Variant

Variant ID Consequence Effect Gene AC AN AF NS NHOM maxEAF
1-100315979-C-T c.-69+8C>T splice_region AGL 1 2884 3.46741E-4 1442 0 3.18573E-5
1-100316262-T-G c.-261T>G 5_prime_UTR_premature_start_codon_gain AGL 4 18102 2.2097E-4 9051 0 3.1837E-5
1-100316344-C-T c.-179C>T 5_prime_UTR_premature_start_codon_gain AGL 1 43472 2.30033E-5 21736 0 NA
1-100316453-A-G c.-70A>G splice_region AGL 1 70426 1.41993E-5 35213 0 NA
1-100316455-G-C c.-69+1G>C splice_donor AGL 2 70882 2.82159E-5 35441 0 NA
1-100316455-G-T c.-69+1G>T splice_donor AGL 1 70882 1.4108E-5 35441 0 NA
1-100316455-G-GT c.-69+1_-69+2insT splice_donor AGL 3 70882 4.23239E-5 35441 0 NA
1-100316589-A-G c.-8-2A>G splice_acceptor AGL 36043 82064 0.439206 41032 8145 0.469372
1-100316602-G-A p.Gly2Arg missense AGL 1 83280 1.20077E-5 41640 0 3.97738E-6
1-100316609-G-A p.Ser4Asn missense AGL 5 83292 6.00298E-5 41646 0 7.95425E-6
1-100316614-CAG-C p.Gln6fs frameshift AGL 8 83302 9.60361E-5 41651 0 4.94413E-5
1-100316620-C-T p.Arg8* stop_gained AGL 1 83306 1.20039E-5 41653 0 NA
1-100316628-A-T p.Leu10Phe missense AGL 2 83308 2.40073E-5 41654 0 3.18492E-5
1-100316637-C-T c.-153C>T 5_prime_UTR_premature_start_codon_gain AGL 79 83312 9.48243E-4 41656 1 0.005625
1-100316638-G-A p.Glu14Lys missense AGL 1 83314 1.20028E-5 41657 0 1.64796E-5
1-100316648-A-G p.Lys17Arg missense AGL 1 83314 1.20028E-5 41657 0 NA
1-100316663-T-G p.Leu22Arg missense AGL 2 83292 2.40119E-5 41646 0 NA
1-100316664-C-T p.Leu22Leu synonymous AGL 3 83296 3.60161E-5 41648 0 NA
1-100316673-T-G c.-117T>G 5_prime_UTR_premature_start_codon_gain AGL 2 83280 2.40154E-5 41640 0 2.47255E-5
1-100316676-A-G p.Glu26Glu synonymous AGL 4 83278 4.80319E-5 41639 0 3.18431E-5
1-100316684-A-C c.82+4A>C splice_region AGL 37 83254 4.44423E-4 41627 0 2.78412E-4
1-100318110-TTTG-T c.-109-6_-109-4delTTG splice_region AGL 1 32190 3.10655E-5 16095 0 NA
1-100318111-TTG-T c.-109-5_-109-4delTG splice_region AGL 1 32430 3.08356E-5 16215 0 NA
1-100318112-TG-T c.-109-4delG splice_region AGL 5 31048 1.61041E-4 15524 0 NA
1-100318113-G-T c.-109-4G>T splice_region AGL 94 15732 0.00597508 7866 0 0.0457868
1-100318113-GTA-TTT c.-109-4_-109-2delGTAinsTTT splice_acceptor AGL 10 16066 6.22432E-4 8033 0 NA
1-100318114-T-TTTTAA c.-109-3_-109-2insTTTAA splice_acceptor AGL 1 19996 5.001E-5 9998 0 NA
1-100318114-T-TTA c.-109-3_-109-2insTA splice_acceptor AGL 1 19996 5.001E-5 9998 0 NA
1-100318115-A-T c.-109-2A>T splice_acceptor AGL 26 18204 0.00142826 9102 0 0.00312288
1-100318116-G-A c.-109-1G>A splice_acceptor AGL 19 22452 8.4625E-4 11226 0 NA
1-100318116-G-T c.-109-1G>T splice_acceptor AGL 2 22476 8.89838E-5 11238 0 3.25794E-4
1-100318120-C-A c.-106C>A 5_prime_UTR_premature_start_codon_gain AGL 1 29376 3.40414E-5 14688 0 NA
1-100318132-A-G c.-94A>G 5_prime_UTR_premature_start_codon_gain AGL 1 39664 2.52118E-5 19832 0 NA
1-100318221-C-T c.-5C>T 5_prime_UTR_premature_start_codon_gain AGL 4 55774 7.1718E-5 27887 0 1.03859E-4
1-100318245-T-G p.Ile7Ser missense AGL 963 55962 0.0172081 27981 10 0.0435233
1-100318255-T-C p.Phe10Phe synonymous AGL 1 56032 1.78469E-5 28016 0 4.02687E-6
1-100318262-G-A c.34+3G>A splice_region AGL 1 56054 1.78399E-5 28027 0 4.02606E-6
1-100326796-A-G c.-232A>G 5_prime_UTR_premature_start_codon_gain AGL 28 63608 4.40196E-4 31804 0 9.55536E-5
1-100326891-C-G c.-137C>G 5_prime_UTR_premature_start_codon_gain AGL 1 77756 1.28607E-5 38878 0 NA
1-100326966-C-G c.-62C>G 5_prime_UTR_premature_start_codon_gain AGL 1570 82376 0.0190589 41188 25 0.0202651
1-100327025-A-G c.-3A>G 5_prime_UTR_premature_start_codon_gain AGL 20 83184 2.40431E-4 41592 0 7.00325E-4
1-100327026-C-T c.-2C>T 5_prime_UTR_premature_start_codon_gain AGL 17378 82850 0.209753 41425 1975 0.242178
1-100327029-T-G p.Met1? start_lost AGL 1 83200 1.20192E-5 41600 0 NA
1-100327036-A-C p.Leu3Phe missense AGL 1 83212 1.20175E-5 41606 0 NA
1-100327039-A-G p.Leu4Leu synonymous AGL 1 83218 1.20166E-5 41609 0 NA
1-100327060-G-A p.Gly28Gly splice_region+synonymous AGL 1 83222 1.20161E-5 41611 0 1.67258E-5
1-100327064-G-A p.Glu30Lys missense AGL 1 83226 1.20155E-5 41613 0 3.18451E-5
1-100327065-A-G p.Glu30Gly missense AGL 1 83226 1.20155E-5 41613 0 NA
1-100327069-A-G p.Leu31Leu synonymous AGL 1 83228 1.20152E-5 41614 0 2.38814E-5
1-100327070-C-T p.Gln32* stop_gained AGL 1 83226 1.20155E-5 41613 0 3.18512E-5
1-100327076-C-T p.Arg34* stop_gained AGL 1 83218 1.20166E-5 41609 0 2.78662E-5
1-100327077-G-A p.Arg34Gln missense AGL 1 83222 1.20161E-5 41611 0 6.25E-4
1-100327079-T-C p.Leu35Leu synonymous AGL 5 83218 6.00832E-5 41609 0 1.49373E-4
1-100327088-A-G p.Thr38Ala missense AGL 571 83222 0.00686117 41611 13 0.0143658
1-100327088-A-T p.Thr38Ser missense AGL 1 83224 1.20158E-5 41612 0 3.97931E-6
1-100327098-G-A p.Gly41Glu missense AGL 6 83214 7.21032E-5 41607 0 NA
1-100327105-A-G p.Ala43Ala synonymous AGL 1 83216 1.20169E-5 41608 0 1.1938E-5
1-100327111-C-T p.Thr45Thr synonymous AGL 1 83202 1.20189E-5 41601 0 8.26528E-6
1-100327112-G-T p.Val46Leu missense AGL 1 83204 1.20187E-5 41602 0 1.03482E-4
1-100327112-G-A p.Val46Met missense AGL 2 83204 2.40373E-5 41602 0 2.4795E-5
1-100327112-G-C p.Val46Leu missense AGL 1 83204 1.20187E-5 41602 0 9.55414E-5
1-100327116-A-G p.Tyr47Cys missense AGL 1 83222 1.20161E-5 41611 0 NA
1-100327121-A-G p.Asn49Asp missense AGL 1 83222 1.20161E-5 41611 0 3.30398E-5
1-100327136-G-A p.Gly54Arg missense AGL 3 83202 3.60568E-5 41601 0 8.26009E-6
1-100327150-T-C p.Asn58Asn synonymous AGL 1 83194 1.20201E-5 41597 0 6.37146E-5
1-100327153-A-G p.Arg59Arg synonymous AGL 2 83196 2.40396E-5 41598 0 NA
1-100327164-G-A p.Arg63His missense AGL 3 83190 3.6062E-5 41595 0 7.16469E-5
1-100327169-C-G p.Leu65Val missense AGL 5 83188 6.01048E-5 41594 0 8.25791E-6
1-100327183-T-C p.Asn69Asn synonymous AGL 1600 83174 0.0192368 41587 27 0.0448137
1-100327185-C-T p.Pro70Leu missense AGL 2 83202 2.40379E-5 41601 0 NA
1-100327188-CAG-C p.Glu72fs frameshift AGL 1 83202 1.20189E-5 41601 0 8.26009E-6
1-100327192-A-T p.Glu72Asp missense AGL 2 83208 2.40361E-5 41604 0 NA
1-100327197-AAG-A p.Asp75fs frameshift AGL 1 83200 1.20192E-5 41600 0 8.26078E-6
1-100327200-A-G p.Asp75Gly missense AGL 9 83200 1.08173E-4 41600 0 4.13025E-5
1-100327206-C-G p.Ser77Cys missense AGL 1 83206 1.20184E-5 41603 0 NA
1-100327217-T-C p.Cys81Arg missense AGL 1 83194 1.20201E-5 41597 0 1.15467E-4
1-100327224-T-G p.Leu83Arg missense AGL 1 83190 1.20207E-5 41595 0 8.26078E-6
1-100327228-T-TG p.Leu85fs frameshift AGL 1 83186 1.20213E-5 41593 0 NA
1-100327229-C-CTGTTT p.Gln86fs frameshift AGL 1 83174 1.2023E-5 41587 0 NA
1-100327232-C-T p.Gln86* stop_gained AGL 7 83174 8.41609E-5 41587 0 2.22987E-4
1-100327237-A-G p.Gln87Gln synonymous AGL 9 83172 1.08209E-4 41586 0 6.3674E-5
1-100327242-G-A p.Gly89Asp missense AGL 1 83176 1.20227E-5 41588 0 NA
1-100327272-A-G c.293+3A>G splice_region AGL 6 83084 7.22161E-5 41542 0 7.45132E-5
1-100327276-C-T c.293+7C>T splice_region AGL 1 83074 1.20375E-5 41537 0 NA
1-100327811-A-T c.294-2A>T splice_acceptor AGL 5 83318 6.0011E-5 41659 0 NA
1-100327813-A-G p.Gly98Gly splice_region+synonymous AGL 2 83326 2.40021E-5 41663 0 3.18857E-5
1-100327817-G-A p.Glu100Lys missense AGL 1 83336 1.19996E-5 41668 0 8.23669E-6
1-100327825-T-A p.Ser102Arg missense AGL 1 83342 1.19988E-5 41671 0 NA
1-100327830-G-T p.Gly104Val missense AGL 4 83348 4.79916E-5 41674 0 2.47093E-5
1-100327836-A-T p.Tyr106Phe missense AGL 3 83350 3.59928E-5 41675 0 3.18634E-5
1-100327837-C-T p.Tyr106Tyr synonymous AGL 1 83352 1.19973E-5 41676 0 7.95342E-6
1-100327842-T-C p.Val108Ala missense AGL 1 83358 1.19964E-5 41679 0 NA
1-100327844-G-T p.Val109Leu missense AGL 3 83362 3.59876E-5 41681 0 1.27248E-4
1-100327853-A-G p.Ile112Val missense AGL 63 83372 7.55649E-4 41686 0 0.00117894
1-100327860-G-A p.Arg114His missense AGL 1 83376 1.19939E-5 41688 0 1.27543E-4
1-100327863-T-C p.Val115Ala missense AGL 5 83380 5.99664E-5 41690 0 0.00100705
1-100327904-C-T p.Leu129Phe missense AGL 2 83388 2.39843E-5 41694 0 7.95298E-6
1-100327904-C-G p.Leu129Val missense AGL 2 83388 2.39843E-5 41694 0 1.64728E-5
1-100327912-A-G p.Thr131Thr synonymous AGL 2 83384 2.39854E-5 41692 0 1.19296E-5
1-100327916-T-G p.Leu133Val missense AGL 1 83388 1.19921E-5 41694 0 NA
1-100327924-G-C p.Lys135Asn missense AGL 1 83388 1.19921E-5 41694 0 NA
1-100327958-C-G p.Leu147Val missense AGL 1 83374 1.19941E-5 41687 0 NA
1-100327962-G-A p.Arg148Lys missense AGL 2 83372 2.39889E-5 41686 0 6.25E-4
1-100329938-G-A c.461-4G>A splice_region AGL 1 83212 1.20175E-5 41606 0 8.26419E-6
1-100329948-A-G p.Asn156Ser missense AGL 1 83224 1.20158E-5 41612 0 1.59148E-5
1-100329968-T-C p.Leu163Leu synonymous AGL 2 83260 2.40211E-5 41630 0 6.3678E-5
1-100329979-T-TG p.Leu168fs frameshift AGL 1 83260 1.20106E-5 41630 0 7.9552E-6
1-100329996-G-GCTA p.Tyr173dup disruptive_inframe_insertion AGL 1 83252 1.20117E-5 41626 0 3.97769E-6
1-100330028-C-A p.Pro183Thr missense AGL 1 83254 1.20114E-5 41627 0 NA
1-100330066-T-C p.Asn195Asn synonymous AGL 1 83240 1.20135E-5 41620 0 8.23913E-6
1-100330067-G-A p.Asp196Asn missense AGL 3 83236 3.60421E-5 41618 0 NA
1-100330076-C-T p.Gln199* stop_gained AGL 1 83228 1.20152E-5 41614 0 1.64799E-5
1-100330084-G-A p.Val201Val synonymous AGL 1 83192 1.20204E-5 41596 0 NA
1-100330086-A-T p.Glu202Val missense AGL 4 83190 4.80827E-5 41595 0 3.1839E-5
1-100330090-A-G p.Lys203Lys synonymous AGL 6 83180 7.21327E-5 41590 0 1.27323E-4
1-100330103-T-C p.Trp208Arg missense AGL 15 83152 1.80393E-4 41576 0 2.54793E-4
1-100330137-A-G p.Asn219Ser missense AGL 1 82966 1.20531E-5 41483 0 NA
1-100335977-A-G p.Gln229Arg missense AGL 2481 82868 0.0299392 41434 79 0.0416083
1-100335980-A-C p.Glu230Ala missense AGL 1 82972 1.20523E-5 41486 0 6.36902E-5
1-100335985-C-A p.Pro232Thr missense AGL 2 83022 2.409E-5 41511 0 NA
1-100336014-T-C p.Ser241Ser synonymous AGL 1 83138 1.20282E-5 41569 0 NA
1-100336016-C-T p.Pro242Leu missense AGL 2 83146 2.40541E-5 41573 0 NA
1-100336019-A-T p.His243Leu missense AGL 1 83144 1.20273E-5 41572 0 NA
1-100336027-C-G p.Pro246Ala missense AGL 5 83140 6.01395E-5 41570 0 3.29538E-5
1-100336032-C-G p.Ala247Ala synonymous AGL 2 83138 2.40564E-5 41569 0 NA
1-100336033-T-C p.Trp248Arg missense AGL 1 83138 1.20282E-5 41569 0 NA
1-100336040-TAGAC-T p.Asp251fs frameshift AGL 1 83144 1.20273E-5 41572 0 6.36983E-5
1-100336044-CAGAGCACTT-C p.Arg252_Leu254del conservative_inframe_deletion AGL 1 83152 1.20262E-5 41576 0 NA
1-100336057-C-T p.Arg256Cys missense AGL 7 83130 8.42055E-5 41565 0 8.75406E-5
1-100336058-G-A p.Arg256His missense AGL 4 83126 4.81197E-5 41563 0 6.37105E-5
1-100336092-A-G p.Lys267Lys synonymous AGL 1 83070 1.2038E-5 41535 0 1.64837E-5
1-100336100-G-A p.Gly270Glu missense AGL 1 83010 1.20467E-5 41505 0 3.98064E-6
1-100336124-A-G p.Asp278Gly missense AGL 2 82904 2.41243E-5 41452 0 5.03525E-4
1-100336130-A-G p.His280Arg missense AGL 2 82920 2.41196E-5 41460 0 8.26706E-6
1-100336132-A-G p.Met281Val missense AGL 2 82922 2.41191E-5 41461 0 2.38966E-5
1-100336145-T-A c.846+8T>A splice_region AGL 5 82916 6.0302E-5 41458 0 6.37826E-5
1-100336306-T-C c.847-8T>C splice_region AGL 1 82846 1.20706E-5 41423 0 9.10531E-6
1-100336307-T-A c.847-7T>A splice_region AGL 9 82848 1.08633E-4 41424 0 6.30517E-4
1-100336321-G-A p.Arg285Gln missense AGL 19 83020 2.28861E-4 41510 0 2.72512E-4
1-100336326-ATAAT-A p.Ile288fs frameshift AGL 2 83054 2.40807E-5 41527 0 NA
1-100336347-C-T p.Pro294Ser missense AGL 2 83148 2.40535E-5 41574 0 3.18918E-5
1-100336352-G-C p.Lys295Asn missense AGL 3 83170 3.60707E-5 41585 0 1.67946E-5
1-100336354-T-G p.Leu296Arg missense AGL 6 83176 7.21362E-5 41588 0 2.0141E-4
1-100336361-C-T p.Leu298Leu synonymous AGL 60157 82786 0.726657 41393 22108 0.755886
1-100336362-T-G p.Trp299Gly missense AGL 1 83204 1.20187E-5 41602 0 8.00384E-6
1-100336373-C-T p.Phe302Phe synonymous AGL 9 83198 1.08176E-4 41599 0 NA
1-100336388-C-T p.Asn307Asn synonymous AGL 2 83170 2.40471E-5 41585 0 8.00058E-6
1-100336394-G-A p.Ala309Ala synonymous AGL 4 83146 4.81081E-5 41573 0 6.3743E-5
1-100336403-A-G p.Gln312Gln synonymous AGL 1 83094 1.20346E-5 41547 0 NA
1-100336423-A-G p.Gln319Arg missense+splice_region AGL 2 82934 2.41156E-5 41467 0 NA
1-100336426-G-A c.958+1G>A splice_donor AGL 4 82910 4.82451E-5 41455 0 NA
1-100336430-A-C c.958+5A>C splice_region AGL 1 82814 1.20753E-5 41407 0 NA
1-100336432-G-A c.958+7G>A splice_region AGL 1 82816 1.2075E-5 41408 0 NA
1-100340225-G-GTCTTTTCTTTCTTTTAGAAAATAGTGACAGTTTTAATCTCTTTGTAGATATTTGCATTTAAGGTATCA p.Arg322fs frameshift AGL 2 82846 2.41412E-5 41423 1 8.69429E-6
1-100340239-T-C c.959-4T>C splice_region AGL 1 82940 1.20569E-5 41470 0 3.18634E-5
1-100340240-T-A c.959-3T>A splice_region AGL 2 82950 2.41109E-5 41475 0 1.69872E-5
1-100340250-G-A p.Arg322Arg synonymous AGL 1 82970 1.20525E-5 41485 0 6.25E-4
1-100340252-G-A p.Arg323Gln missense AGL 40 82944 4.82253E-4 41472 0 0.00151057
1-100340280-C-A p.His332Gln missense AGL 1 83064 1.20389E-5 41532 0 1.1941E-5
1-100340286-G-A p.Thr334Thr synonymous AGL 2 83066 2.40772E-5 41533 0 3.31241E-5
1-100340294-A-C p.Gln337Pro missense AGL 4 83074 4.81498E-5 41537 0 NA
1-100340294-A-G p.Gln337Arg missense AGL 1 83074 1.20375E-5 41537 0 NA
1-100340300-C-G p.Pro339Arg missense AGL 1 83076 1.20372E-5 41538 0 NA
1-100340312-G-A p.Arg343Gln missense AGL 53 83080 6.37939E-4 41540 0 7.33465E-4
1-100340321-G-A p.Cys346Tyr missense AGL 2 83078 2.40738E-5 41539 0 3.97918E-6
1-100340323-A-G p.Thr347Ala missense AGL 4 83074 4.81498E-5 41537 0 2.47468E-5
1-100340326-G-A p.Val348Ile missense AGL 5 83074 6.01873E-5 41537 0 6.25E-4
1-100340333-T-C p.Met350Thr missense AGL 3 83056 3.61202E-5 41528 0 3.58141E-5
1-100340334-G-A p.Met350Ile missense AGL 3 83062 3.61176E-5 41531 0 3.18593E-5
1-100340344-CT-C p.Leu354fs frameshift AGL 1 83020 1.20453E-5 41510 0 NA
1-100340346-A-G p.Leu354Leu synonymous AGL 1 82994 1.20491E-5 41497 0 NA
1-100340348-C-T p.Thr355Met missense AGL 3 82968 3.61585E-5 41484 0 6.25E-4
1-100340348-C-A p.Thr355Lys missense AGL 1 82968 1.20528E-5 41484 0 NA
1-100340349-G-A p.Thr355Thr synonymous AGL 4 82980 4.82044E-5 41490 0 1.07469E-4
1-100340356-A-G p.Ile358Val missense AGL 1 82954 1.20549E-5 41477 0 NA
1-100340357-T-TACC p.Pro359dup disruptive_inframe_insertion AGL 2 82944 2.41127E-5 41472 0 3.1841E-5
1-100340360-C-T p.Pro359Leu missense AGL 9 82946 1.08504E-4 41473 0 9.90295E-5
1-100340362-C-T p.His360Tyr missense AGL 2 82954 2.41097E-5 41477 0 5.03525E-4
1-100340363-A-G p.His360Arg missense AGL 1 82950 1.20555E-5 41475 0 NA
1-100340704-C-T c.1083-6C>T splice_region AGL 3 82634 3.63047E-5 41317 0 6.25E-4
1-100340705-T-C c.1083-5T>C splice_region AGL 1 82646 1.20998E-5 41323 0 8.79709E-6
1-100340706-C-G c.1083-4C>G splice_region AGL 1 82668 1.20966E-5 41334 0 8.76885E-6
1-100340755-A-G p.Lys376Lys synonymous AGL 1 83120 1.20308E-5 41560 0 NA
1-100340758-A-T p.Arg377Ser missense AGL 1 83134 1.20288E-5 41567 0 NA
1-100340782-G-T p.Lys385Asn missense AGL 1332 83146 0.01602 41573 22 0.0427996
1-100340787-G-A p.Arg387Gln missense AGL 1452 83148 0.0174628 41574 88 0.0524413
1-100340788-A-G p.Arg387Arg synonymous AGL 1 83180 1.20221E-5 41590 0 3.98886E-6
1-100340792-A-T p.Ile389Phe missense AGL 2 83186 2.40425E-5 41593 0 3.1841E-5
1-100340793-T-A p.Ile389Asn missense AGL 2 83190 2.40414E-5 41595 0 NA
1-100340799-A-G p.Tyr391Cys missense AGL 3 83194 3.60603E-5 41597 0 1.65945E-5
1-100340804-C-A p.Gln393Lys missense AGL 1 83192 1.20204E-5 41596 0 NA
1-100340809-ACAGGTTTTACTTATTTTTGAACTGCTGCTTTTCCTTGCATCTTACTACTATTTTTTTGTTGTCTTGAGGATGGTGATGATCTAACACAATTTAATGTTTTT-A p.Gln395del splice_donor AGL 1 83194 1.20201E-5 41597 0 NA
1-100340813-G-T c.1185+1G>T splice_donor AGL 1 83208 1.20181E-5 41604 0 NA
1-100340820-T-C c.1185+8T>C splice_region AGL 16 83224 1.92252E-4 41612 0 6.25E-4
1-100340921-A-T p.Asn398Ile missense AGL 1 83296 1.20054E-5 41648 0 NA
1-100340924-G-A p.Cys399Tyr missense AGL 2 83292 2.40119E-5 41646 0 7.95577E-6
1-100340925-C-T p.Cys399Cys synonymous AGL 2 83298 2.40102E-5 41649 0 NA
1-100340937-T-C p.Asn403Asn synonymous AGL 1 83290 1.20062E-5 41645 0 NA
1-100340939-T-C p.Val404Ala missense AGL 1 83286 1.20068E-5 41643 0 8.24933E-6
1-100340946-T-G p.Tyr406* stop_gained AGL 2 83298 2.40102E-5 41649 0 NA
1-100340950-C-T p.Arg408* stop_gained AGL 2 83286 2.40136E-5 41643 0 1.64962E-5
1-100340951-G-A p.Arg408Gln missense AGL 1 83284 1.20071E-5 41642 0 3.18532E-5
1-100340954-T-G p.Leu409Arg missense AGL 17 83286 2.04116E-4 41643 0 1.91034E-4
1-100340966-G-A p.Gly413Asp missense AGL 1 83254 1.20114E-5 41627 0 8.25014E-6
1-100340969-C-T p.Pro414Leu missense AGL 4 83254 4.80457E-5 41627 0 2.47525E-5
1-100340978-G-C p.Gly417Ala missense AGL 1 83248 1.20123E-5 41624 0 8.25396E-6
1-100340980-C-T p.Pro418Ser missense AGL 1 83248 1.20123E-5 41624 0 NA
1-100340988-T-C p.Thr420Thr synonymous AGL 2 83220 2.40327E-5 41610 0 6.36943E-5
1-100340989-A-G p.Arg421Gly missense AGL 4 83226 4.80619E-5 41613 0 0.00151057
1-100340991-A-G p.Arg421Arg synonymous AGL 3 83214 3.60516E-5 41607 0 3.97858E-6
1-100341008-C-T p.Thr427Ile missense AGL 1 83134 1.20288E-5 41567 0 6.25E-4
1-100341009-C-T p.Thr427Thr splice_region+synonymous AGL 1 83130 1.20294E-5 41565 0 NA
1-100342009-C-T c.1284-5C>T splice_region AGL 1 81850 1.22175E-5 40925 0 NA
1-100342010-A-G c.1284-4A>G splice_region AGL 3 81908 3.66265E-5 40954 0 2.72306E-4
1-100342045-T-G p.Phe439Val missense AGL 1 82662 1.20975E-5 41331 0 NA
1-100342049-C-T p.Ser440Phe missense AGL 126 82674 0.00152406 41337 0 0.00289883
1-100342049-C-A p.Ser440Tyr missense AGL 1 82680 1.20948E-5 41340 0 3.18552E-5
1-100342063-A-G p.Met445Val missense AGL 7 82806 8.45349E-5 41403 0 2.86624E-4
1-100342089-T-C p.Cys453Cys synonymous AGL 1 82924 1.20592E-5 41462 0 0.003125
1-100342102-C-A p.His458Asn missense AGL 2 82932 2.41161E-5 41466 0 1.19464E-5
1-100342105-A-C p.Asn459His missense AGL 1 82948 1.20557E-5 41474 0 3.98153E-6
1-100342109-G-A p.Gly460Glu missense AGL 2 82948 2.41115E-5 41474 0 3.98156E-6
1-100342110-A-G p.Gly460Gly synonymous AGL 1 82926 1.20589E-5 41463 0 NA
1-100342116-A-C p.Val462Val synonymous AGL 5 82940 6.02845E-5 41470 0 3.18573E-5
1-100342119-G-A p.Met463Ile missense AGL 2 82962 2.41074E-5 41481 0 6.25E-4
1-100342122-A-G p.Gly464Gly synonymous AGL 1 82958 1.20543E-5 41479 0 NA
1-100342125-T-G p.Asp465Glu missense AGL 1 82954 1.20549E-5 41477 0 1.64897E-5
1-100342135-C-G p.Arg469Gly missense AGL 1 82962 1.20537E-5 41481 0 1.23705E-4
1-100342136-G-A p.Arg469Gln missense AGL 5 82966 6.02657E-5 41483 0 6.37024E-5
1-100342151-C-T p.Pro474Leu missense+splice_region AGL 2 82890 2.41284E-5 41445 0 2.47615E-5
1-100342155-T-TTC c.1423+2_1423+3insTC splice_region AGL 1 82892 1.20639E-5 41446 0 NA
1-100342156-A-G c.1423+3A>G splice_region AGL 4 82906 4.82474E-5 41453 0 1.2738E-4
1-100343189-C-T c.1424-8C>T splice_region AGL 1 83070 1.2038E-5 41535 0 8.28885E-6
1-100343194-C-T c.1424-3C>T splice_region AGL 1 83076 1.20372E-5 41538 0 NA
1-100343197-G-T p.Gly475Val missense+splice_region AGL 1 83088 1.20354E-5 41544 0 1.59398E-4
1-100343202-G-C p.Glu477Gln missense AGL 4 83104 4.81325E-5 41552 0 8.26132E-6
1-100343205-G-A p.Val478Ile missense AGL 5 83106 6.01641E-5 41553 0 1.40366E-4
1-100343213-A-G p.Leu480Leu synonymous AGL 1 83112 1.2032E-5 41556 0 3.97988E-6
1-100343214-A-C p.Arg481Arg synonymous AGL 1 83112 1.2032E-5 41556 0 NA
1-100343219-A-G p.Arg482Arg synonymous AGL 1 83118 1.20311E-5 41559 0 NA
1-100343222-A-G p.Glu483Glu synonymous AGL 1 83126 1.20299E-5 41563 0 8.24606E-6
1-100343223-C-A p.Leu484Ile missense AGL 1 83122 1.20305E-5 41561 0 8.24633E-6
1-100343235-G-A p.Gly488Arg missense AGL 1 83136 1.20285E-5 41568 0 NA
1-100343253-C-T p.Arg494Cys missense AGL 3 83132 3.60872E-5 41566 0 6.37349E-5
1-100343254-G-A p.Arg494His missense AGL 435 83122 0.00523327 41561 3 0.00958904
1-100343282-T-G p.Pro503Pro synonymous AGL 2 83180 2.40442E-5 41590 0 3.97959E-6
1-100343310-A-T p.Thr513Ser missense AGL 6 83184 7.21293E-5 41592 0 1.27372E-4
1-100343314-A-G p.Glu514Gly missense AGL 1 83178 1.20224E-5 41589 0 8.24688E-6
1-100343320-C-G p.Thr516Ser missense AGL 1 83166 1.20241E-5 41583 0 NA
1-100343325-A-G p.Thr518Ala missense AGL 13 83160 1.56325E-4 41580 0 4.12521E-5
1-100343330-T-C p.Tyr519Tyr synonymous AGL 1 83144 1.20273E-5 41572 0 NA
1-100343333-C-G p.Phe520Leu missense AGL 2 83130 2.40587E-5 41565 0 NA
1-100343343-C-T p.Arg524Cys missense AGL 1 83092 1.20349E-5 41546 0 3.98045E-6
1-100343344-G-A p.Arg524His missense AGL 1 83082 1.20363E-5 41541 0 8.25846E-6
1-100343350-A-G p.Asp526Gly missense AGL 2 83062 2.40784E-5 41531 0 3.18492E-5
1-100343375-C-T p.His534His synonymous AGL 12 82844 1.44851E-4 41422 0 6.54093E-4
1-100343376-G-A p.Val535Ile missense AGL 2 82840 2.41429E-5 41420 0 6.25E-4
1-100343378-AG-TC p.ValAla535ValPro missense AGL 2 82820 2.41488E-5 41410 0 NA
1-100343380-C-G p.Ala536Gly missense AGL 1 82792 1.20785E-5 41396 0 NA
1-100343381-TGAGGTACAGAAAAACAATTTA-T p.Glu537del splice_donor AGL 2 82788 2.41581E-5 41394 0 NA
1-100343390-G-A c.1611+6G>A splice_region AGL 2 82604 2.42119E-5 41302 0 2.49095E-5
1-100345471-T-A c.1612-8T>A splice_region AGL 1 83174 1.2023E-5 41587 0 NA
1-100345489-A-G p.Asp541Gly missense AGL 2 83206 2.40367E-5 41603 0 8.24321E-6
1-100345510-C-G p.Pro548Arg missense AGL 2 83206 2.40367E-5 41603 0 1.64829E-5
1-100345513-A-G p.Asn549Ser missense AGL 2 83210 2.40356E-5 41605 0 3.9794E-6
1-100345517-A-G p.Leu550Leu synonymous AGL 2 83204 2.40373E-5 41602 0 2.38755E-5
1-100345518-T-C p.Tyr551His missense AGL 1 83208 1.20181E-5 41604 0 8.24131E-6
1-100345527-G-A p.Ala554Thr missense AGL 1 83208 1.20181E-5 41604 0 3.97912E-6
1-100345535-G-A p.Leu556Leu synonymous AGL 1 83206 1.20184E-5 41603 0 NA
1-100345541-A-G p.Thr558Thr synonymous AGL 1 83206 1.20184E-5 41603 0 NA
1-100345546-G-A p.Ser560Asn missense AGL 1 83194 1.20201E-5 41597 0 NA
1-100345560-A-G p.Asn565Asp missense AGL 1 83192 1.20204E-5 41596 0 NA
1-100345561-A-G p.Asn565Ser missense AGL 5 83192 6.01019E-5 41596 0 6.25E-4
1-100345565-CTT-C p.Phe567fs frameshift AGL 1 83200 1.20192E-5 41600 0 NA
1-100345571-T-A p.Val568Val synonymous AGL 1 83210 1.20178E-5 41605 0 NA
1-100345573-C-G p.Thr569Ser missense AGL 1 83200 1.20192E-5 41600 0 NA
1-100345579-T-G p.Leu571Arg missense AGL 2 83196 2.40396E-5 41598 0 3.97877E-6
1-100345581-G-A p.Gly572Ser missense AGL 1 83190 1.20207E-5 41595 0 NA
1-100345583-C-T p.Gly572Gly synonymous AGL 2 83194 2.40402E-5 41597 0 NA
1-100345603-G-T c.1735+1G>T splice_donor AGL 1 83192 1.20204E-5 41596 0 1.64807E-5
1-100346201-A-G p.Ala583Ala synonymous AGL 4 82836 4.82882E-5 41418 0 6.25E-4
1-100346211-C-T p.His587Tyr missense AGL 48 82890 5.79081E-4 41445 0 0.00100705
1-100346217-G-C p.Glu589Gln missense AGL 1 82954 1.20549E-5 41477 0 NA
1-100346240-T-C p.Tyr596Tyr synonymous AGL 2 83094 2.40691E-5 41547 0 1.64769E-5
1-100346250-C-A p.Pro600Thr missense AGL 1 83120 1.20308E-5 41560 0 NA
1-100346262-T-G p.Phe604Val missense AGL 39 83180 4.68863E-4 41590 0 0.00133724
1-100346267-T-C p.Val605Val synonymous AGL 1 83198 1.20195E-5 41599 0 NA
1-100346272-C-A p.Pro607His missense AGL 1 83196 1.20198E-5 41598 0 8.23873E-6
1-100346274-T-C p.Cys608Arg missense AGL 1 83196 1.20198E-5 41598 0 NA
1-100346275-G-A p.Cys608Tyr missense AGL 1 83200 1.20192E-5 41600 0 NA
1-100346308-C-T p.Ala619Val missense AGL 1 83206 1.20184E-5 41603 0 3.97836E-6
1-100346316-A-C p.Met622Leu missense AGL 5 83192 6.01019E-5 41596 0 1.91095E-4
1-100346316-A-G p.Met622Val missense AGL 1 83192 1.20204E-5 41596 0 NA
1-100346327-G-T p.Thr625Thr synonymous AGL 155 83172 0.00186361 41586 0 0.0014802
1-100346337-G-A p.Glu629Lys missense AGL 76 83146 9.14055E-4 41573 0 0.00168811
1-100346344-C-A p.Pro631His missense AGL 1 83118 1.20311E-5 41559 0 NA
1-100346347-T-C p.Ile632Thr missense AGL 8 83110 9.6258E-5 41555 0 1.59215E-4
1-100346350-T-C p.Val633Ala missense+splice_region AGL 1 83100 1.20337E-5 41550 0 3.18431E-5
1-100346626-T-C c.1900-6T>C splice_region AGL 4 82810 4.83033E-5 41405 0 3.18471E-5
1-100346640-A-G p.Ser636Ser synonymous AGL 32 82904 3.85989E-4 41452 0 0.00111465
1-100346641-G-A p.Ala637Thr missense AGL 2 82902 2.41249E-5 41451 0 6.7694E-5
1-100346651-C-T p.Ala640Val missense AGL 1 82938 1.20572E-5 41469 0 3.18451E-5
1-100346665-A-G p.Thr645Ala missense AGL 12 82956 1.44655E-4 41478 1 0.00125
1-100346682-A-C p.Ala650Ala synonymous AGL 3 82984 3.61515E-5 41492 0 1.64886E-5
1-100346702-C-G p.Thr657Arg missense AGL 1 82996 1.20488E-5 41498 0 3.98172E-6
1-100346704-A-T p.Arg658* stop_gained AGL 1 82988 1.20499E-5 41494 0 NA
1-100346706-A-G p.Arg658Arg synonymous AGL 1 82972 1.20523E-5 41486 0 NA
1-100346707-G-A p.Gly659Ser missense AGL 1 82968 1.20528E-5 41484 0 5.03525E-4
1-100346711-A-C p.Tyr660Ser missense AGL 2 82960 2.4108E-5 41480 0 1.64894E-5
1-100346730-TCAGGTTTGTTTATATGTTGTTTCTTAAAACCTACATGGCCAACAACTTTGGGCATTTTTATTAAAAAAAATTCATTGTAATTAAGATGTATCCATGCTAAATTTTACCTTTGTC-T p.Gln667del splice_donor AGL 6 82910 7.23676E-5 41455 3 NA
1-100346741-T-C c.2001+8T>C splice_region AGL 42495 82466 0.515303 41233 11189 0.554136
1-100346842-G-T c.2002-6G>T splice_region AGL 1 82514 1.21192E-5 41257 0 NA
1-100346860-T-G p.Ser672Ala missense AGL 1 82452 1.21283E-5 41226 0 3.30595E-5
1-100346870-G-A p.Arg675Gln missense AGL 6 82372 7.28403E-5 41186 0 3.19145E-5
1-100346870-G-C p.Arg675Pro missense AGL 1 82372 1.214E-5 41186 0 NA
1-100346871-G-A p.Arg675Arg synonymous AGL 3 82366 3.64228E-5 41183 0 8.26392E-6
1-100346871-G-T p.Arg675Arg synonymous AGL 1 82366 1.21409E-5 41183 0 NA
1-100346880-T-C p.Thr678Thr synonymous AGL 1 82352 1.2143E-5 41176 0 6.3674E-5
1-100346892-T-C p.Pro682Pro synonymous AGL 1 82308 1.21495E-5 41154 0 NA
1-100346897-C-T p.Ala684Val missense AGL 1 82320 1.21477E-5 41160 0 NA
1-100346915-G-T p.Gly690Val missense AGL 1 82298 1.2151E-5 41149 0 3.18329E-5
1-100346923-A-G p.Asn693Asp missense AGL 2 82382 2.42771E-5 41191 0 NA
1-100346930-A-G p.Gln695Arg missense AGL 2 82420 2.4266E-5 41210 0 8.27185E-6
1-100346934-C-T p.Ser696Ser synonymous AGL 23 82402 2.79119E-4 41201 0 0.00100705
1-100346938-A-G p.Ile698Val missense AGL 1 82470 1.21256E-5 41235 0 3.99125E-6
1-100346960-T-C p.Ile705Thr missense AGL 2 82650 2.41984E-5 41325 0 8.2765E-6
1-100346979-G-A p.Glu711Glu synonymous AGL 1 82702 1.20916E-5 41351 0 NA
1-100346993-G-A p.Gly716Asp missense AGL 1 82774 1.20811E-5 41387 0 1.65585E-5
1-100346999-TTCAGGCAAGAAATAATTAAATTTGTTTCTTCAGGTTCAATTTCAGAGTAAGTCTTTCCAGTTTGAGAGCTAATCTAGTTGTTCTTTCTGCTTC-T p.Ile718fs frameshift AGL 7 82796 8.45452E-5 41398 3 NA
1-100347001-C-T p.Gln719* stop_gained AGL 1 82798 1.20776E-5 41399 0 NA
1-100347095-A-G c.2158-2A>G splice_acceptor AGL 4 83212 4.807E-5 41606 0 NA
1-100347102-T-C p.Tyr721Tyr synonymous AGL 11 83240 1.32148E-4 41620 0 5.03525E-4
1-100347112-G-A p.Val725Ile missense AGL 2 83232 2.40292E-5 41616 0 NA
1-100347121-G-GTTT p.Asp728delinsValTyr disruptive_inframe_insertion AGL 1 83242 1.20132E-5 41621 0 NA
1-100347125-T-C p.Ile729Thr missense AGL 1 83248 1.20123E-5 41624 0 6.25E-4
1-100347138-A-G p.Thr733Thr synonymous AGL 1 83278 1.2008E-5 41639 0 NA
1-100347138-A-T p.Thr733Thr synonymous AGL 1 83278 1.2008E-5 41639 0 1.64788E-5
1-100347148-C-T p.Pro737Ser missense AGL 1 83268 1.20094E-5 41634 0 3.1841E-5
1-100347151-A-T p.Ser738Cys missense AGL 1 83266 1.20097E-5 41633 0 NA
1-100347152-G-T p.Ser738Ile missense AGL 1 83270 1.20091E-5 41635 0 NA
1-100347154-A-G p.Ile739Val missense AGL 1 83270 1.20091E-5 41635 0 NA
1-100347158-A-G p.His740Arg missense AGL 3 83276 3.60248E-5 41638 0 2.54858E-4
1-100347159-T-A p.His740Gln missense AGL 1 83270 1.20091E-5 41635 0 9.0632E-5
1-100347161-A-G p.Gln741Arg missense AGL 7 83282 8.40518E-5 41641 0 6.25E-4
1-100347177-A-T p.Val746Val synonymous AGL 1 83254 1.20114E-5 41627 0 3.97867E-6
1-100347187-G-T p.Ala750Ser missense AGL 28 83228 3.36425E-4 41614 0 5.03525E-4
1-100347203-A-G p.Lys755Arg missense AGL 1 83168 1.20239E-5 41584 0 3.97959E-6
1-100347219-C-T p.Ser760Ser synonymous AGL 19 83028 2.28838E-4 41514 0 0.00151057
1-100347244-C-T p.Pro769Ser missense AGL 3 82768 3.62459E-5 41384 0 NA
1-100347247-G-C p.Gly770Arg missense+splice_region AGL 6 82706 7.25461E-5 41353 0 1.2791E-4
1-100349675-G-A c.2309-1G>A splice_acceptor AGL 1 82734 1.20869E-5 41367 0 7.9961E-6
1-100349714-G-A p.Glu783Lys missense AGL 1 82730 1.20875E-5 41365 0 3.18532E-5
1-100349720-A-G p.Asn785Asp missense AGL 2 82760 2.41663E-5 41380 0 4.96467E-5
1-100349724-C-T p.Thr786Met missense AGL 7 82764 8.45778E-5 41382 0 8.27294E-6
1-100349725-G-A p.Thr786Thr synonymous AGL 2 82768 2.41639E-5 41384 0 3.18654E-5
1-100349733-A-C p.Tyr789Ser missense AGL 1 82814 1.20753E-5 41407 0 3.18451E-5
1-100349737-G-A p.Arg790Arg synonymous AGL 1 82826 1.20735E-5 41413 0 NA
1-100349753-A-G p.Ile796Val missense AGL 1 82854 1.20694E-5 41427 0 2.39192E-5
1-100349757-A-G p.Asn797Ser missense AGL 170 82876 0.00205126 41438 0 0.0020141
1-100349769-A-G p.Asp801Gly missense AGL 2 82878 2.41319E-5 41439 0 3.18492E-5
1-100349788-A-C p.Arg807Ser missense AGL 1 82882 1.20653E-5 41441 0 8.27075E-6
1-100349798-CAGGTATTTGGGACTCTCATCTTACTACTGTGTTTAGCATTTTAAGAACATTAGAACTATTTGTTGAATGGATTTTTTTAATGTACTTTTTTTCA-C p.Gln811fs frameshift AGL 2 82904 2.41243E-5 41452 1 NA
1-100349801-G-A c.2433+1G>A splice_donor AGL 1 82896 1.20633E-5 41448 0 NA
1-100349891-C-T c.2434-4C>T splice_region AGL 1 82762 1.20828E-5 41381 0 NA
1-100349892-A-AGAAGTCTG c.2434-3_2434-2insGAAGTCTG splice_acceptor AGL 1 82752 1.20843E-5 41376 0 NA
1-100349909-A-C p.Lys816Asn missense AGL 1 82758 1.20834E-5 41379 0 NA
1-100349913-G-A p.Val818Ile missense AGL 1 82748 1.20849E-5 41374 0 NA
1-100349920-A-G p.Gln820Arg missense AGL 1 82802 1.2077E-5 41401 0 NA
1-100349926-G-C p.Gly822Ala missense AGL 1 82810 1.20758E-5 41405 0 8.35631E-6
1-100349928-G-A p.Val823Ile missense AGL 1 82818 1.20747E-5 41409 0 1.59693E-4
1-100349934-A-G p.Thr825Ala missense AGL 2 82850 2.414E-5 41425 0 6.37267E-5
1-100349942-G-C p.Gly827Gly synonymous AGL 1 82884 1.20651E-5 41442 0 3.1902E-5
1-100349947-A-G p.Asn829Ser missense AGL 11 82886 1.32712E-4 41443 0 9.55536E-5
1-100349949-G-C p.Glu830Gln missense AGL 2 82900 2.41255E-5 41450 0 4.40779E-5
1-100349955-A-G p.Ile832Val missense AGL 1 82916 1.20604E-5 41458 0 NA
1-100349958-C-A p.Gln833Lys missense AGL 2 82914 2.41214E-5 41457 0 9.25677E-5
1-100349959-A-G p.Gln833Arg missense AGL 1 82926 1.20589E-5 41463 0 NA
1-100349964-A-G p.Ile835Val missense AGL 1 82928 1.20587E-5 41464 0 8.01693E-6
1-100349981-G-A p.Leu840Leu synonymous AGL 1 82882 1.20653E-5 41441 0 NA
1-100349983-C-T p.Ser841Phe missense AGL 392 82892 0.00472905 41446 5 0.0236657
1-100349985-C-T p.Pro842Ser missense AGL 1 82886 1.20648E-5 41443 0 NA
1-100349987-AG-CA p.ProGly842ProArg missense AGL 1 82894 1.20636E-5 41447 0 NA
1-100349998-T-C p.Ile846Thr missense AGL 1 82872 1.20668E-5 41436 0 5.03525E-4
1-100350002-ATTCAGGTATGTTAATTGAGCTCAAACTGTTGACTTTACTTATATTTAAAATAGTTTGCATATCCTGTTAAATTTGAATAAATTACTCCTAAAAATTAACCACTTTTTAATTAACATT-A p.Phe848fs frameshift AGL 7 82862 8.44778E-5 41431 2 NA
1-100350007-G-A p.Arg849Lys missense+splice_region AGL 5 82838 6.03588E-5 41419 0 3.18837E-5
1-100350136-A-AAAAAAAG p.Asp853fs frameshift AGL 1 82934 1.20578E-5 41467 0 NA
1-100350138-C-A p.Pro854Thr missense AGL 1 82930 1.20584E-5 41465 0 NA
1-100350139-C-T p.Pro854Leu missense AGL 1 82932 1.20581E-5 41466 0 NA
1-100350153-G-A p.Ala859Thr missense AGL 5 82870 6.03355E-5 41435 0 2.48172E-5
1-100350156-G-A p.Val860Ile missense AGL 2 82890 2.41284E-5 41445 0 NA
1-100350168-C-T p.Arg864* stop_gained AGL 2 82842 2.41423E-5 41421 0 8.26228E-5
1-100350185-A-G p.Gln869Gln synonymous AGL 8 82886 9.65181E-5 41443 0 0.00125
1-100350200-T-A p.Phe874Leu missense AGL 1 82870 1.20671E-5 41435 0 NA
1-100350210-A-C p.Ser878Arg missense AGL 1 82846 1.20706E-5 41423 0 8.25328E-6
1-100350213-C-T p.Leu879Leu synonymous AGL 1 82852 1.20697E-5 41426 0 NA
1-100350235-C-T p.Pro886Leu missense AGL 6 82824 7.24428E-5 41412 0 1.27389E-4
1-100350249-C-G p.Pro891Ala missense AGL 1 82746 1.20852E-5 41373 0 8.25382E-6
1-100350260-G-A c.2681+1G>A splice_donor AGL 4 82580 4.84379E-5 41290 0 6.25E-4
1-100353527-T-C c.2682-7T>C splice_region AGL 2 83044 2.40836E-5 41522 0 3.30622E-5
1-100353545-G-C p.Arg898Thr missense AGL 1 83098 1.2034E-5 41549 0 NA
1-100353546-A-T p.Arg898Ser missense AGL 2 83090 2.40703E-5 41545 0 1.65128E-5
1-100353581-G-A p.Arg910Gln missense AGL 4 83186 4.8085E-5 41593 0 1.07282E-4
1-100353613-G-A p.Gly921Arg missense AGL 4 83250 4.8048E-5 41625 0 8.25055E-6
1-100353620-A-T p.Tyr923Phe missense AGL 4 83248 4.80492E-5 41624 0 NA
1-100353621-T-C p.Tyr923Tyr synonymous AGL 1 83254 1.20114E-5 41627 0 NA
1-100353623-A-C p.Asp924Ala missense AGL 5 83250 6.00601E-5 41625 0 1.27372E-4
1-100353635-G-A p.Trp928* stop_gained AGL 1 83250 1.2012E-5 41625 0 3.98076E-6
1-100353641-C-G p.Ala930Gly missense AGL 1 83234 1.20143E-5 41617 0 NA
1-100353642-C-T p.Ala930Ala synonymous AGL 1 83234 1.20143E-5 41617 0 8.24946E-6
1-100353652-G-A p.Ala934Thr missense AGL 1 83238 1.20137E-5 41619 0 NA
1-100353654-A-C p.Ala934Ala synonymous AGL 262 83230 0.0031479 41615 1 0.00659278
1-100353664-G-T p.Gly938Cys missense+splice_region AGL 1 83226 1.20155E-5 41613 0 7.96921E-6
1-100356777-T-C p.Gly938Gly splice_region+synonymous AGL 2 83058 2.40796E-5 41529 1 3.18735E-5
1-100356777-T-G p.Gly938Gly splice_region+synonymous AGL 5 83058 6.01989E-5 41529 0 4.95933E-5
1-100356792-G-A p.Leu943Leu synonymous AGL 2 83092 2.40697E-5 41546 0 1.65246E-5
1-100356819-G-T p.Leu952Phe missense AGL 1 83076 1.20372E-5 41538 0 8.25696E-6
1-100356822-G-A p.Gly953Gly synonymous AGL 1 83066 1.20386E-5 41533 0 NA
1-100356846-A-G p.Arg961Arg synonymous AGL 119 83044 0.00143298 41522 0 0.00372801
1-100356847-T-A p.Ser962Thr missense AGL 2 83044 2.40836E-5 41522 0 NA
1-100356848-C-G p.Ser962Cys missense AGL 580 83040 0.00698459 41520 13 0.0136995
1-100356860-T-C p.Met966Thr missense AGL 3 83024 3.61341E-5 41512 0 NA
1-100356866-A-G p.Asp968Gly missense AGL 1 83016 1.20459E-5 41508 0 3.18512E-5
1-100356868-T-C p.Tyr969His missense AGL 1 83004 1.20476E-5 41502 0 3.18512E-5
1-100356870-T-C p.Tyr969Tyr synonymous AGL 4 83002 4.81916E-5 41501 0 NA
1-100356880-C-T p.Arg973Trp missense AGL 1 82936 1.20575E-5 41468 0 3.30169E-5
1-100356893-G-A p.Arg977Gln missense AGL 10 82814 1.20753E-4 41407 0 1.9129E-4
1-100356893-G-T p.Arg977Leu missense AGL 1 82814 1.20753E-5 41407 0 4.38156E-5
1-100356898-G-A p.Gly979Arg missense AGL 10 82758 1.20834E-4 41379 0 2.3901E-5
1-100356904-A-G p.Ile981Val missense AGL 14 82716 1.69254E-4 41358 0 4.46172E-4
1-100356914-T-A c.2949+2T>A splice_donor AGL 1 82552 1.21136E-5 41276 0 3.98775E-6
1-100357165-G-A p.Gly985Ser missense AGL 1 83058 1.20398E-5 41529 0 NA
1-100357176-G-A p.Leu988Leu synonymous AGL 1 83094 1.20346E-5 41547 0 3.18552E-5
1-100357177-C-T p.Gln989* stop_gained AGL 1 83094 1.20346E-5 41547 0 NA
1-100357178-A-G p.Gln989Arg missense AGL 5 83092 6.01743E-5 41546 1 5.57054E-5
1-100357183-A-G p.Met991Val missense AGL 2 83106 2.40657E-5 41553 0 NA
1-100357188-C-T p.Phe992Phe synonymous AGL 1 83120 1.20308E-5 41560 0 NA
1-100357202-A-G p.Gln997Arg missense AGL 1 83158 1.20253E-5 41579 0 3.97871E-6
1-100357211-G-A p.Arg1000His missense AGL 1 83140 1.20279E-5 41570 0 3.97905E-6
1-100357219-A-C p.Ile1003Leu missense AGL 1 83158 1.20253E-5 41579 0 NA
1-100357220-T-C p.Ile1003Thr missense AGL 1 83158 1.20253E-5 41579 0 NA
1-100357221-C-G p.Ile1003Met missense AGL 1 83160 1.2025E-5 41580 0 NA
1-100357225-T-G p.Cys1005Gly missense AGL 1 83164 1.20244E-5 41582 0 3.18613E-5
1-100357250-G-T p.Gly1013Val missense AGL 1 83104 1.20331E-5 41552 0 NA
1-100357259-C-G p.Thr1016Ser missense AGL 4 83066 4.81545E-5 41533 0 NA
1-100357294-A-G p.Ser1028Gly missense+splice_region AGL 2 82904 2.41243E-5 41452 0 8.24457E-6
1-100357980-T-C c.3084-8T>C splice_region AGL 10 82932 1.20581E-4 41466 1 6.25E-4
1-100357983-T-G c.3084-5T>G splice_region AGL 1 82948 1.20557E-5 41474 0 NA
1-100357991-TG-T p.Val1030fs frameshift AGL 1 83032 1.20435E-5 41516 0 NA
1-100358002-G-T p.Gly1033Val missense AGL 1 83076 1.20372E-5 41538 0 NA
1-100358006-A-G p.Ser1034Ser synonymous AGL 1 83096 1.20343E-5 41548 0 1.19451E-5
1-100358020-A-T p.His1039Leu missense AGL 2 83194 2.40402E-5 41597 0 5.17541E-5
1-100358028-T-G p.Leu1042Val missense AGL 2 83230 2.40298E-5 41615 0 5.03525E-4
1-100358028-T-C p.Leu1042Leu synonymous AGL 4 83230 4.80596E-5 41615 0 2.4768E-5
1-100358030-G-A p.Leu1042Leu synonymous AGL 1 83234 1.20143E-5 41617 0 1.65123E-5
1-100358031-G-T p.Gly1043Cys missense AGL 3 83228 3.60456E-5 41614 0 3.9808E-6
1-100358059-A-G p.Lys1052Arg missense AGL 1 83238 1.20137E-5 41619 0 2.47664E-5
1-100358068-C-G p.Ser1055Cys missense AGL 1 83240 1.20135E-5 41620 0 4.37874E-5
1-100358070-C-G p.Leu1056Val missense AGL 1 83242 1.20132E-5 41621 0 2.78682E-5
1-100358070-C-T p.Leu1056Leu synonymous AGL 1 83242 1.20132E-5 41621 0 3.98118E-6
1-100358103-C-T p.Pro1067Ser missense AGL 11968 82968 0.144248 41484 893 0.224572
1-100358107-A-G p.Tyr1068Cys missense AGL 65 83148 7.81739E-4 41574 0 0.00159246
1-100358108-T-C p.Tyr1068Tyr synonymous AGL 1 83154 1.20259E-5 41577 0 NA
1-100358117-TGA-T p.Glu1072fs frameshift AGL 6 83118 7.21865E-5 41559 0 3.18573E-5
1-100358135-G-A p.Lys1077Lys synonymous AGL 13 82998 1.5663E-4 41499 0 2.232E-4
1-100358143-G-C p.Cys1080Ser missense AGL 2 82964 2.41068E-5 41482 0 NA
1-100358156-A-G p.Leu1084Leu synonymous AGL 3 82886 3.61943E-5 41443 0 NA
1-100358158-C-G p.Ala1085Gly missense AGL 1 82894 1.20636E-5 41447 0 NA
1-100358164-G-GCT c.3259+1_3259+2insCT splice_donor AGL 4 82886 4.82591E-5 41443 2 NA
1-100361860-C-A p.Ser1093Tyr missense AGL 1 83258 1.20109E-5 41629 0 NA
1-100361865-A-G p.Ile1095Val missense AGL 2 83258 2.40217E-5 41629 0 3.97709E-6
1-100361871-C-T p.Arg1097Cys missense AGL 1 83254 1.20114E-5 41627 0 3.29457E-5
1-100361872-G-A p.Arg1097His missense AGL 2 83252 2.40234E-5 41626 0 2.55232E-4
1-100361890-C-G p.Thr1103Ser missense AGL 1 83246 1.20126E-5 41623 0 8.23642E-6
1-100361896-T-C p.Ile1105Thr missense AGL 4 83240 4.80538E-5 41620 0 3.97719E-6
1-100361897-T-C p.Ile1105Ile synonymous AGL 1 83230 1.20149E-5 41615 0 NA
1-100361915-G-C p.Leu1111Leu synonymous AGL 1 83160 1.2025E-5 41580 0 3.97747E-6
1-100361923-C-T p.Thr1114Ile missense AGL 2 83116 2.40628E-5 41558 0 NA
1-100361924-T-C p.Thr1114Thr synonymous AGL 3 83106 3.60985E-5 41553 0 1.64742E-5
1-100361925-G-A p.Gly1115Arg missense AGL 4190 82934 0.0505221 41467 160 0.073494
1-100361927-A-T p.Gly1115Gly synonymous AGL 1 83074 1.20375E-5 41537 0 3.57953E-5
1-100361928-C-T p.Arg1116Cys missense AGL 2 83038 2.40854E-5 41519 0 3.18634E-5
1-100361929-G-T p.Arg1116Leu missense AGL 1 83036 1.2043E-5 41518 0 3.9776E-6
1-100361929-G-A p.Arg1116His missense AGL 1 83036 1.2043E-5 41518 0 4.37536E-5
1-100361933-T-C p.Tyr1117Tyr synonymous AGL 1 83048 1.20412E-5 41524 0 NA
1-100361945-G-GAATATTATTTTAGCATTTGCGGGTACCCTGAGGCATGGTCTCATTCC c.3362+1_3362+2insAATATTATTTTAGCATTTGCGGGTACCCTGAGGCATGGTCTCATTCC splice_donor AGL 1 82920 1.20598E-5 41460 0 NA
1-100361945-G-GAATATTATTTTAGCATTTGCGGGTACCCTGAGGCA c.3362+1_3362+2insAATATTATTTTAGCATTTGCGGGTACCCTGAGGCA splice_donor AGL 2 82920 2.41196E-5 41460 1 NA
1-100366200-T-C p.Ile1124Thr missense AGL 1 83268 1.20094E-5 41634 0 NA
1-100366213-G-A p.Ala1128Ala synonymous AGL 120 83312 0.00144037 41656 0 0.00376276
1-100366217-A-G p.Thr1130Ala missense AGL 3 83344 3.59954E-5 41672 0 NA
1-100366229-G-A p.Gly1134Ser missense AGL 1 83372 1.19944E-5 41686 0 1.5907E-5
1-100366232-C-G p.Leu1135Val missense AGL 2 83376 2.39877E-5 41688 0 3.97665E-6
1-100366241-A-G p.Asn1138Asp missense AGL 1 83400 1.19904E-5 41700 0 5.03525E-4
1-100366248-T-G p.Leu1140Arg missense AGL 1 83412 1.19887E-5 41706 0 6.37633E-5
1-100366260-T-A p.Ile1144Asn missense AGL 77 83426 9.22974E-4 41713 0 0.00173788
1-100366265-G-A p.Ala1146Thr missense AGL 1 83430 1.19861E-5 41715 0 4.11821E-5
1-100366266-C-T p.Ala1146Val missense AGL 6 83432 7.19149E-5 41716 0 NA
1-100366280-C-T p.Arg1151Trp missense AGL 5 83434 5.99276E-5 41717 0 1.15316E-4
1-100366281-G-A p.Arg1151Gln missense AGL 3 83434 3.59566E-5 41717 0 1.1929E-5
1-100366285-T-A p.Asp1152Glu missense AGL 1 83432 1.19858E-5 41716 0 NA
1-100366290-T-A p.Val1154Glu missense AGL 1 83436 1.19852E-5 41718 0 NA
1-100366315-G-A p.Gln1162Gln synonymous AGL 1 83426 1.19867E-5 41713 0 NA
1-100366315-G-C p.Gln1162His missense AGL 1 83426 1.19867E-5 41713 0 NA
1-100366322-T-A p.Cys1165Ser missense AGL 1 83426 1.19867E-5 41713 0 NA
1-100366337-A-G p.Asn1170Asp missense AGL 3 83418 3.59635E-5 41709 0 1.19298E-5
1-100366341-G-A p.Gly1171Asp missense AGL 2 83416 2.39762E-5 41708 0 8.23683E-6
1-100366349-A-G p.Ile1174Val missense AGL 1 83412 1.19887E-5 41706 0 NA
1-100366357-G-T p.Lys1176Asn missense AGL 1 83412 1.19887E-5 41706 0 3.97633E-6
1-100366360-C-T p.Cys1177Cys synonymous AGL 1 83410 1.1989E-5 41705 0 NA
1-100366361-C-T p.Pro1178Ser missense AGL 4 83408 4.7957E-5 41704 0 1.59053E-5
1-100366375-G-T p.Met1182Ile missense AGL 2 83380 2.39866E-5 41690 0 3.20533E-5
1-100366377-A-G p.Tyr1183Cys missense AGL 6 83378 7.19614E-5 41689 0 1.59057E-5
1-100366379-C-A p.Pro1184Thr missense AGL 1 83380 1.19933E-5 41690 0 1.64728E-5
1-100366410-G-A p.Gly1194Asp missense AGL 1 83310 1.20034E-5 41655 0 8.23696E-6
1-100366413-C-G p.Thr1195Arg missense AGL 11 83306 1.32043E-4 41653 0 9.70874E-5
1-100366414-A-C p.Thr1195Thr synonymous AGL 1 83300 1.20048E-5 41650 0 NA
1-100366418-G-GATCAGCCATTGTTTGAAGTCA c.3588+1_3588+2insATCAGCCATTGTTTGAAGTCA splice_donor AGL 4 83270 4.80365E-5 41635 2 NA
1-100368261-T-C p.Ile1204Thr missense AGL 1 82780 1.20802E-5 41390 0 6.37064E-5
1-100368263-C-G p.Gln1205Glu missense AGL 1 82798 1.20776E-5 41399 0 1.99491E-5
1-100368269-G-A p.Ala1207Thr missense AGL 339 82788 0.0040948 41394 3 0.00821761
1-100368284-A-T p.Met1212Leu missense AGL 2 82882 2.41307E-5 41441 0 NA
1-100368285-T-C p.Met1212Thr missense AGL 1 82878 1.20659E-5 41439 0 0.003125
1-100368295-A-G p.Ile1215Met missense AGL 2 82852 2.41394E-5 41426 0 NA
1-100368302-C-T p.Arg1218* stop_gained AGL 1 82842 1.20712E-5 41421 0 3.18471E-5
1-100368303-G-A p.Arg1218Gln missense AGL 3 82848 3.62109E-5 41424 0 2.49775E-5
1-100368310-GA-G p.Asn1221fs frameshift AGL 1 82816 1.2075E-5 41408 0 NA
1-100368316-T-A p.Ala1222Ala synonymous AGL 1 82780 1.20802E-5 41390 0 NA
1-100368318-G-A p.Gly1223Asp missense AGL 4 82754 4.8336E-5 41377 0 2.74936E-4
1-100368320-C-G p.Pro1224Ala missense AGL 1 82746 1.20852E-5 41373 0 3.99307E-6
1-100368324-A-G p.Gln1225Arg missense AGL 1 82732 1.20872E-5 41366 0 NA
1-100368327-T-C p.Ile1226Thr missense AGL 3 82714 3.62696E-5 41357 0 3.18512E-5
1-100368332-C-T p.Arg1228* stop_gained AGL 1 82664 1.20972E-5 41332 0 7.99348E-6
1-100368333-G-A p.Arg1228Gln missense AGL 2 82648 2.4199E-5 41324 0 3.3423E-5
1-100368342-A-G p.Lys1231Arg missense AGL 1 82544 1.21148E-5 41272 0 8.40647E-6
1-100368346-C-T p.Asp1232Asp synonymous AGL 3 82454 3.63839E-5 41227 0 5.04032E-4
1-100368347-G-A p.Glu1233Lys missense AGL 4 82416 4.85343E-5 41208 0 2.80521E-5
1-100368352-T-TTTTAATATAACTGCAGGAGTTGATGAAGAA c.3700+2_3700+3insTTTAATATAACTGCAGGAGTTGATGAAGAA splice_region AGL 2 82340 2.42895E-5 41170 1 NA
1-100376263-T-G c.3701-5T>G splice_region AGL 2 81708 2.44774E-5 40854 0 NA
1-100376272-T-C p.Phe1235Phe synonymous AGL 1 82192 1.21666E-5 41096 0 2.2423E-5
1-100376286-G-T p.Gly1240Val missense AGL 2 82790 2.41575E-5 41395 0 3.99568E-6
1-100376305-A-T p.Gly1246Gly synonymous AGL 5 82974 6.02598E-5 41487 0 6.25E-4
1-100376324-C-A p.Arg1253Ser missense AGL 2 83028 2.40883E-5 41514 0 NA
1-100376325-G-A p.Arg1253His missense AGL 238 83036 0.00286623 41518 3 0.00600447
1-100376331-A-G p.Asn1255Ser missense AGL 77 83030 9.27376E-4 41515 0 0.00151057
1-100376345-A-T p.Met1260Leu missense AGL 1 83022 1.2045E-5 41511 0 NA
1-100376359-A-T p.Gly1264Gly synonymous AGL 45 82990 5.42234E-4 41495 0 0.00127527
1-100376379-A-G p.Asn1271Ser missense AGL 2 82804 2.41534E-5 41402 0 NA
1-100376380-CAG-C p.Gly1273fs frameshift AGL 1 82792 1.20785E-5 41396 0 NA
1-100376385-G-A p.Gly1273Glu missense AGL 2 82748 2.41698E-5 41374 0 8.60985E-6
1-100376389-C-T p.Ile1274Ile synonymous AGL 16 82752 1.93349E-4 41376 0 0.00151057
1-100376403-G-A p.Arg1279Lys missense+splice_region AGL 1 82670 1.20963E-5 41335 0 NA
1-100376403-G-GAGATGGGTCTGCTGTGGAAATTGTGGGCCTGA c.3836_3836+1insAGATGGGTCTGCTGTGGAAATTGTGGGCCTGA splice_donor AGL 1 82670 1.20963E-5 41335 0 NA
1-100376405-T-C c.3836+2T>C splice_donor AGL 1 82642 1.21004E-5 41321 0 8.71429E-6
1-100376406-A-G c.3836+3A>G splice_region AGL 6 82642 7.26023E-5 41321 0 3.18593E-5
1-100376407-G-A c.3836+4G>A splice_region AGL 1 82646 1.20998E-5 41323 0 4.00449E-6
1-100376409-G-A c.3836+6G>A splice_region AGL 2 82632 2.42037E-5 41316 0 NA
1-100377973-T-C p.Ala1283Ala synonymous AGL 1358 83222 0.0163178 41611 25 0.0427996
1-100377978-A-C p.Glu1285Ala missense AGL 1 83286 1.20068E-5 41643 0 NA
1-100377984-T-A p.Val1287Glu missense AGL 1 83298 1.20051E-5 41649 0 3.97947E-6
1-100378008-G-A p.Arg1295His missense AGL 15 83304 1.80063E-4 41652 0 6.25E-4
1-100378014-T-G p.Leu1297Trp missense AGL 3 83300 3.60144E-5 41650 0 3.18512E-5
1-100378027-C-CA p.Asn1304fs frameshift AGL 5 83286 6.00341E-5 41643 0 4.0076E-5
1-100378027-CA-C p.Asn1304fs frameshift AGL 2 83292 2.40119E-5 41646 0 1.65673E-4
1-100378037-A-G p.Ile1305Val missense AGL 1 83270 1.20091E-5 41635 0 NA
1-100378041-T-C p.Phe1306Ser missense AGL 1 83256 1.20111E-5 41628 0 NA
1-100378045-T-G p.Pro1307Pro synonymous AGL 1 83250 1.2012E-5 41625 0 NA
1-100378063-AAAAAGACATGGTAAGCTGGTT-A p.Lys1314fs frameshift AGL 2 83118 2.40622E-5 41559 0 NA
1-100378074-G-GAAAGGCTATAAAGGTCTCATATGATGAGTGGAACAGAAAAA c.3949+1_3949+2insAAAGGCTATAAAGGTCTCATATGATGAGTGGAACAGAAAAA splice_donor AGL 1 83058 1.20398E-5 41529 0 NA
1-100379097-GT-G p.Val1322fs frameshift AGL 2 82948 2.41115E-5 41474 0 3.18552E-5
1-100379097-G-GTC p.Tyr1324fs frameshift AGL 1 82948 1.20557E-5 41474 0 NA
1-100379101-C-T p.Ser1323Leu missense AGL 1 82980 1.20511E-5 41490 0 3.1837E-5
1-100379111-G-A p.Glu1326Glu synonymous AGL 4 83016 4.81835E-5 41508 0 3.98495E-6
1-100379113-G-A p.Trp1327* stop_gained AGL 7 83014 8.43231E-5 41507 0 6.36862E-5
1-100379118-A-G p.Arg1329Gly missense AGL 5 83010 6.02337E-5 41505 0 6.3674E-5
1-100379135-C-T p.Asn1334Asn synonymous AGL 1 83054 1.20404E-5 41527 0 NA
1-100379152-A-G p.His1340Arg missense AGL 2 83046 2.4083E-5 41523 0 NA
1-100379159-C-T p.Ser1342Ser synonymous AGL 1 83042 1.20421E-5 41521 0 1.19449E-5
1-100379160-G-A p.Glu1343Lys missense AGL 12 83042 1.44505E-4 41521 0 5.61386E-4
1-100379164-AC-A p.Pro1345fs frameshift AGL 1 83032 1.20435E-5 41516 0 NA
1-100379166-C-A p.Pro1345Thr missense AGL 2 83036 2.40859E-5 41518 0 NA
1-100379184-A-G p.Lys1351Glu missense AGL 1 83050 1.20409E-5 41525 0 8.24729E-6
1-100379185-A-G p.Lys1351Arg missense AGL 6 83046 7.22491E-5 41523 0 2.54712E-4
1-100379188-A-G p.His1352Arg missense AGL 1 83038 1.20427E-5 41519 0 8.24593E-6
1-100379198-G-A p.Leu1355Leu synonymous AGL 3 83004 3.61428E-5 41502 0 NA
1-100379209-G-A p.Arg1359His missense AGL 23 82996 2.77122E-4 41498 0 2.54761E-4
1-100379222-A-G p.Lys1363Lys synonymous AGL 1 82974 1.2052E-5 41487 0 NA
1-100379231-T-C p.Tyr1366Tyr synonymous AGL 1 82930 1.20584E-5 41465 0 NA
1-100379233-G-A p.Gly1367Glu missense AGL 2 82916 2.41208E-5 41458 0 3.18471E-5
1-100379235-G-A p.Ala1368Thr missense AGL 1 82904 1.20621E-5 41452 0 2.47304E-5
1-100379257-A-G p.Tyr1375Cys missense AGL 1 82868 1.20674E-5 41434 0 3.18309E-5
1-100379279-C-T p.Thr1382Thr synonymous AGL 1 82722 1.20887E-5 41361 0 6.25E-4
1-100379295-G-GCCCCTGAGCTCTTTACTACAGAAAAAGCATGGAAAGCTT c.4161+1_4161+2insCCCCTGAGCTCTTTACTACAGAAAAAGCATGGAAAGCTT splice_donor AGL 3 82542 3.63451E-5 41271 1 NA
1-100380941-C-G c.4162-4C>G splice_region AGL 2 82876 2.41324E-5 41438 0 8.30068E-6
1-100380946-C-T p.Ala1388Val missense+splice_region AGL 2 82916 2.41208E-5 41458 0 6.26566E-4
1-100380947-C-G p.Ala1388Ala splice_region+synonymous AGL 15 82930 1.80875E-4 41465 0 1.16092E-4
1-100380949-C-G p.Pro1389Arg missense AGL 2 82952 2.41103E-5 41476 0 NA
1-100380952-A-T p.Glu1390Val missense AGL 1 82988 1.20499E-5 41494 0 8.28844E-6
1-100380969-A-G p.Lys1396Glu missense AGL 11 83086 1.32393E-4 41543 0 1.07635E-4
1-100380972-G-A p.Ala1397Thr missense AGL 4 83106 4.81313E-5 41553 0 6.26566E-4
1-100380976-G-A p.Trp1398* stop_gained AGL 2 83102 2.40668E-5 41551 0 3.98178E-6
1-100380978-A-G p.Lys1399Glu missense AGL 3 83110 3.60967E-5 41555 0 1.65445E-5
1-100380993-G-A p.Ala1404Thr missense AGL 1 83142 1.20276E-5 41571 0 9.59816E-5
1-100380996-GA-G p.Lys1407fs frameshift AGL 1 83148 1.20267E-5 41574 0 7.96407E-6
1-100380997-A-G p.Glu1405Gly missense AGL 26 83150 3.12688E-4 41575 0 4.46713E-4
1-100381009-T-G p.Leu1409Arg missense AGL 1 83154 1.20259E-5 41577 0 3.98007E-6
1-100381034-A-T p.Leu1417Phe missense AGL 3 83034 3.61298E-5 41517 0 NA
1-100381041-G-C p.Asp1420His missense+splice_region AGL 1 82942 1.20566E-5 41471 0 1.65593E-5
1-100381959-T-A c.4260-7T>A splice_region AGL 1 82366 1.21409E-5 41183 0 NA
1-100381968-A-G p.Asp1421Gly missense+splice_region AGL 5 82478 6.06222E-5 41239 0 9.5584E-5
1-100381977-A-T p.Tyr1424Phe missense AGL 1 82608 1.21054E-5 41304 0 7.60146E-5
1-100381989-A-C p.Tyr1428Ser missense AGL 2 82714 2.41797E-5 41357 0 3.18471E-5
1-100381999-A-G p.Ala1431Ala synonymous AGL 1 82790 1.20788E-5 41395 0 3.18512E-5
1-100382006-A-G p.Asn1434Asp missense AGL 4 82826 4.8294E-5 41413 0 7.49238E-5
1-100382007-A-G p.Asn1434Ser missense AGL 3 82824 3.62214E-5 41412 0 6.25E-4
1-100382013-A-G p.Asn1436Ser missense AGL 2 82868 2.41348E-5 41434 0 3.18471E-5
1-100382019-A-G p.Asn1438Ser missense AGL 3 82898 3.61891E-5 41449 0 1.19718E-5
1-100382035-C-G p.Phe1443Leu missense AGL 1 82964 1.20534E-5 41482 0 NA
1-100382037-A-G p.Asn1444Ser missense AGL 60 82978 7.23083E-4 41489 0 0.001875
1-100382047-A-G p.Gln1447Gln synonymous AGL 2 83018 2.40912E-5 41509 0 1.59683E-5
1-100382050-A-C p.Gly1448Gly synonymous AGL 1 83000 1.20482E-5 41500 0 8.34557E-6
1-100382053-TGTAAGAATTTCATTTATCTTCTGAGTTTCAGTTTAAATTATTTTTCAAGTAATTTTTAGGTATTTATGGTTTTTTTTGTCTTTTAAATAATCTTTTTTAG-T c.4347+1_4348-1delGTAAGAATTTCATTTATCTTCTGAGTTTCAGTTTAAATTATTTTTCAAGTAATTTTTAGGTATTTATGGTTTTTTTTGTCTTTTAAATAATCTTTTTTAG splice_acceptor AGL 8 83022 9.636E-5 41511 3 NA
1-100382054-G-A c.4347+1G>A splice_donor AGL 1 83020 1.20453E-5 41510 0 NA
1-100382145-C-CT c.4348-9_4348-8insT splice_region AGL 2 83058 2.40796E-5 41529 0 NA
1-100382145-CT-C c.4348-8delT splice_region AGL 1 83060 1.20395E-5 41530 0 NA
1-100382164-GGC-G p.Trp1453fs frameshift AGL 1 83068 1.20383E-5 41534 0 NA
1-100382169-A-T p.Ile1455Phe missense AGL 1 83076 1.20372E-5 41538 0 8.44552E-6
1-100382169-ATTGGGT-A p.Ile1455_Tyr1457delinsAsn disruptive_inframe_deletion AGL 1 83076 1.20372E-5 41538 0 NA
1-100382174-G-A p.Gly1456Gly synonymous AGL 4 83076 4.81487E-5 41538 0 4.21614E-5
1-100382183-T-G p.Leu1459Leu synonymous AGL 1 83084 1.2036E-5 41542 0 NA
1-100382185-G-A p.Arg1460His missense AGL 5 83070 6.01902E-5 41535 0 1.17786E-4
1-100382193-T-TGATTGAAATTTAAGTTAAATAAAAGATGATCAGA p.Leu1463fs frameshift AGL 1 83090 1.20351E-5 41545 0 NA
1-100382195-A-G p.Leu1463Leu synonymous AGL 3 83094 3.61037E-5 41547 0 1.67768E-5
1-100382206-G-T p.Arg1467Ile missense AGL 1 83092 1.20349E-5 41546 0 NA
1-100382211-A-G p.Met1469Val missense AGL 1 83088 1.20354E-5 41544 0 8.34962E-6
1-100382218-C-T p.Pro1471Leu missense AGL 1 83092 1.20349E-5 41546 0 1.66792E-5
1-100382236-C-G p.Thr1477Ser missense AGL 182 83104 0.00219003 41552 3 0.00414382
1-100382242-T-C p.Val1479Ala missense AGL 4 83102 4.81336E-5 41551 0 1.65893E-5
1-100382244-T-G p.Leu1480Val missense AGL 1 83096 1.20343E-5 41548 0 NA
1-100382245-T-G p.Leu1480Trp missense AGL 1 83090 1.20351E-5 41545 0 3.98622E-5
1-100382249-T-G p.Val1481Val synonymous AGL 2 83082 2.40726E-5 41541 0 1.19573E-5
1-100382256-G-A p.Val1484Ile missense AGL 8 83060 9.63159E-5 41530 0 2.55102E-4
1-100382257-T-G p.Val1484Gly missense AGL 7 83062 8.42744E-5 41531 0 6.37064E-5
1-100382259-CT-C p.Ser1486fs frameshift AGL 2 83064 2.40778E-5 41532 0 8.28651E-6
1-100382265-C-T p.Arg1487* stop_gained AGL 7 83048 8.42886E-5 41524 0 6.37714E-5
1-100382266-G-A p.Arg1487Gln missense AGL 4 83046 4.81661E-5 41523 0 0.00125
1-100382268-C-T p.His1488Tyr missense AGL 4 83046 4.81661E-5 41523 0 1.59327E-4
1-100382275-T-C p.Val1490Ala missense AGL 1 83038 1.20427E-5 41519 0 NA
1-100382289-T-C c.4481+2T>C splice_donor AGL 2 82986 2.41005E-5 41493 0 NA
1-100387084-A-G c.4482-6A>G splice_region AGL 3 82870 3.62013E-5 41435 0 NA
1-100387114-A-G p.Glu1502Glu synonymous AGL 4 83078 4.81475E-5 41539 0 3.18532E-5
1-100387122-A-G p.Asn1505Ser missense AGL 2 83116 2.40628E-5 41558 0 1.65262E-5
1-100387135-G-A p.Gln1509Gln synonymous AGL 1 83128 1.20296E-5 41564 0 7.96686E-6
1-100387136-T-TA p.Tyr1510fs frameshift AGL 3 83122 3.60915E-5 41561 0 1.99167E-5
1-100387142-C-T p.Pro1512Ser missense AGL 1 83124 1.20302E-5 41562 0 NA
1-100387147-C-T p.Phe1513Phe synonymous AGL 1 83124 1.20302E-5 41562 0 8.2616E-6
1-100387172-A-G p.Ile1522Val missense AGL 2 83064 2.40778E-5 41532 0 1.65276E-5
1-100387179-C-CAAAATAAAACAA p.Thr1524_Ile1525insLysTerAsnAsn stop_gained AGL 1 83020 1.20453E-5 41510 0 NA
1-100387180-T-G p.Thr1524Thr synonymous AGL 1 83004 1.20476E-5 41502 0 3.98832E-6
1-100387183-T-A p.Ile1525Ile synonymous AGL 25 82976 3.01292E-4 41488 0 0.00125
1-100387183-T-C p.Ile1525Ile synonymous AGL 1 82982 1.20508E-5 41491 0 NA
1-100387189-G-T p.Glu1527Asp missense AGL 2 82926 2.41179E-5 41463 0 8.2687E-6
1-100389579-T-C c.*2372T>C splice_region AGL 1 3040 3.28947E-4 1520 0 2.54858E-4