 0 NA
8-141595376-T-C p.Gln19Gln synonymous AGO2 1 83392 1.19916E-5 41696 0 8.24457E-6
8-141595382-G-A p.Pro17Pro synonymous AGO2 2 83386 2.39848E-5 41693 0 2.78769E-5
8-141595382-G-C p.Pro17Pro synonymous AGO2 5 83386 5.99621E-5 41693 0 5.03525E-4
8-141595389-G-A p.Pro15Leu missense AGO2 3 83370 3.59842E-5 41685 0 5.78245E-5
8-141595391-C-T p.Pro14Pro synonymous AGO2 1 83356 1.19967E-5 41678 0 7.57177E-5
8-141595392-G-A p.Pro14Leu missense AGO2 2 83354 2.3994E-5 41677 0 9.55414E-5
8-141595395-G-A p.Ala13Val missense AGO2 1 83336 1.19996E-5 41668 0 6.25E-4
8-141595397-A-C p.Pro12Pro synonymous AGO2 2 83338 2.39987E-5 41669 0 NA
8-141595402-G-A p.Pro11Ser missense AGO2 1 83322 1.20016E-5 41661 0 3.18471E-5
8-141595409-T-TGCGGGGCCG p.Ala8_Leu9insGlyProAla disruptive_inframe_insertion AGO2 2 83292 2.40119E-5 41646 0 NA
8-141595411-C-CGGGGCCGGCTCCCGAGTACA c.23-2_23-1insTGTACTCGGGAGCCGGCCCC splice_acceptor AGO2 1 83292 1.2006E-5 41646 0 NA
8-141595414-G-A c.23-4C>T splice_region AGO2 6 83256 7.20669E-5 41628 0 1.99599E-5
8-141595418-G-A c.23-8C>T splice_region AGO2 1 83240 1.20135E-5 41620 0 8.34571E-6