Variant

Variant ID Consequence Effect Gene AC AN AF NS NHOM maxEAF
6-32148920-T-A p.Ter295Cysext*? stop_lost AGER 1 83314 1.20028E-5 41657 0 8.2375E-6
6-32148926-C-T p.Gly293Gly synonymous AGER 7 83316 8.40175E-5 41658 0 6.25E-4
6-32148927-C-T p.Gly293Glu missense AGER 3 83330 3.60014E-5 41665 0 1.59337E-4
6-32148941-C-CT p.Ser289fs frameshift AGER 1 83360 1.19962E-5 41680 0 NA
6-32148943-C-CGCCTGCCT p.Glu288fs frameshift AGER 2 83352 2.39946E-5 41676 0 NA
6-32148946-C-G p.Gly287Arg missense AGER 72 83362 8.63703E-4 41681 2 0.004375
6-32148957-T-C p.Glu283Gly missense AGER 8 83376 9.59509E-5 41688 0 1.64731E-5
6-32148958-C-T p.Gly341Glu missense AGER 3 83384 3.59781E-5 41692 0 6.37227E-5
6-32148963-G-A p.Ser281Leu missense AGER 7 83368 8.39651E-5 41684 0 6.25E-4
6-32148966-T-C p.Gln280Arg missense AGER 1 83380 1.19933E-5 41690 0 NA
6-32148981-C-T p.Arg275His missense AGER 3 83378 3.59807E-5 41689 0 9.55779E-5
6-32148982-G-A p.Ala333Val missense AGER 1 83368 1.1995E-5 41684 0 NA
6-32148989-CT-C p.Gly331fs frameshift AGER 1 83366 1.19953E-5 41683 0 NA
6-32149011-G-A p.Ala265Val missense AGER 3 83338 3.5998E-5 41669 0 0.00108932
6-32149012-C-A p.Gly323Val missense AGER 1 83336 1.19996E-5 41668 0 0.00108932
6-32149018-TGAG-T c.*30-5_*30-3delCTC splice_region AGER 1 83322 1.20016E-5 41661 0 NA
6-32149127-C-T c.*370+1G>A splice_donor AGER 3 82890 3.61925E-5 41445 0 1.19931E-5
6-32149128-C-T p.Arg263Lys missense+splice_region AGER 2 82878 2.41319E-5 41439 0 7.99418E-6
6-32149133-C-A p.Gly320* stop_gained AGER 3 82790 3.62363E-5 41395 0 3.18492E-5
6-32149140-C-T p.Arg259Gln missense AGER 441 82620 0.00533769 41310 9 0.0475
6-32149141-G-C p.Pro317Arg missense AGER 11 82544 1.33262E-4 41272 0 1.27405E-4
6-32149143-C-T p.Arg258His missense AGER 2 82480 2.42483E-5 41240 0 2.51319E-5
6-32149144-G-A p.Thr316Met missense AGER 1 82474 1.2125E-5 41237 0 1.67636E-5
6-32149144-G-T p.Thr316Lys missense AGER 1 82474 1.2125E-5 41237 0 9.55597E-5
6-32149146-T-G p.Gln257Pro missense AGER 1 82450 1.21286E-5 41225 0 8.40859E-6
6-32149149-C-T p.Arg256Gln missense AGER 1 82334 1.21457E-5 41167 0 3.18431E-5
6-32149150-G-A p.Ala314Val missense AGER 10 82230 1.2161E-4 41115 0 4.62721E-4
6-32149164-A-T p.His309Gln missense AGER 1 81980 1.21981E-5 40990 0 NA
6-32149167-A-T p.Val250Asp missense AGER 1 81914 1.22079E-5 40957 0 NA
6-32149170-C-T p.Trp307* stop_gained AGER 2 81884 2.44248E-5 40942 0 1.69265E-5
6-32149173-A-G p.Ile248Thr missense AGER 1 81838 1.22193E-5 40919 0 4.23542E-5
6-32149175-G-A p.His306Tyr missense AGER 1 81832 1.22202E-5 40916 0 8.48464E-6
6-32149182-G-T p.Ala245Asp missense AGER 2 81670 2.44888E-5 40835 0 NA
6-32149184-G-A p.Arg303Cys missense AGER 2 81638 2.44984E-5 40819 0 3.18695E-5
6-32149217-CAGGGCTAG-C p.Ser289fs frameshift AGER 1 81498 1.22702E-5 40749 0 4.04433E-6
6-32149218-A-G p.Leu233Pro missense AGER 1 81502 1.22696E-5 40751 0 NA
6-32149219-G-A p.Pro291Leu missense AGER 169 81502 0.00207357 40751 0 0.00875
6-32149234-G-A p.Ala286Val missense AGER 1 81492 1.22711E-5 40746 0 NA
6-32149242-C-G p.Arg283Ser missense AGER 4 81496 4.90822E-5 40748 0 3.18674E-5
6-32149251-G-C p.Ser222Cys missense AGER 1 81496 1.22705E-5 40748 0 2.57506E-5
6-32149253-GCCTGTACGGAGACAGGGAAAATTGAGAGCACAGCCACCACCACTCACCATTCCTTTCTTGTTGACCATCCCCCCAGTCACATGTGTTGGGGGCTATCTTCTGCTTCCCTGACTTTATCAAACCCCTCA-G p.Arg279fs frameshift AGER 2 81484 2.45447E-5 40742 0 NA
6-32149260-C-T c.*244-6G>A splice_region AGER 2036 81472 0.0249902 40736 85 0.0356005
6-32149262-G-T c.*244-8C>A splice_region AGER 1 81486 1.2272E-5 40743 0 NA
6-32149299-A-T c.*29+2T>A splice_donor AGER 1 81494 1.22708E-5 40747 0 NA
6-32149301-C-T c.*29G>A splice_region AGER 1 81504 1.22693E-5 40752 0 NA
6-32149332-A-G p.Ter348Argext*? stop_lost AGER 3 81506 3.68071E-5 40753 0 1.5951E-4
6-32149335-T-C p.Met347Val missense AGER 4 81508 4.90749E-5 40754 0 1.72061E-4
6-32149356-C-T p.Ala340Thr missense AGER 1 81508 1.22687E-5 40754 0 NA
6-32149365-C-G p.Val337Leu missense AGER 27 81512 3.3124E-4 40756 0 5.4147E-4
6-32149369-A-G p.Asp335Asp synonymous AGER 1 81514 1.22678E-5 40757 0 NA
6-32149386-C-T p.Ala330Thr missense AGER 1 81506 1.2269E-5 40753 0 NA
6-32149393-C-T p.Ala276Thr missense AGER 1 81494 1.22708E-5 40747 0 3.44216E-5
6-32149399-C-T p.Gly274Arg missense AGER 1 81496 1.22705E-5 40748 0 4.05551E-6
6-32149401-C-T p.Glu325Lys missense AGER 1 81496 1.22705E-5 40748 0 3.18593E-5
6-32150024-C-T p.Glu322Lys missense+splice_region AGER 4 77612 5.15384E-5 38806 0 6.37796E-5
6-32150025-G-C p.Ile321Met missense+splice_region AGER 1 77694 1.2871E-5 38847 0 3.18837E-5
6-32150037-G-A p.Ser317Ser synonymous AGER 4 78204 5.11483E-5 39102 0 4.05801E-6
6-32150039-T-C p.Ser317Gly missense AGER 6 78206 7.67205E-5 39103 0 3.18837E-4
6-32150047-C-T p.Arg314His missense AGER 201 78242 0.00256895 39121 1 0.00433508
6-32150048-G-A p.Arg314Cys missense AGER 3 78266 3.83308E-5 39133 0 8.61861E-6
6-32150050-C-T p.Ser313Asn missense AGER 1 78290 1.2773E-5 39145 0 NA
6-32150063-C-T p.Gly309Arg missense AGER 144 78208 0.00184124 39104 0 0.00106906
6-32150064-G-A p.His308His synonymous AGER 19 78300 2.42656E-4 39150 0 1.27527E-4
6-32150065-T-G p.His308Pro missense AGER 2 78326 2.55343E-5 39163 0 2.84135E-5
6-32150086-C-G p.Cys301Ser missense AGER 231 78040 0.00296002 39020 4 0.00217865
6-32150107-TGAGGCCCTATCTCAGG-T p.Pro289fs frameshift AGER 10 77542 1.28962E-4 38771 0 5.69018E-5
6-32150110-G-A p.Pro293Leu missense AGER 38 77416 4.90855E-4 38708 1 2.76385E-4
6-32150122-G-C p.Pro289Arg missense AGER 1 76960 1.29938E-5 38480 0 1.22092E-5
6-32150136-AGGGCTGG-A p.Pro282fs frameshift AGER 6 76188 7.87526E-5 38094 0 9.57854E-5
6-32150162-C-T p.Val276Met missense AGER 2 74782 2.67444E-5 37391 0 3.1902E-5
6-32150169-G-A c.823-4C>T splice_region AGER 1 74460 1.343E-5 37230 0 NA
6-32150314-AC-A c.809+1delG splice_donor AGER 1 80664 1.23971E-5 40332 0 NA
6-32150323-C-T p.Ala268Thr missense AGER 2 80902 2.47213E-5 40451 0 NA
6-32150326-C-T p.Gly267Arg missense AGER 2 80992 2.46938E-5 40496 0 NA
6-32150334-A-G p.Leu264Pro missense AGER 3 81140 3.69731E-5 40570 0 1.62402E-5
6-32150342-CA-C p.Val261fs frameshift AGER 1 81248 1.2308E-5 40624 0 NA
6-32150348-C-T p.Lys273Lys synonymous AGER 1 81300 1.23001E-5 40650 0 NA
6-32150356-A-T p.Trp271Arg missense AGER 242 81316 0.00297604 40658 4 0.00214965
6-32150376-T-C p.Gln264Arg missense AGER 1 81398 1.22853E-5 40699 0 NA
6-32150380-C-T p.Ala263Thr missense AGER 1 81390 1.22865E-5 40695 0 NA
6-32150385-A-T p.Val261Asp missense AGER 9 81400 1.10565E-4 40700 0 6.38407E-5
6-32150391-C-A p.Cys259Phe missense AGER 4 81414 4.91316E-5 40707 0 8.60541E-6
6-32150399-G-T p.Thr256Thr synonymous AGER 1 81430 1.22805E-5 40715 0 NA
6-32150401-T-C p.Thr256Ala missense AGER 1 81412 1.22832E-5 40706 0 NA
6-32150405-G-A p.Thr254Thr synonymous AGER 1 81432 1.22802E-5 40716 0 1.21655E-5
6-32150423-TGCTCCACCTTCTG-T p.Pro244fs frameshift AGER 3 81444 3.68351E-5 40722 0 3.18593E-5
6-32150423-T-C p.Gln121Arg missense AGER 2 81444 2.45567E-5 40722 0 NA
6-32150426-T-G p.Glu120Ala missense AGER 1 81440 1.2279E-5 40720 0 NA
6-32150427-C-T p.Gly247Glu missense AGER 1 81444 1.22784E-5 40722 0 1.72111E-5
6-32150430-C-T p.Gly246Asp missense AGER 6 81438 7.36757E-5 40719 0 2.23044E-4
6-32150430-C-A p.Gly246Val missense AGER 2 81440 2.4558E-5 40720 0 NA
6-32150443-C-T p.Trp114* stop_gained AGER 1 81436 1.22796E-5 40718 0 3.18593E-5
6-32150446-C-G p.Val241Leu missense AGER 6 81436 7.36775E-5 40718 0 2.15154E-4
6-32150449-A-G p.Leu240Leu synonymous AGER 3 81440 3.68369E-5 40720 0 3.44246E-5
6-32150450-T-C p.Asn112Ser missense AGER 2 81430 2.4561E-5 40715 0 NA
6-32150455-C-A p.Lys110Asn missense+splice_region AGER 1 81430 1.22805E-5 40715 0 1.72132E-5
6-32150456-C-T c.330-1G>A splice_acceptor AGER 1 81428 1.22808E-5 40714 0 NA
6-32150456-CT-C p.Glu237fs frameshift AGER 2 81428 2.45616E-5 40714 0 NA
6-32150617-C-A c.691+1G>T splice_donor AGER 1 78050 1.28123E-5 39025 0 NA
6-32150619-CCA-C p.Trp230fs frameshift AGER 1 78098 1.28044E-5 39049 0 1.73488E-5
6-32150622-G-A p.Val229Val synonymous AGER 1 78192 1.2789E-5 39096 0 NA
6-32150623-ACACGGGGC-A p.Gln226fs frameshift AGER 1 78192 1.2789E-5 39096 0 NA
6-32150624-C-T p.Val229Ile missense AGER 1 78252 1.27792E-5 39126 0 NA
6-32150626-C-T p.Arg228His missense AGER 2 78264 2.55545E-5 39132 0 3.18451E-5
6-32150628-G-C p.Pro227Pro synonymous AGER 2 78422 2.5503E-5 39211 0 NA
6-32150629-G-A p.Pro227Leu missense AGER 3 78448 3.82419E-5 39224 0 1.73409E-5
6-32150637-G-C p.Pro224Pro synonymous AGER 1 78884 1.26768E-5 39442 0 NA
6-32150638-G-T p.Pro224His missense AGER 2 78908 2.5346E-5 39454 0 4.09863E-6
6-32150647-C-T p.Arg234His missense+splice_region AGER 3 79028 3.79612E-5 39514 0 3.18512E-5
6-32150648-G-A p.Arg221Cys missense AGER 1 79146 1.26349E-5 39573 0 1.73076E-5
6-32150656-C-T p.Arg218Gln missense AGER 10 79500 1.25786E-4 39750 0 6.54702E-5
6-32150657-G-A p.Arg218Trp missense AGER 5 79672 6.27573E-5 39836 0 3.45674E-5
6-32150663-G-A p.Arg216* stop_gained AGER 1 79910 1.25141E-5 39955 0 2.59023E-5
6-32150668-AG-A p.Leu214fs frameshift AGER 7 80266 8.721E-5 40133 0 3.18512E-5
6-32150675-G-A p.Pro212Ser missense AGER 1 80524 1.24187E-5 40262 0 8.15421E-6
6-32150692-A-G p.Phe206Ser missense AGER 4 80920 4.94315E-5 40460 0 4.30849E-5
6-32150697-G-A p.Pro204Pro synonymous AGER 5 81008 6.17223E-5 40504 1 NA
6-32150701-C-T p.Arg203His missense AGER 1 81058 1.23368E-5 40529 0 3.66461E-5
6-32150702-G-A p.Arg203Cys missense AGER 2 81086 2.46652E-5 40543 0 8.61356E-6
6-32150704-G-C p.Pro202Arg missense AGER 1 81118 1.23277E-5 40559 0 NA
6-32150705-G-A p.Pro202Ser missense AGER 6 81130 7.39554E-5 40565 0 3.18613E-5
6-32150707-T-A p.Asp201Val missense AGER 1 81154 1.23223E-5 40577 0 NA
6-32150716-C-T p.Arg198Gln missense AGER 1 81226 1.23113E-5 40613 0 3.18573E-5
6-32150717-G-A p.Arg198Trp missense AGER 8 81242 9.84712E-5 40621 0 6.37186E-5
6-32150717-G-T p.Arg198Arg synonymous AGER 2 81242 2.46178E-5 40621 0 3.44364E-5
6-32150739-C-A p.Ser190Ser synonymous AGER 1 81358 1.22914E-5 40679 0 3.18756E-5
6-32150740-G-A p.Ser190Leu missense AGER 1 81372 1.22892E-5 40686 0 1.7212E-5
6-32150775-C-G p.Arg178Ser missense AGER 2 81428 2.45616E-5 40714 0 5.27276E-5
6-32150784-T-C p.Glu175Glu synonymous AGER 21 81412 2.57947E-4 40706 0 1.70343E-4
6-32150786-C-T p.Glu175Lys missense AGER 1 81414 1.22829E-5 40707 0 NA
6-32150795-A-G p.Ser172Pro missense AGER 2 81416 2.45652E-5 40708 0 3.18573E-5
6-32150799-TCCTATGATGGGAGGATAAGACAAATTATCCCAGGGTGGGTGTGGGAGTGAGATCAGGGAGAAGGCAGCTTGGGGGGCACCTTAGGACTCA-T p.Gly170fs frameshift AGER 7 81406 8.59888E-5 40703 0 NA
6-32150883-G-C c.508+8C>G splice_region AGER 1 81482 1.22726E-5 40741 0 3.18715E-5
6-32150885-A-G c.508+6T>C splice_region AGER 4 81488 4.9087E-5 40744 0 3.19305E-5
6-32150887-T-C c.508+4A>G splice_region AGER 3 81486 3.68161E-5 40743 0 4.05512E-6
6-32150890-C-A c.508+1G>T splice_donor AGER 13 81492 1.59525E-4 40746 0 1.03256E-4
6-32150895-CTC-TTT p.Glu168Lys missense AGER 1 81484 1.22723E-5 40742 0 NA
6-32150902-G-A p.Pro166Leu missense AGER 1 81492 1.22711E-5 40746 0 NA
6-32150909-G-C p.Leu164Val missense AGER 1 81492 1.22711E-5 40746 0 8.60452E-6
6-32150922-C-G p.Leu159Phe missense AGER 35 81488 4.29511E-4 40744 0 7.70429E-5
6-32150922-CA-C p.Leu159fs frameshift AGER 1 81488 1.22717E-5 40744 0 NA
6-32150929-C-T p.Trp157* stop_gained AGER 3 81492 3.68134E-5 40746 0 3.18654E-5
6-32150936-G-A p.Leu155Phe missense AGER 1 81494 1.22708E-5 40747 0 5.44662E-4
6-32150960-C-CT p.Glu147fs frameshift AGER 3 81494 3.68125E-5 40747 0 NA
6-32150965-A-C p.Val145Gly missense AGER 1 81496 1.22705E-5 40748 0 NA
6-32150967-A-C p.Cys144Trp missense AGER 7 81498 8.58917E-5 40749 0 6.37592E-5
6-32150968-CAT-C p.Ser146fs frameshift AGER 1 81496 1.22705E-5 40748 0 3.18756E-5
6-32150970-T-C p.Thr143Thr synonymous AGER 2 81492 2.45423E-5 40746 0 5.44662E-4
6-32150972-T-G p.Thr143Pro missense AGER 1 81498 1.22702E-5 40749 0 NA
6-32150976-CACCTGGGGAAAGAGTGGTGACCTCAGAATCCTTTGAAAATGAGAGATGCCACACACCCACACCCACACACACTCGCCTCCTGTTCACAGGGCCGTTTTCTACTTCTCCTGCTTTCTTCCACT-C p.Val141fs frameshift AGER 5 81500 6.13497E-5 40750 0 NA
6-32150978-C-T p.Val141Met missense+splice_region AGER 1 81502 1.22696E-5 40751 0 3.18776E-5
6-32150980-TG-T c.421-3delC splice_region AGER 13 81504 1.59501E-4 40752 0 2.84037E-4
6-32150983-G-A c.421-5C>T splice_region AGER 1 81498 1.22702E-5 40749 0 NA
6-32151045-A-C c.468+8T>G splice_region AGER 7 81504 8.58854E-5 40752 0 6.37267E-5
6-32151046-CA-C c.468+6delT splice_region AGER 1 81506 1.2269E-5 40753 0 NA
6-32151050-C-T c.468+3G>A splice_region AGER 12 81508 1.47225E-4 40754 0 2.2293E-4
6-32151051-G-A c.468+2C>T splice_donor AGER 4 81506 4.90761E-5 40753 0 1.72417E-5
6-32151063-C-T p.Cys153Tyr missense AGER 6 81498 7.36214E-5 40749 0 NA
6-32151071-T-A p.Lys150Asn missense AGER 2 81508 2.45375E-5 40754 0 NA
6-32151072-T-C p.Lys150Arg missense AGER 3 81508 3.68062E-5 40754 0 8.60733E-6
6-32151080-TCTC-T p.Arg147del disruptive_inframe_deletion AGER 6 81500 7.36196E-5 40750 0 9.5584E-5
6-32151101-C-T p.Lys140Lys splice_region+synonymous AGER 2 81500 2.45399E-5 40750 0 8.10885E-6
6-32151104-A-G p.Asn139Asn synonymous AGER 1 81502 1.22696E-5 40751 0 NA
6-32151105-T-C p.Asn139Ser missense AGER 2 81500 2.45399E-5 40750 0 4.05459E-6
6-32151117-G-A p.Ala135Val missense AGER 1 81502 1.22696E-5 40751 0 4.05456E-6
6-32151118-C-A p.Ala135Ser missense AGER 1 81506 1.2269E-5 40753 0 NA
6-32151131-G-A p.Ala130Ala synonymous AGER 4 81490 4.90858E-5 40745 0 1.72153E-5
6-32151135-G-C p.Ser129Cys missense AGER 2 81488 2.45435E-5 40744 0 NA
6-32151136-A-C p.Ser129Ala missense AGER 1 81488 1.22717E-5 40744 0 NA
6-32151138-TC-T p.Asp128fs frameshift AGER 1 81488 1.22717E-5 40744 0 4.05512E-6
6-32151142-C-T p.Val127Ile missense AGER 1 81488 1.22717E-5 40744 0 8.1103E-6
6-32151148-C-T p.Glu125Lys missense AGER 1 81484 1.22723E-5 40742 0 4.05538E-6
6-32151151-G-A p.Pro124Ser missense AGER 1 81480 1.2273E-5 40740 0 3.1841E-5
6-32151161-A-T p.Ile120Ile synonymous AGER 1 81480 1.2273E-5 40740 0 NA
6-32151165-TCTGAA-T p.Ser131fs frameshift AGER 1 81476 1.22736E-5 40738 0 NA
6-32151172-GAGGAAAAA-G p.Ile127fs frameshift AGER 1 81468 1.22748E-5 40734 0 NA
6-32151175-G-GA p.Pro129fs frameshift AGER 1 81468 1.22748E-5 40734 0 1.72661E-5
6-32151177-A-G p.Phe128Ser missense AGER 1 81468 1.22748E-5 40734 0 NA
6-32151193-C-T p.Ala123Thr missense AGER 1 81446 1.22781E-5 40723 0 NA
6-32151214-A-T p.Leu116Met missense AGER 2 81442 2.45574E-5 40721 0 4.06851E-6
6-32151217-T-TTTCCATTC c.343-1_343insGAATGGAA splice_acceptor AGER 1 81438 1.22793E-5 40719 0 NA
6-32151218-C-G c.343-1G>C splice_acceptor AGER 24 81434 2.94717E-4 40717 0 6.25782E-4
6-32151218-C-T c.343-1G>A splice_acceptor AGER 1 81434 1.22799E-5 40717 0 4.06884E-6
6-32151219-T-C c.343-2A>G splice_acceptor AGER 2 81442 2.45574E-5 40721 0 4.06888E-6
6-32151222-G-A c.343-5C>T splice_region AGER 20582 81266 0.253267 40633 3057 0.276596
6-32151331-C-T c.355+1G>A splice_donor AGER 1 81502 1.22696E-5 40751 0 6.88812E-5
6-32151340-C-A p.Arg116Leu missense AGER 6 81504 7.3616E-5 40752 0 1.27429E-4
6-32151340-C-T p.Arg116His missense AGER 1 81504 1.22693E-5 40752 0 3.18573E-5
6-32151342-G-GACTCGGTA p.Arg116fs frameshift AGER 1 81502 1.22696E-5 40751 0 4.05551E-6
6-32151347-G-A p.Arg114* stop_gained AGER 1 81502 1.22696E-5 40751 0 2.02777E-5
6-32151353-T-A p.Asn112Tyr missense AGER 1 81502 1.22696E-5 40751 0 NA
6-32151354-G-A c.329+4C>T splice_region AGER 1 81500 1.22699E-5 40750 0 1.21664E-5
6-32151367-T-C p.Lys107Arg missense AGER 1 81502 1.22696E-5 40751 0 8.60704E-6
6-32151372-A-G p.Asn105Asn synonymous AGER 1 81496 1.22705E-5 40748 0 1.21657E-5
6-32151379-T-C p.Asn103Ser missense AGER 2 81492 2.45423E-5 40746 0 NA
6-32151388-T-A p.Gln100Leu missense AGER 2 81488 2.45435E-5 40744 0 8.60704E-6
6-32151395-G-A p.Arg98Trp missense AGER 2 81462 2.45513E-5 40731 0 NA
6-32151403-C-G p.Gly95Ala missense AGER 1 81458 1.22763E-5 40729 0 NA
6-32151419-C-T p.Gly90Arg missense AGER 3 81368 3.68695E-5 40684 0 3.65307E-5
6-32151420-G-C p.Val89Val synonymous AGER 5354 81318 0.0658403 40659 237 0.0799796
6-32151427-G-A p.Pro87Leu missense AGER 10 81348 1.22929E-4 40674 0 0.005
6-32151431-G-A p.Leu86Phe missense AGER 3 81344 3.68804E-5 40672 0 1.62505E-5
6-32151442-C-A p.Gly82Val missense AGER 1 81326 1.22962E-5 40663 0 NA
6-32151443-C-T p.Gly82Ser missense AGER 2695 81268 0.0331619 40634 85 0.0534296
6-32151444-G-A c.-61C>T 5_prime_UTR_premature_start_codon_gain AGER 18 81304 2.21391E-4 40652 0 4.14197E-4
6-32151457-C-T p.Arg77His missense AGER 1 81216 1.23128E-5 40608 0 6.37877E-5
6-32151458-G-A p.Arg77Cys missense AGER 719 81384 0.00883466 40692 8 0.0375817
6-32151471-C-T p.Trp72* stop_gained AGER 5 81454 6.13843E-5 40727 0 4.07014E-6
6-32151474-G-C p.Pro71Pro synonymous AGER 1 81460 1.2276E-5 40730 0 9.5584E-5
6-32151477-G-T p.Gly70Gly synonymous AGER 24 81448 2.94667E-4 40724 0 4.14224E-4
6-32151479-C-T p.Gly70Ser missense AGER 2 81456 2.45531E-5 40728 0 8.65202E-6
6-32151481-C-T p.Gly69Glu missense AGER 1 81464 1.22754E-5 40732 0 NA
6-32151501-CT-C p.Lys62fs frameshift AGER 5 81476 6.13678E-5 40738 0 8.67423E-6
6-32151501-C-T p.Lys62Lys synonymous AGER 1 81476 1.22736E-5 40738 0 8.67423E-6
6-32151517-C-T p.Arg57Gln missense AGER 3 81470 3.68234E-5 40735 0 2.6086E-5
6-32151518-G-C p.Arg57Gly missense AGER 3 81470 3.68234E-5 40735 0 1.63157E-5
6-32151526-T-C p.Asn54Ser missense+splice_region AGER 2 81468 2.45495E-5 40734 0 NA
6-32151527-T-C p.Asn54Asp missense+splice_region AGER 1 81464 1.22754E-5 40732 0 NA
6-32151528-C-G c.160-1G>C splice_acceptor AGER 6 81464 7.36522E-5 40732 0 1.22419E-5
6-32151531-G-C c.160-4C>G splice_region AGER 1 81462 1.22757E-5 40731 0 NA
6-32151651-C-T c.159+7G>A splice_region AGER 1 81440 1.2279E-5 40720 0 3.18593E-5
6-32151655-T-A c.159+3A>T splice_region AGER 1 81446 1.22781E-5 40723 0 NA
6-32151663-T-G p.Lys52Gln missense AGER 1 81448 1.22778E-5 40724 0 NA
6-32151664-C-T p.Trp51* stop_gained AGER 40 81444 4.91135E-4 40722 0 8.28553E-4
6-32151666-A-C p.Trp51Gly missense AGER 4 81444 4.91135E-5 40722 0 3.18695E-5
6-32151670-C-T p.Leu49Leu synonymous AGER 2 81460 2.45519E-5 40730 0 6.02648E-5
6-32151674-C-T p.Arg48Gln missense AGER 6 81458 7.36576E-5 40729 0 9.55901E-5
6-32151675-G-A p.Arg48Trp missense AGER 1 81448 1.22778E-5 40724 0 4.30463E-5
6-32151690-TG-T p.Lys43fs frameshift AGER 2 81404 2.45688E-5 40702 0 NA
6-32151690-T-C p.Lys43Glu missense AGER 1 81404 1.22844E-5 40702 0 NA
6-32151691-G-C p.Pro42Pro synonymous AGER 8 81400 9.82801E-5 40700 0 0.0010846
6-32151696-C-T p.Ala41Thr missense AGER 1 81388 1.22868E-5 40694 0 NA
6-32151699-C-T p.Gly40Arg missense AGER 1 81372 1.22892E-5 40686 0 1.21657E-5
6-32151703-A-C p.Cys38Trp missense AGER 8 81348 9.83429E-5 40674 0 3.50586E-4
6-32151709-C-T p.Leu36Leu synonymous AGER 1 81312 1.22983E-5 40656 0 4.05522E-6
6-32151715-C-T p.Leu34Leu synonymous AGER 1 81250 1.23077E-5 40625 0 NA
6-32151718-T-C p.Pro33Pro synonymous AGER 1 81200 1.23153E-5 40600 0 NA
6-32151719-G-A p.Pro33Leu missense AGER 7 81172 8.62366E-5 40586 0 2.83884E-5
6-32151724-G-A p.Gly31Gly synonymous AGER 5 80766 6.19072E-5 40383 0 3.6875E-5
6-32151731-C-T p.Arg29Gln missense AGER 4 80686 4.95749E-5 40343 0 6.37064E-5
6-32151732-G-A p.Arg29Trp missense AGER 1 80628 1.24026E-5 40314 0 8.6103E-6
6-32151734-G-A p.Ala28Val missense AGER 5 80604 6.20317E-5 40302 0 4.01528E-4
6-32151741-T-G p.Ile26Leu missense AGER 1 80556 1.24137E-5 40278 0 NA
6-32151741-TG-T p.Asn25fs frameshift AGER 1 80556 1.24137E-5 40278 0 3.18471E-5
6-32151744-T-A p.Asn25Tyr missense AGER 1 80538 1.24165E-5 40269 0 4.05587E-6
6-32151747-G-C p.Gln24Glu missense AGER 1 80536 1.24168E-5 40268 0 NA
6-32151751-A-T p.Gly22Gly synonymous AGER 2 80528 2.48361E-5 40264 0 NA
6-32151757-T-C p.Val20Val synonymous AGER 1 80582 1.24097E-5 40291 0 NA
6-32151763-C-T p.Gly18Gly splice_region+synonymous AGER 8 80612 9.92408E-5 40306 0 6.37267E-5
6-32151796-A-C c.-283T>G 5_prime_UTR_premature_start_codon_gain AGER 1 81146 1.23235E-5 40573 0 4.0624E-6
6-32151954-G-A c.-441C>T 5_prime_UTR_premature_start_codon_gain AGER 1 79068 1.26473E-5 39534 0 NA
6-32151969-C-T p.Val11Met missense AGER 3 78806 3.80682E-5 39403 0 8.71794E-6
6-32151983-G-A p.Ala6Val missense AGER 2 78916 2.53434E-5 39458 0 6.37714E-5
6-32151985-T-C p.Thr5Thr synonymous AGER 1 78960 1.26646E-5 39480 0 NA
6-32151986-G-A p.Thr5Ile missense AGER 4 78944 5.06688E-5 39472 1 3.66205E-5
6-32151990-C-T p.Gly4Arg missense AGER 5 78882 6.33858E-5 39441 0 6.25E-4
6-32151994-A-T p.Ala2Ala synonymous AGER 70945 77428 0.916271 38714 32615 0.96
6-32152008-C-T p.Gly29Arg missense AGER 2 79202 2.52519E-5 39601 0 4.11482E-6
6-32152015-G-A p.Thr26Thr synonymous AGER 3 79022 3.79641E-5 39511 0 4.15127E-6
6-32152025-C-CT p.Arg23fs frameshift AGER 1 79156 1.26333E-5 39578 0 4.1401E-5
6-32152031-G-A p.Ala21Val missense AGER 1 79116 1.26397E-5 39558 0 4.41696E-5
6-32152036-T-A p.Arg19Ser missense AGER 1 79190 1.26279E-5 39595 0 NA
6-32152044-CT-C p.Ala17fs frameshift AGER 1 79150 1.26342E-5 39575 0 NA
6-32152054-C-T p.Ala13Ala synonymous AGER 1 79058 1.26489E-5 39529 0 6.94927E-5
6-32152065-G-A p.Pro10Ser missense AGER 1 79000 1.26582E-5 39500 0 NA
6-32152069-C-T p.Gln8Gln synonymous AGER 1 78962 1.26643E-5 39481 0 NA
6-32152073-A-G p.Val7Ala missense AGER 1 78840 1.26839E-5 39420 0 5.83363E-6
6-32152077-T-C p.Arg6Gly missense AGER 1 78838 1.26842E-5 39419 0 NA
6-32152085-GC-G p.Ala3fs frameshift AGER 815 78548 0.0103758 39274 9 0.0137006
6-32152085-G-T p.Ala3Asp missense AGER 2 78588 2.54492E-5 39294 0 NA