Variant

Variant ID Consequence Effect Gene AC AN AF NS NHOM maxEAF
2-228337148-G-C p.Ser4Thr missense AGFG1 1 64094 1.56021E-5 32047 0 NA
2-228337170-G-A p.Glu11Glu synonymous AGFG1 1 69550 1.43781E-5 34775 0 NA
2-228337182-G-A p.Lys15Lys synonymous AGFG1 1 71882 1.39117E-5 35941 0 4.14353E-5
2-228337200-C-T p.Thr21Thr synonymous AGFG1 2 73600 2.71739E-5 36800 0 2.20124E-5
2-228337201-G-A p.Gly22Ser missense AGFG1 1 73532 1.35995E-5 36766 0 NA
2-228337204-C-T p.Leu23Phe missense AGFG1 2 73890 2.70673E-5 36945 0 1.61697E-4
2-228337221-G-T p.Lys28Asn missense AGFG1 1 74300 1.34589E-5 37150 0 NA
2-228337236-C-T p.Asp33Asp synonymous AGFG1 3 74208 4.04269E-5 37104 0 8.97553E-6
2-228337242-C-G p.Arg35Arg synonymous AGFG1 1 73784 1.35531E-5 36892 0 4.52444E-6
2-228337248-C-T p.Pro37Pro synonymous AGFG1 1 73804 1.35494E-5 36902 0 NA
2-228337248-CA-C p.Thr38fs frameshift AGFG1 1 73804 1.35494E-5 36902 0 NA
2-228337266-G-C p.Thr43Thr synonymous AGFG1 1 72134 1.38631E-5 36067 0 8.80003E-6
2-228337296-C-T p.Ser53Ser synonymous AGFG1 3 65520 4.57875E-5 32760 0 1.94338E-4
2-228337301-G-C p.Ser55Thr missense AGFG1 1 64000 1.5625E-5 32000 0 NA
2-228337302-C-T p.Ser55Ser splice_region+synonymous AGFG1 1 63804 1.5673E-5 31902 0 NA
2-228356293-A-G p.Lys66Lys synonymous AGFG1 1 81822 1.22217E-5 40911 0 2.47639E-5
2-228356358-T-TCTGTAAACAGATTTGGCTAGGATTATTTGATGATAGATCTTCAGC c.261+2_261+3insCTGTAAACAGATTTGGCTAGGATTATTTGATGATAGATCTTCAGC splice_region AGFG1 2 80644 2.48004E-5 40322 1 NA
2-228356358-T-TCTGTAAACAGATTTGGCTAGGATTATTTGATGATAGATCTTC c.261+2_261+3insCTGTAAACAGATTTGGCTAGGATTATTTGATGATAGATCTTC splice_region AGFG1 4 80644 4.96007E-5 40322 2 NA
2-228373168-A-G c.-172A>G 5_prime_UTR_premature_start_codon_gain AGFG1 2 46876 4.26658E-5 23438 0 NA
2-228373186-T-C c.-154T>C 5_prime_UTR_premature_start_codon_gain AGFG1 1 48538 2.06024E-5 24269 0 NA
2-228373250-A-G c.-90A>G 5_prime_UTR_premature_start_codon_gain AGFG1 1 52572 1.90215E-5 26286 0 3.18532E-5
2-228373310-A-G c.-30A>G 5_prime_UTR_premature_start_codon_gain AGFG1 1 53358 1.87413E-5 26679 0 NA
2-228373326-C-G c.-14C>G 5_prime_UTR_premature_start_codon_gain AGFG1 1 53392 1.87294E-5 26696 0 6.64726E-6
2-228373358-C-T p.Arg7Cys missense AGFG1 1 53158 1.88118E-5 26579 0 2.00019E-5
2-228373359-G-A p.Arg7His missense AGFG1 3 53182 5.64101E-5 26591 0 1.61249E-4
2-228373365-A-G p.Lys9Arg missense+splice_region AGFG1 18 53142 3.38715E-4 26571 0 6.25E-4
2-228384669-T-C p.Cys89Cys synonymous AGFG1 2 82556 2.4226E-5 41278 0 3.35233E-5
2-228384684-A-G p.Leu94Leu synonymous AGFG1 2 82792 2.41569E-5 41396 0 3.1837E-5
2-228384692-T-G p.Phe97Cys missense AGFG1 1 82878 1.20659E-5 41439 0 9.55536E-5
2-228384710-C-T p.Ala103Val missense AGFG1 1 82906 1.20619E-5 41453 0 9.10067E-6
2-228384714-T-G p.Ile104Met missense AGFG1 1 82888 1.20645E-5 41444 0 NA
2-228384735-A-G p.Gln111Gln synonymous AGFG1 3508 82720 0.0424081 41360 84 0.058125
2-228384739-G-C p.Val113Leu missense AGFG1 1 82774 1.20811E-5 41387 0 4.63985E-6
2-228384747-G-A p.Glu115Glu synonymous AGFG1 1 82746 1.20852E-5 41373 0 NA
2-228384748-T-A p.Phe116Ile missense AGFG1 1 82728 1.20878E-5 41364 0 8.32459E-6
2-228384753-A-G p.Leu117Leu synonymous AGFG1 5 82680 6.04741E-5 41340 0 6.25E-4
2-228384755-A-G p.Gln118Arg missense AGFG1 1 82696 1.20925E-5 41348 0 NA
2-228384755-A-C p.Gln118Pro missense AGFG1 2 82696 2.4185E-5 41348 0 8.33959E-6
2-228388471-T-C c.378-8T>C splice_region AGFG1 2 82980 2.41022E-5 41490 0 1.07603E-4
2-228388481-A-G p.Tyr127Cys missense+splice_region AGFG1 2 83066 2.40772E-5 41533 0 NA
2-228388485-C-T p.Val128Val synonymous AGFG1 2 83100 2.40674E-5 41550 0 8.24824E-6
2-228388487-C-T p.Pro129Leu missense AGFG1 1 83108 1.20325E-5 41554 0 8.77501E-5
2-228388488-G-A p.Pro129Pro synonymous AGFG1 2 83086 2.40714E-5 41543 0 1.19676E-5
2-228388500-C-G p.Ala133Ala synonymous AGFG1 2 83124 2.40604E-5 41562 0 NA
2-228388502-A-C p.Lys134Thr missense AGFG1 1 83122 1.20305E-5 41561 0 NA
2-228388506-C-T p.Val135Val synonymous AGFG1 1 83102 1.20334E-5 41551 0 8.24049E-6
2-228388507-G-A p.Val136Met missense AGFG1 2 83092 2.40697E-5 41546 0 1.99124E-5
2-228388517-T-C p.Val139Ala missense AGFG1 370 83144 0.00445011 41572 0 0.0054218
2-228388535-G-A p.Gly145Glu missense AGFG1 1 83104 1.20331E-5 41552 0 NA
2-228388539-C-T p.Ser146Ser synonymous AGFG1 2 83108 2.40651E-5 41554 0 NA
2-228388549-A-G p.Ser150Gly missense AGFG1 1 83116 1.20314E-5 41558 0 NA
2-228388579-C-T p.Leu160Leu synonymous AGFG1 2 83112 2.40639E-5 41556 0 3.98042E-6
2-228388586-C-T p.Ser162Phe missense AGFG1 1 83114 1.20317E-5 41557 0 NA
2-228388591-T-C p.Leu164Leu synonymous AGFG1 4 83106 4.81313E-5 41553 0 3.18512E-5
2-228388597-G-T p.Asp166Tyr missense AGFG1 1 83100 1.20337E-5 41550 0 NA
2-228388633-C-T p.Pro178Ser missense AGFG1 1 83088 1.20354E-5 41544 0 7.96718E-6
2-228388641-G-GTCCCCAGTTGTAGGTCGTTCTCAAGGGCAGCAGCAGGAGAAGAA c.540_540+1insTCCCCAGTTGTAGGTCGTTCTCAAGGGCAGCAGCAGGAGAAGAA splice_donor AGFG1 2 83044 2.40836E-5 41522 1 NA
2-228388649-G-C c.540+8G>C splice_region AGFG1 10 82986 1.20502E-4 41493 0 3.46575E-4
2-228389488-T-C p.Val184Ala missense AGFG1 1 83362 1.19959E-5 41681 0 NA
2-228389490-G-T p.Gly185Cys missense AGFG1 1 83360 1.19962E-5 41680 0 NA
2-228389493-C-T p.Arg186Cys missense AGFG1 2 83364 2.39912E-5 41682 0 6.25E-4
2-228389494-G-T p.Arg186Leu missense AGFG1 2 83366 2.39906E-5 41683 0 NA
2-228389496-T-C p.Ser187Pro missense AGFG1 1 83364 1.19956E-5 41682 0 8.239E-6
2-228389511-CAGG-C p.Glu193del conservative_inframe_deletion AGFG1 1 83350 1.19976E-5 41675 0 1.64753E-5
2-228389520-A-C p.Lys195Gln missense AGFG1 5 83340 5.99952E-5 41670 0 3.18431E-5
2-228389525-A-G p.Gln196Gln synonymous AGFG1 21 83334 2.51998E-4 41667 0 6.25E-4
2-228389532-C-G p.Leu199Val missense AGFG1 1 83328 1.20008E-5 41664 0 NA
2-228389546-C-T p.Leu203Leu synonymous AGFG1 3 83326 3.60032E-5 41663 0 5.76673E-5
2-228389547-G-A p.Gly204Ser missense AGFG1 1 83332 1.20002E-5 41666 0 NA
2-228389549-C-T p.Gly204Gly synonymous AGFG1 1 83328 1.20008E-5 41664 0 NA
2-228389552-A-T p.Ser205Ser synonymous AGFG1 3 83328 3.60023E-5 41664 0 8.23818E-6
2-228389556-A-G p.Ile207Val missense AGFG1 1 83318 1.20022E-5 41659 0 7.95754E-6
2-228389563-C-T p.Ala209Val missense AGFG1 1 83306 1.20039E-5 41653 0 2.78569E-5
2-228389568-C-G p.Pro211Ala missense AGFG1 2 83308 2.40073E-5 41654 0 NA
2-228389571-G-C p.Ala212Pro missense AGFG1 5 83312 6.00154E-5 41656 0 5.03525E-4
2-228389572-C-T p.Ala212Val missense AGFG1 3 83318 3.60066E-5 41659 0 3.97864E-6
2-228389601-G-T p.Ala222Ser missense AGFG1 1 83274 1.20085E-5 41637 0 3.97867E-6
2-228389635-A-G c.694+4A>G splice_region AGFG1 5 83186 6.01063E-5 41593 0 6.25E-4
2-228395808-T-C p.Ala232Ala splice_region+synonymous AGFG1 1 83028 1.20441E-5 41514 0 3.1837E-5
2-228395812-A-G p.Asn234Asp missense AGFG1 1 83050 1.20409E-5 41525 0 NA
2-228395821-A-G p.Asn237Asp missense AGFG1 22 83102 2.64735E-4 41551 0 6.25E-4
2-228395859-T-C p.Ser249Ser synonymous AGFG1 2 83222 2.40321E-5 41611 0 3.18431E-5
2-228395870-G-C p.Ser253Thr missense AGFG1 1 83234 1.20143E-5 41617 0 8.24974E-6
2-228395886-C-T p.Phe258Phe synonymous AGFG1 2 83234 2.40286E-5 41617 0 3.98273E-6
2-228395901-C-T p.His263His synonymous AGFG1 1 83244 1.20129E-5 41622 0 3.98359E-6
2-228395902-T-A p.Ser264Thr missense AGFG1 34 83234 4.08487E-4 41617 0 5.73321E-4
2-228395905-C-T p.Pro265Ser missense AGFG1 1 83224 1.20158E-5 41612 0 NA
2-228395910-T-C p.Phe266Phe synonymous AGFG1 1 83210 1.20178E-5 41605 0 NA
2-228395912-A-G p.Gln267Arg missense AGFG1 3 83204 3.6056E-5 41602 0 1.99427E-5
2-228395917-C-A p.Gln269Lys missense AGFG1 1 83184 1.20215E-5 41592 0 NA
2-228395921-C-G p.Thr270Ser missense AGFG1 2 83170 2.40471E-5 41585 0 NA
2-228395923-A-G p.Thr271Ala missense AGFG1 1 83172 1.20233E-5 41586 0 7.98352E-6
2-228395924-C-G p.Thr271Arg missense+splice_region AGFG1 1 83168 1.20239E-5 41584 0 8.25014E-6
2-228395928-T-TGGA c.814+2_814+3insGGA splice_region AGFG1 2 83158 2.40506E-5 41579 0 NA
2-228395932-G-A c.814+6G>A splice_region AGFG1 2 83118 2.40622E-5 41559 0 1.00344E-4
2-228396866-T-C p.Leu276Pro missense AGFG1 1 81800 1.22249E-5 40900 0 NA
2-228396884-T-C p.Phe282Ser missense AGFG1 49 81868 5.98524E-4 40934 0 0.00162493
2-228396885-T-C p.Phe282Phe synonymous AGFG1 1 81870 1.22145E-5 40935 0 NA
2-228396896-C-T p.Thr286Ile missense AGFG1 1 81902 1.22097E-5 40951 0 NA
2-228396898-T-G p.Ser287Ala missense AGFG1 1 81910 1.22085E-5 40955 0 6.46738E-6
2-228396898-T-C p.Ser287Pro missense AGFG1 1 81910 1.22085E-5 40955 0 4.61297E-5
2-228396917-CTACCCACAG-C p.Thr294fs frameshift AGFG1 1 81926 1.22061E-5 40963 0 NA
2-228398265-G-A p.Gly272Asp missense+splice_region AGFG1 1 82838 1.20718E-5 41419 0 NA
2-228398275-T-C p.Ala275Ala synonymous AGFG1 3 82870 3.62013E-5 41435 0 NA
2-228398277-C-T p.Ala276Val missense AGFG1 2 82872 2.41336E-5 41436 0 NA
2-228398277-C-A p.Ala276Glu missense AGFG1 1 82872 1.20668E-5 41436 0 NA
2-228398293-T-A p.Asn281Lys missense AGFG1 2 82878 2.41319E-5 41439 0 NA
2-228398348-A-C p.Asn300His missense AGFG1 2 82640 2.42014E-5 41320 0 1.32129E-4
2-228398349-A-G p.Asn300Ser missense AGFG1 3 82636 3.63038E-5 41318 0 5.78082E-5
2-228398355-C-T p.Ser302Phe missense AGFG1 1 82588 1.21083E-5 41294 0 7.97327E-6
2-228398363-C-G p.His305Asp missense AGFG1 1 82572 1.21106E-5 41286 0 NA
2-228398385-G-C p.Ser312Thr missense AGFG1 2 82560 2.42248E-5 41280 0 NA
2-228398395-A-G p.Ser237Ser splice_region+synonymous AGFG1 1 82542 1.2115E-5 41271 0 3.18431E-5
2-228398396-A-G p.Thr316Ala missense AGFG1 1 82536 1.21159E-5 41268 0 6.36943E-5
2-228398398-G-A p.Thr316Thr synonymous AGFG1 2 82536 2.42319E-5 41268 0 5.03525E-4
2-228398401-C-G p.Asn317Lys missense AGFG1 1 82532 1.21165E-5 41266 0 NA
2-228398421-CA-TG p.Ala324Val missense AGFG1 1 82420 1.2133E-5 41210 0 NA
2-228398422-A-G p.Ala324Ala synonymous AGFG1 6272 82288 0.0762201 41144 268 0.0916247
2-228398431-T-C p.Tyr327Tyr synonymous AGFG1 2 82360 2.42836E-5 41180 0 1.65596E-5
2-228398450-G-T p.Asp334Tyr missense AGFG1 1 82170 1.21699E-5 41085 0 NA
2-228398454-A-T p.Asn335Ile missense AGFG1 2 82136 2.43499E-5 41068 0 NA
2-228398454-A-G p.Asn335Ser missense AGFG1 4 82136 4.86997E-5 41068 0 6.3932E-5
2-228398455-T-C p.Asn335Asn synonymous AGFG1 2 82122 2.4354E-5 41061 0 NA
2-228398457-T-C p.Ile336Thr missense AGFG1 18 82058 2.19357E-4 41029 0 6.25E-4
2-228398467-C-T p.Ala339Ala synonymous AGFG1 2 81876 2.44272E-5 40938 0 3.33617E-5
2-228398468-G-A p.Gly340Arg missense AGFG1 1 81852 1.22172E-5 40926 0 0.00100705
2-228398479-C-G c.1024+5C>G splice_region AGFG1 1 81586 1.2257E-5 40793 0 NA
2-228398481-A-G c.1024+7A>G splice_region AGFG1 1 81518 1.22672E-5 40759 0 8.42701E-6
2-228399553-G-A c.1025-8G>A splice_region AGFG1 8 82862 9.65461E-5 41431 0 2.2391E-4
2-228399553-G-C c.1025-8G>C splice_region AGFG1 1 82862 1.20683E-5 41431 0 NA
2-228399566-G-T p.Asp344Tyr missense AGFG1 2 83012 2.40929E-5 41506 0 NA
2-228399572-G-A p.Gly346Arg missense AGFG1 1 83054 1.20404E-5 41527 0 8.25982E-6
2-228399597-A-G p.Lys354Arg missense AGFG1 13 83134 1.56374E-4 41567 0 2.23001E-4
2-228399636-C-G p.Ser367* stop_gained AGFG1 2 83086 2.40714E-5 41543 0 NA
2-228399643-A-G p.Ala369Ala synonymous AGFG1 6 83050 7.22456E-5 41525 0 1.15433E-4
2-228399696-C-T p.Ala387Val missense AGFG1 1 83144 1.20273E-5 41572 0 NA
2-228399701-A-G p.Thr389Ala missense AGFG1 1 83160 1.2025E-5 41580 0 3.3006E-5
2-228399705-C-G p.Ser390Cys missense AGFG1 3 83180 3.60664E-5 41590 0 7.96546E-6
2-228399714-C-T p.Ala393Val missense AGFG1 6 83190 7.21241E-5 41595 0 4.95426E-5
2-228399715-G-A p.Ala393Ala synonymous AGFG1 29 83198 3.48566E-4 41599 0 6.25E-4
2-228399719-A-C p.Thr395Pro missense AGFG1 2 83202 2.40379E-5 41601 0 NA
2-228399723-C-T p.Ser396Phe missense AGFG1 1 83184 1.20215E-5 41592 0 8.26241E-6
2-228399725-A-G p.Thr397Ala missense AGFG1 1 83180 1.20221E-5 41590 0 8.26843E-6
2-228399729-G-A p.Ser398Asn missense AGFG1 4 83164 4.80977E-5 41582 0 1.91144E-4
2-228399734-G-A p.Ala400Thr missense AGFG1 2 83132 2.40581E-5 41566 0 4.03174E-6
2-228401341-C-G p.Ser402Arg missense+splice_region AGFG1 1 81758 1.22312E-5 40879 0 3.19183E-5
2-228401343-A-G p.Asn403Ser missense+splice_region AGFG1 2 81862 2.44314E-5 40931 0 5.03525E-4
2-228401345-G-A p.Val404Ile missense AGFG1 1 81904 1.22094E-5 40952 0 8.27404E-6
2-228401347-T-A p.Val404Val synonymous AGFG1 1 81972 1.21993E-5 40986 0 3.99495E-6
2-228401354-A-C p.Thr407Pro missense AGFG1 7 82090 8.52723E-5 41045 0 6.78572E-5
2-228401367-T-TTGCTTCTGCACAGACACAGCC p.Ser420_Ser421insAlaGlnThrGlnProAlaSer disruptive_inframe_insertion AGFG1 1 82326 1.21468E-5 41163 0 1.59502E-5
2-228401382-C-T p.Thr416Ile missense AGFG1 7 82484 8.48649E-5 41242 0 9.89527E-5
2-228401383-A-G p.Thr416Thr synonymous AGFG1 1 82504 1.21206E-5 41252 0 NA
2-228401386-G-A p.Gln417Gln synonymous AGFG1 1 82546 1.21145E-5 41273 0 NA
2-228401391-C-T p.Ala419Val missense AGFG1 2 82598 2.42137E-5 41299 0 NA
2-228401393-T-A p.Ser420Thr missense AGFG1 1 82624 1.2103E-5 41312 0 NA
2-228401423-A-G c.1285+3A>G splice_region AGFG1 1 82784 1.20796E-5 41392 0 8.24443E-6
2-228401425-G-A c.1285+5G>A splice_region AGFG1 1 82786 1.20793E-5 41393 0 NA
2-228401620-C-T p.Thr430Met missense AGFG1 7 83092 8.4244E-5 41546 0 2.48406E-5
2-228401621-G-A p.Thr430Thr synonymous AGFG1 1 83084 1.2036E-5 41542 0 2.78971E-5
2-228401623-C-T p.Pro431Leu missense AGFG1 2 83112 2.40639E-5 41556 0 8.27157E-6
2-228401627-C-A p.Ser432Ser synonymous AGFG1 2 83136 2.4057E-5 41568 0 NA
2-228401649-G-C p.Ala440Pro missense AGFG1 1 83216 1.20169E-5 41608 0 NA
2-228401668-C-T p.Ser446Phe missense AGFG1 1 83202 1.20189E-5 41601 0 NA
2-228401669-T-G p.Ser446Ser synonymous AGFG1 10 83204 1.20187E-4 41602 0 4.45746E-4
2-228401670-T-C p.Ser447Pro missense AGFG1 5 83200 6.00962E-5 41600 0 3.97975E-6
2-228401687-G-T p.Gln452His missense AGFG1 2 83178 2.40448E-5 41589 0 8.24946E-6
2-228401709-G-GCGGCAACCTTTGGCACTGCATCCATGAGCATGCCCACGGGATTCGGCACTCCT c.1378_1378+1insCGGCAACCTTTGGCACTGCATCCATGAGCATGCCCACGGGATTCGGCACTCCT splice_donor AGFG1 2 83088 2.40709E-5 41544 1 NA
2-228414786-G-A p.Ala17Thr missense AGFG1 1 53004 1.88665E-5 26502 0 NA
2-228414800-A-G p.Gln21Gln synonymous AGFG1 2 52832 3.78558E-5 26416 0 2.39927E-5
2-228414806-T-C p.Phe23Phe synonymous AGFG1 5 52816 9.46683E-5 26408 0 3.9692E-5
2-228414812-C-T p.His25His synonymous AGFG1 3 52736 5.68871E-5 26368 0 1.91058E-4
2-228414815-T-C p.Ala26Ala synonymous AGFG1 1 52794 1.89415E-5 26397 0 NA
2-228414818-T-G p.His27Gln missense AGFG1 1 52720 1.89681E-5 26360 0 3.1839E-5
2-228416668-C-T c.1379-7C>T splice_region AGFG1 1 83240 1.20135E-5 41620 0 NA
2-228416675-C-T p.Ala460Val missense+splice_region AGFG1 12 83242 1.44158E-4 41621 0 1.99513E-4
2-228416699-T-C p.Met468Thr missense AGFG1 1 83258 1.20109E-5 41629 0 8.23886E-6
2-228416700-G-A p.Met468Ile missense AGFG1 1 83262 1.20103E-5 41631 0 1.19355E-5
2-228416710-A-G p.Thr472Ala missense AGFG1 2 83252 2.40234E-5 41626 0 3.18431E-5
2-228416712-A-G p.Thr472Thr synonymous AGFG1 61052 82306 0.741769 41153 22677 0.800625
2-228416718-C-T p.Phe474Phe synonymous AGFG1 19 83230 2.28283E-4 41615 0 3.50274E-4
2-228416719-G-A p.Gly475Ser missense AGFG1 1 83222 1.20161E-5 41611 0 2.47129E-5
2-228416723-C-G p.Thr476Ser missense AGFG1 1 83236 1.2014E-5 41618 0 NA
2-228416725-C-G p.Pro477Ala missense AGFG1 1 83246 1.20126E-5 41623 0 NA
2-228416728-G-A p.Ala478Thr missense AGFG1 1 83244 1.20129E-5 41622 0 NA
2-228416733-C-T p.Pro479Pro synonymous AGFG1 1 83238 1.20137E-5 41619 0 3.97829E-6
2-228416754-T-C p.Phe486Phe synonymous AGFG1 6 83242 7.2079E-5 41621 0 2.47137E-5
2-228416762-GC-TT p.Ser489Ile missense AGFG1 1 83226 1.20155E-5 41613 0 NA
2-228416768-A-G p.Gln491Arg missense AGFG1 3 83236 3.60421E-5 41618 0 3.97785E-6
2-228416778-C-T p.Ala494Ala synonymous AGFG1 2 83246 2.40252E-5 41623 0 NA
2-228416779-T-C p.Phe495Leu missense AGFG1 1 83244 1.20129E-5 41622 0 NA
2-228416799-C-T p.Phe501Phe synonymous AGFG1 5 83212 6.00875E-5 41606 0 1.91083E-4
2-228416811-A-C p.Thr505Thr synonymous AGFG1 2 83178 2.40448E-5 41589 0 3.29669E-5
2-228416829-C-T p.Pro511Pro synonymous AGFG1 7 83050 8.42866E-5 41525 0 3.29984E-5
2-228416830-A-G p.Asn512Asp missense AGFG1 1 83048 1.20412E-5 41524 0 5.77443E-5
2-228416831-A-G p.Asn512Ser missense+splice_region AGFG1 8 83036 9.63438E-5 41518 0 1.07247E-4
2-228418420-G-A p.Gly513Asp missense+splice_region AGFG1 1 83322 1.20016E-5 41661 0 NA
2-228418433-A-G p.Ala517Ala synonymous AGFG1 21 83322 2.52034E-4 41661 0 0.003125
2-228418441-G-A p.Gly520Glu missense AGFG1 1 83338 1.19993E-5 41669 0 NA
2-228418451-G-A p.Lys523Lys synonymous AGFG1 4 83344 4.79939E-5 41672 0 1.27437E-4
2-228418458-G-C p.Val526Leu missense AGFG1 3 83338 3.5998E-5 41669 0 3.18451E-5
2-228418464-C-G p.Pro528Ala missense AGFG1 8 83344 9.59877E-5 41672 0 6.76159E-5
2-228418489-G-A p.Gly536Glu missense AGFG1 1 83336 1.19996E-5 41668 0 NA
2-228418505-T-A p.Pro541Pro synonymous AGFG1 1 83248 1.20123E-5 41624 0 NA
2-228418506-T-A p.Phe542Ile missense AGFG1 17 83224 2.04268E-4 41612 0 1.35878E-4
2-228419171-A-G p.Gln550Arg missense AGFG1 22 83146 2.64595E-4 41573 0 1.67245E-4
2-228419172-A-G p.Gln550Gln synonymous AGFG1 7 83150 8.41852E-5 41575 0 5.03525E-4
2-228419194-A-G p.Thr558Ala missense AGFG1 2 83138 2.40564E-5 41569 0 1.99118E-5
2-228419206-T-C p.Leu562Leu synonymous AGFG1 1 83134 1.20288E-5 41567 0 NA
2-228419208-A-T p.Leu562Phe missense AGFG1 1 83130 1.20294E-5 41565 0 NA
2-228419275-G-T c.*64G>T splice_region AGFG1 2 82250 2.43161E-5 41125 0 NA
2-228420429-GAACTTGTTTAAGTATCTATGTACAGTAATGCCTCATTCATCTAGAGGTAATCTGGCAGTCTTGTGAAAACCGAAC-G c.*1220_*1294delACTTGTTTAAGTATCTATGTACAGTAATGCCTCATTCATCTAGAGGTAATCTGGCAGTCTTGTGAAAACCGAACA splice_region AGFG1 1 43318 2.30851E-5 21659 0 NA
2-228420437-TTAAG-T c.*1229_*1232delAGTA splice_region AGFG1 1 43290 2.31E-5 21645 0 NA
2-228420443-A-G c.*1232A>G splice_region AGFG1 1 43238 2.31278E-5 21619 0 NA