Variant

Variant ID Consequence Effect Gene AC AN AF NS NHOM maxEAF
15-86686921-T-TC c.-23-9_-23-8insC splice_region AGBL1 13 82210 1.58132E-4 41105 0 6.68875E-4
15-86686938-C-T c.-15C>T 5_prime_UTR_premature_start_codon_gain AGBL1 1 82220 1.21625E-5 41110 0 4.42471E-5
15-86686939-G-T c.-14G>T 5_prime_UTR_premature_start_codon_gain AGBL1 2 82208 2.43285E-5 41104 0 1.65967E-4
15-86686962-A-C p.Lys4Gln missense AGBL1 1 82242 1.21592E-5 41121 0 NA
15-86686980-C-T p.Leu10Phe missense AGBL1 2 82244 2.43179E-5 41122 0 8.28638E-6
15-86686985-G-A p.Leu11Leu synonymous AGBL1 1 82228 1.21613E-5 41114 0 4.01807E-6
15-86686989-A-C p.Thr13Pro missense AGBL1 2 82216 2.43262E-5 41108 0 NA
15-86686990-C-T p.Thr13Ile missense AGBL1 2 82238 2.43197E-5 41119 0 3.18451E-5
15-86686994-G-C p.Leu14Leu synonymous AGBL1 11 82234 1.33765E-4 41117 0 2.23001E-4
15-86687005-C-T p.Ala18Val missense AGBL1 1 82208 1.21643E-5 41104 0 3.31499E-5
15-86687011-C-T p.Thr20Ile missense AGBL1 3 82198 3.64972E-5 41099 0 9.55657E-5
15-86687019-C-T p.Pro23Ser missense AGBL1 2 82196 2.43321E-5 41098 0 3.18512E-5
15-86687022-G-A p.Asp24Asn missense AGBL1 1 82180 1.21684E-5 41090 0 NA
15-86687033-C-T p.Ile27Ile synonymous AGBL1 1 82184 1.21678E-5 41092 0 NA
15-86687043-C-G p.Leu31Val missense AGBL1 2 82154 2.43445E-5 41077 0 6.37024E-5
15-86687049-C-T p.Arg33Trp missense AGBL1 271 82118 0.00330013 41059 1 0.013125
15-86687050-G-A p.Arg33Gln missense AGBL1 39 82086 4.75111E-4 41043 1 0.00113837
15-86687055-C-T p.Leu35Leu synonymous AGBL1 3 82080 3.65497E-5 41040 0 6.36983E-5
15-86687058-G-A p.Ala36Thr missense AGBL1 1 82054 1.21871E-5 41027 0 NA
15-86687071-T-C p.Leu40Pro missense AGBL1 4 82038 4.87579E-5 41019 0 2.5061E-5
15-86687080-C-T c.124+4C>T splice_region AGBL1 4 81984 4.879E-5 40992 0 9.55414E-5
15-86687082-C-A c.124+6C>A splice_region AGBL1 2633 81858 0.0321655 40929 37 0.040625
15-86687082-C-T c.124+6C>T splice_region AGBL1 4 81952 4.88091E-5 40976 0 3.35852E-5
15-86687082-C-G c.124+6C>G splice_region AGBL1 1 81952 1.22023E-5 40976 0 NA
15-86687083-G-A c.124+7G>A splice_region AGBL1 11 81958 1.34215E-4 40979 0 2.09982E-4
15-86697661-A-G p.Asp42Gly missense+splice_region AGBL1 1 81846 1.22181E-5 40923 0 NA
15-86697667-AG-A p.Ile45fs frameshift AGBL1 1 81870 1.22145E-5 40935 0 NA
15-86697669-A-T p.Ile45Phe missense AGBL1 1 81876 1.22136E-5 40938 0 7.72603E-5
15-86697673-G-A p.Gly46Glu missense AGBL1 4 81868 4.88591E-5 40934 0 6.36821E-5
15-86697675-C-T p.Arg47Trp missense AGBL1 590 81862 0.00720725 40931 33 0.0149919
15-86697676-G-A p.Arg47Gln missense AGBL1 2 81898 2.44206E-5 40949 0 6.36862E-5
15-86697679-A-G p.Lys48Arg missense AGBL1 1 81924 1.22064E-5 40962 0 3.1841E-5
15-86697680-G-C p.Lys48Asn missense AGBL1 1 81924 1.22064E-5 40962 0 NA
15-86697686-A-G p.Leu50Leu synonymous AGBL1 1 81968 1.21999E-5 40984 0 4.04737E-6
15-86697698-A-G p.Ala54Ala synonymous AGBL1 2 81980 2.43962E-5 40990 0 1.61688E-5
15-86697699-C-T p.Leu55Phe missense AGBL1 2 81990 2.43932E-5 40995 0 3.6388E-5
15-86697705-G-T p.Val57Leu missense AGBL1 1 81998 1.21954E-5 40999 0 3.18695E-5
15-86697727-A-G p.Lys64Arg missense AGBL1 1 82060 1.21862E-5 41030 0 NA
15-86697729-A-C p.Asn65His missense AGBL1 1 82068 1.2185E-5 41034 0 NA
15-86697734-A-C p.Leu66Leu synonymous AGBL1 1 82072 1.21844E-5 41036 0 NA
15-86697735-T-A p.Ser67Thr missense AGBL1 5 82076 6.09191E-5 41038 0 0.00125
15-86697747-A-T p.Asn71Tyr missense AGBL1 1 82100 1.21803E-5 41050 0 4.03151E-6
15-86697756-C-T p.His74Tyr missense AGBL1 2 82116 2.43558E-5 41058 0 2.42117E-5
15-86697767-G-A p.Trp77* stop_gained AGBL1 2 82120 2.43546E-5 41060 0 4.04816E-6
15-86697769-C-T p.Ala78Val missense AGBL1 1 82112 1.21785E-5 41056 0 NA
15-86697772-T-C p.Leu79Pro missense AGBL1 2 82110 2.43576E-5 41055 0 NA
15-86697774-C-T p.Arg80Cys missense AGBL1 1 82084 1.21826E-5 41042 0 1.22377E-5
15-86697775-G-A p.Arg80His missense AGBL1 4 82088 4.87282E-5 41044 0 5.06586E-4
15-86697785-C-T p.Ala83Ala synonymous AGBL1 3 82038 3.65684E-5 41019 0 NA
15-86697788-C-T p.Ser84Ser synonymous AGBL1 1 82024 1.21916E-5 41012 0 8.45938E-6
15-86697800-A-T c.256+8A>T splice_region AGBL1 2 81898 2.44206E-5 40949 0 NA
15-86697800-A-C c.256+8A>C splice_region AGBL1 1 81898 1.22103E-5 40949 0 NA
15-86702169-A-C p.Met88Leu missense AGBL1 2 82148 2.43463E-5 41074 0 6.64198E-5
15-86702176-C-A p.Ala90Asp missense AGBL1 2 82148 2.43463E-5 41074 0 3.21541E-5
15-86702184-G-A p.Gly93Arg missense AGBL1 1 82208 1.21643E-5 41104 0 NA
15-86702191-A-G p.Asn95Ser missense AGBL1 1 82230 1.2161E-5 41115 0 NA
15-86702199-A-G p.Met98Val missense AGBL1 1 82240 1.21595E-5 41120 0 3.1841E-5
15-86702200-T-C p.Met98Thr missense AGBL1 1 82236 1.21601E-5 41118 0 NA
15-86702202-G-A p.Glu99Lys missense AGBL1 1 82230 1.2161E-5 41115 0 2.48769E-5
15-86702207-G-A p.Leu100Leu synonymous AGBL1 1 82214 1.21634E-5 41107 0 NA
15-86702218-T-C p.Val104Ala missense AGBL1 3 82162 3.65132E-5 41081 0 2.81366E-5
15-86702223-A-T p.Thr106Ser missense AGBL1 1 82110 1.21788E-5 41055 0 NA
15-86702235-C-T p.Arg110* stop_gained AGBL1 3 81992 3.65889E-5 40996 0 2.01055E-5
15-86702236-G-A p.Arg110Gln missense AGBL1 5 81978 6.0992E-5 40989 0 2.48781E-5
15-86702241-C-T p.Arg112Cys missense AGBL1 2558 81854 0.0312508 40927 45 0.04875
15-86702242-G-A p.Arg112His missense AGBL1 1 81914 1.22079E-5 40957 0 2.01091E-5
15-86702245-C-T p.Thr113Ile missense AGBL1 1 81908 1.22088E-5 40954 0 8.29311E-6
15-86702251-C-T p.Ala115Val missense AGBL1 2 81818 2.44445E-5 40909 0 1.20686E-5
15-86702265-G-A c.350+8G>A splice_region AGBL1 7 81616 8.57675E-5 40808 0 9.55597E-5
15-86768141-C-T c.351-4C>T splice_region AGBL1 4 82274 4.8618E-5 41137 0 8.28363E-6
15-86768142-C-T c.351-3C>T splice_region AGBL1 3 82278 3.64618E-5 41139 0 5.79854E-5
15-86768147-C-T p.Ala118Val missense+splice_region AGBL1 1 82312 1.21489E-5 41156 0 4.01577E-6
15-86768161-T-C p.Leu123Leu synonymous AGBL1 9 82356 1.09282E-4 41178 0 0.00375
15-86768168-C-T p.Ala125Val missense AGBL1 1 82352 1.2143E-5 41176 0 NA
15-86768169-A-G p.Ala125Ala synonymous AGBL1 2 82346 2.42878E-5 41173 0 3.19203E-5
15-86768185-A-T c.388+3A>T splice_region AGBL1 2 82310 2.42984E-5 41155 0 3.19346E-5
15-86790905-C-G p.Ser131Trp missense AGBL1 3 80316 3.73525E-5 40158 0 2.16769E-5
15-86790906-G-A p.Ser131Ser synonymous AGBL1 1 80496 1.2423E-5 40248 0 4.1154E-5
15-86790909-C-T p.Asn132Asn synonymous AGBL1 22 80640 2.72817E-4 40320 0 0.00352823
15-86790910-G-A p.Gly133Ser missense AGBL1 1 80760 1.23824E-5 40380 0 4.31105E-6
15-86790913-C-T p.Arg134Cys missense AGBL1 11 80898 1.35974E-4 40449 0 3.13261E-4
15-86790914-G-A p.Arg134His missense AGBL1 8 80972 9.87996E-5 40486 0 2.2293E-4
15-86790914-G-T p.Arg134Leu missense AGBL1 2 80972 2.46999E-5 40486 0 1.6997E-5
15-86790918-A-G p.Arg135Arg synonymous AGBL1 1 81202 1.2315E-5 40601 0 4.59334E-5
15-86790923-T-C p.Val137Ala missense AGBL1 2 81370 2.45791E-5 40685 0 1.42682E-5
15-86790929-G-T p.Arg139Leu missense AGBL1 1 81498 1.22702E-5 40749 0 4.11587E-6
15-86790929-G-A p.Arg139Gln missense AGBL1 2 81498 2.45405E-5 40749 0 1.29343E-5
15-86790936-C-T p.Tyr141Tyr synonymous AGBL1 6 81738 7.34053E-5 40869 0 0.00100705
15-86790936-C-A p.Tyr141* stop_gained AGBL1 1 81738 1.22342E-5 40869 0 1.59236E-4
15-86790937-G-A p.Val142Ile missense AGBL1 1 81770 1.22294E-5 40885 0 2.26342E-5
15-86790952-G-A p.Gly147Arg missense AGBL1 3 81974 3.6597E-5 40987 0 3.23693E-5
15-86790953-G-T p.Gly147Val missense AGBL1 2 81980 2.43962E-5 40990 0 4.04328E-6
15-86790971-A-G p.His153Arg missense AGBL1 1 82080 1.21832E-5 41040 0 NA
15-86790979-G-A p.Asp156Asn missense AGBL1 1 82110 1.21788E-5 41055 0 NA
15-86790990-C-T p.Asn159Asn synonymous AGBL1 168 82062 0.00204723 41031 7 0.015
15-86790991-G-A p.Ala160Thr missense AGBL1 1 82048 1.2188E-5 41024 0 3.62045E-5
15-86790992-C-A p.Ala160Asp missense AGBL1 1 82066 1.21853E-5 41033 0 NA
15-86790995-AC-A p.Tyr161fs frameshift AGBL1 1 82072 1.21844E-5 41036 0 NA
15-86790996-C-T p.Tyr161Tyr synonymous AGBL1 3 82068 3.65551E-5 41034 0 6.36983E-5
15-86790997-G-A p.Val162Met missense AGBL1 596 82060 0.00726298 41030 1 0.00751592
15-86791006-C-T p.Arg165* stop_gained AGBL1 31 81996 3.78067E-4 40998 0 6.25E-4
15-86791007-G-A p.Arg165Gln missense AGBL1 3 81996 3.65871E-5 40998 0 3.21724E-5
15-86791009-C-T p.Arg166Trp missense AGBL1 6 81958 7.32082E-5 40979 0 5.03525E-4
15-86791010-G-A p.Arg166Gln missense AGBL1 1 81962 1.22008E-5 40981 0 NA
15-86791011-G-C p.Arg166Arg synonymous AGBL1 3 81944 3.66104E-5 40972 0 3.3456E-5
15-86791014-C-T p.Gly167Gly synonymous AGBL1 2 81904 2.44188E-5 40952 0 NA
15-86791017-G-A p.Leu168Leu synonymous AGBL1 5 81844 6.10918E-5 40922 0 3.5086E-4
15-86791023-C-G p.Leu170Leu synonymous AGBL1 2 81854 2.44337E-5 40927 0 5.00576E-5
15-86791045-C-T p.Leu178Phe missense AGBL1 2 81726 2.4472E-5 40863 0 NA
15-86791048-C-T p.Arg179Trp missense AGBL1 7 81640 8.57423E-5 40820 0 0.00100705
15-86791049-G-A p.Arg179Gln missense AGBL1 2 81636 2.4499E-5 40818 0 4.02794E-5
15-86791053-C-T p.Ser180Ser synonymous AGBL1 2 81550 2.45248E-5 40775 0 5.03525E-4
15-86791054-G-A p.Gly181Ser missense AGBL1 2 81552 2.45242E-5 40776 0 3.18552E-5
15-86791054-G-C p.Gly181Arg missense AGBL1 1 81552 1.22621E-5 40776 0 NA
15-86791058-G-C p.Arg182Thr missense AGBL1 1 81496 1.22705E-5 40748 0 3.18512E-5
15-86791069-C-T p.Leu186Leu synonymous AGBL1 3 81202 3.69449E-5 40601 0 6.25E-4
15-86791080-G-C p.Gln189His missense AGBL1 95 80932 0.00117382 40466 0 0.00254858
15-86791082-G-A p.Gly190Asp missense AGBL1 1 80806 1.23753E-5 40403 0 8.37633E-6
15-86791084-A-G p.Met191Val missense AGBL1 1 80746 1.23845E-5 40373 0 8.3783E-6
15-86791098-C-T p.Phe195Phe synonymous AGBL1 2 80310 2.49035E-5 40155 0 NA
15-86791114-G-A c.597+4G>A splice_region AGBL1 128 79534 0.00160937 39767 2 0.005625
15-86791116-C-T c.597+6C>T splice_region AGBL1 1106 79242 0.0139572 39621 41 0.029275
15-86800079-C-T c.598-5C>T splice_region AGBL1 1 82684 1.20942E-5 41342 0 NA
15-86800093-G-A p.Asp203Asn missense AGBL1 6 82750 7.25076E-5 41375 0 2.5507E-4
15-86800093-G-T p.Asp203Tyr missense AGBL1 4 82750 4.83384E-5 41375 0 5.03525E-4
15-86800100-A-G p.Lys205Arg missense AGBL1 1 82752 1.20843E-5 41376 0 NA
15-86800106-T-C p.Met207Thr missense AGBL1 1 82764 1.20825E-5 41382 0 NA
15-86800110-G-A p.Glu208Glu synonymous AGBL1 3 82764 3.62476E-5 41382 0 8.33987E-6
15-86800111-C-G p.Pro209Ala missense AGBL1 2 82758 2.41668E-5 41379 0 NA
15-86800113-C-T p.Pro209Pro synonymous AGBL1 9 82764 1.08743E-4 41382 0 1.83434E-4
15-86800113-C-G p.Pro209Pro synonymous AGBL1 3 82766 3.62468E-5 41383 0 2.50138E-5
15-86800116-C-G p.Val210Val synonymous AGBL1 115 82774 0.00138933 41387 0 0.00375
15-86800122-TGTG-T p.Val214del conservative_inframe_deletion AGBL1 1 82788 1.2079E-5 41394 0 3.18593E-5
15-86800130-T-C p.Leu215Pro missense AGBL1 4 82788 4.83162E-5 41394 0 3.18613E-5
15-86800142-G-A p.Arg219Lys missense AGBL1 2 82816 2.41499E-5 41408 0 1.66395E-5
15-86800146-G-A p.Gln220Gln synonymous AGBL1 1 82808 1.20761E-5 41404 0 NA
15-86800149-C-G p.Cys221Trp missense AGBL1 1 82798 1.20776E-5 41399 0 NA
15-86800154-C-T p.Pro223Leu missense AGBL1 982 82786 0.0118619 41393 7 0.00924038
15-86800154-C-G p.Pro223Arg missense AGBL1 3 82802 3.6231E-5 41401 0 6.37267E-5
15-86800157-C-T p.Thr224Met missense AGBL1 17 82810 2.05289E-4 41405 0 9.55901E-5
15-86800164-A-T p.Pro226Pro synonymous AGBL1 1 82816 1.2075E-5 41408 0 NA
15-86800165-C-G p.Leu227Val missense AGBL1 32 82812 3.86417E-4 41406 0 0.00453172
15-86800170-C-T p.Pro228Pro synonymous AGBL1 1 82812 1.20755E-5 41406 0 NA
15-86800190-C-A p.Ala235Asp missense AGBL1 2 82802 2.4154E-5 41401 0 NA
15-86800196-C-A p.Ala237Asp missense AGBL1 1 82794 1.20782E-5 41397 0 NA
15-86800202-C-T p.Pro239Leu missense AGBL1 2 82778 2.4161E-5 41389 0 9.55475E-5
15-86800202-C-A p.Pro239Gln missense AGBL1 1 82780 1.20802E-5 41390 0 NA
15-86800206-C-G p.Val240Val synonymous AGBL1 1 82774 1.20811E-5 41387 0 3.61495E-5
15-86800207-C-T p.Pro241Ser missense AGBL1 2 82774 2.41622E-5 41387 0 NA
15-86800209-C-T p.Pro241Pro synonymous AGBL1 51191 82052 0.623885 41026 16322 0.712991
15-86800212-G-A p.Gly242Gly synonymous AGBL1 117 82762 0.00141369 41381 0 0.00375
15-86800214-G-T p.Cys243Phe missense AGBL1 4 82762 4.83314E-5 41381 0 3.18552E-5
15-86800229-C-T p.Pro248Leu missense AGBL1 1 82734 1.20869E-5 41367 0 NA
15-86800235-A-G p.His250Arg missense AGBL1 2 82712 2.41803E-5 41356 0 1.69127E-5
15-86800245-T-G p.Pro253Pro synonymous AGBL1 1 82614 1.21045E-5 41307 0 4.042E-6
15-86800249-G-A p.Glu255Lys missense+splice_region AGBL1 3 82602 3.63187E-5 41301 0 1.27405E-4
15-86800251-T-G c.763+2T>G splice_donor AGBL1 19 82576 2.30091E-4 41288 0 0.00210298
15-86801187-C-T c.764-8C>T splice_region AGBL1 1 82664 1.20972E-5 41332 0 NA
15-86801188-C-T c.764-7C>T splice_region AGBL1 1 82678 1.20951E-5 41339 0 4.04338E-6
15-86801198-A-T p.Asp256Val missense AGBL1 1 82698 1.20922E-5 41349 0 NA
15-86801201-T-TTGAAGA p.Glu258_Asp259dup disruptive_inframe_insertion AGBL1 1 82700 1.20919E-5 41350 0 2.00981E-5
15-86801201-T-C p.Phe257Ser missense AGBL1 2 82700 2.41838E-5 41350 0 1.90751E-4
15-86801207-A-T p.Asp259Val missense AGBL1 3 82714 3.62696E-5 41357 0 1.65815E-5
15-86801214-C-T p.Gly261Gly synonymous AGBL1 1 82720 1.2089E-5 41360 0 3.31581E-5
15-86801215-G-A p.Asp262Asn missense AGBL1 1 82722 1.20887E-5 41361 0 6.25E-4
15-86801217-T-C p.Asp262Asp synonymous AGBL1 1 82730 1.20875E-5 41365 0 NA
15-86801221-G-A p.Glu264Lys missense AGBL1 1 82730 1.20875E-5 41365 0 8.2883E-6
15-86801221-G-T p.Glu264* stop_gained AGBL1 1 82730 1.20875E-5 41365 0 NA
15-86801238-T-C p.Ser269Ser synonymous AGBL1 15 82708 1.81361E-4 41354 0 1.59195E-4
15-86801252-G-A p.Gly274Glu missense AGBL1 6 82694 7.25567E-5 41347 0 6.02734E-5
15-86801261-A-G p.Glu277Gly missense+splice_region AGBL1 24 82666 2.90325E-4 41333 0 6.75279E-4
15-86801267-G-A c.831+5G>A splice_region AGBL1 7 82652 8.46924E-5 41326 0 8.29614E-5
15-86805877-G-A p.Met1? start_lost AGBL1 25 68874 3.62982E-4 34437 0 0.00123522
15-86805879-G-A p.Gly2Asp missense AGBL1 1 68990 1.44949E-5 34495 0 3.18613E-5
15-86805880-C-T p.Gly2Gly synonymous AGBL1 8 69092 1.15788E-4 34546 0 6.37308E-5
15-86805881-C-T p.Gln3* stop_gained AGBL1 2 69186 2.89076E-5 34593 0 6.71474E-6
15-86805891-A-G p.Asn6Ser missense AGBL1 1 70670 1.41503E-5 35335 0 1.98683E-5
15-86805896-GA-G p.Glu8fs frameshift AGBL1 3 71048 4.2225E-5 35524 0 NA
15-86805899-G-A c.24+1G>A splice_donor AGBL1 5 71248 7.01774E-5 35624 0 3.18634E-5
15-86806001-C-T c.25-8C>T splice_region AGBL1 166 81862 0.0020278 40931 1 0.00440121
15-86806021-G-C p.Glu13Gln missense AGBL1 2 82336 2.42907E-5 41168 0 3.18492E-5
15-86806027-G-C p.Asp15His missense AGBL1 1 82416 1.21336E-5 41208 0 NA
15-86806029-C-T p.Asp15Asp synonymous AGBL1 52705 81506 0.64664 40753 17653 0.723061
15-86806029-C-A p.Asp15Glu missense AGBL1 2 82406 2.42701E-5 41203 0 1.25408E-5
15-86806035-C-A p.Asn17Lys missense AGBL1 3 82482 3.63716E-5 41241 0 3.18532E-5
15-86806038-G-C p.Lys18Asn missense AGBL1 1 82502 1.21209E-5 41251 0 8.23066E-5
15-86806053-T-C p.Pro23Pro synonymous AGBL1 2 82544 2.42295E-5 41272 0 6.36902E-5
15-86806063-C-T p.Arg27* stop_gained AGBL1 5 82550 6.05694E-5 41275 0 4.19877E-5
15-86806083-G-T p.Met33Ile missense AGBL1 1 82530 1.21168E-5 41265 0 NA
15-86806087-T-C p.Tyr35His missense AGBL1 1 82504 1.21206E-5 41252 0 NA
15-86806092-G-A p.Glu36Glu synonymous AGBL1 1 82504 1.21206E-5 41252 0 NA
15-86806093-G-T p.Val37Leu missense AGBL1 1 82486 1.21233E-5 41243 0 NA
15-86806095-G-T p.Val37Val synonymous AGBL1 17 82466 2.06146E-4 41233 0 0.00100705
15-86806106-A-T p.Glu41Val missense AGBL1 1 82366 1.21409E-5 41183 0 NA
15-86806108-C-T p.Leu42Phe missense AGBL1 1 82334 1.21457E-5 41167 0 NA
15-86806120-T-G p.Phe46Val missense AGBL1 1 82122 1.2177E-5 41061 0 NA
15-86806126-G-A c.141+1G>A splice_donor AGBL1 6 82000 7.31707E-5 41000 0 1.78001E-5
15-86806132-C-T c.141+7C>T splice_region AGBL1 1 81880 1.2213E-5 40940 0 NA
15-86807484-T-G c.142-5T>G splice_region AGBL1 1 82520 1.21183E-5 41260 0 4.97349E-6
15-86807486-A-G c.142-3A>G splice_region AGBL1 3 82530 3.63504E-5 41265 0 4.86888E-6
15-86807495-C-G p.Gln50Glu missense AGBL1 1 82562 1.21121E-5 41281 0 2.58893E-5
15-86807501-A-C p.Lys52Gln missense AGBL1 1 82596 1.21071E-5 41298 0 NA
15-86807502-A-T p.Lys52Ile missense AGBL1 1 82594 1.21074E-5 41297 0 4.41224E-6
15-86807504-C-G p.Leu53Val missense AGBL1 95 82604 0.00115007 41302 0 0.00300471
15-86807507-G-A p.Gly54Arg missense AGBL1 1 82614 1.21045E-5 41307 0 5.98444E-5
15-86807515-T-C p.Asp56Asp synonymous AGBL1 1 82592 1.21077E-5 41296 0 1.27425E-5
15-86807524-T-C p.Ser59Ser synonymous AGBL1 5 82606 6.05283E-5 41303 0 4.45973E-4
15-86807531-A-C p.Thr62Pro missense AGBL1 1 82614 1.21045E-5 41307 0 NA
15-86807536-G-A p.Gln63Gln synonymous AGBL1 8 82604 9.68476E-5 41302 0 0.00100705
15-86807541-C-A p.Ala65Asp missense AGBL1 1 82612 1.21048E-5 41306 0 3.18471E-5
15-86807542-C-T p.Ala65Ala synonymous AGBL1 14591 82254 0.17739 41127 1302 0.21042
15-86807554-C-A p.His69Gln missense AGBL1 1 82574 1.21103E-5 41287 0 NA
15-86807563-C-T p.Ala72Ala synonymous AGBL1 15 82540 1.8173E-4 41270 0 1.01189E-4
15-86807563-C-G p.Ala72Ala synonymous AGBL1 1 82540 1.21153E-5 41270 0 9.87167E-6
15-86807564-G-A p.Ala73Thr missense AGBL1 5 82528 6.05855E-5 41264 0 0.00125
15-86807564-G-T p.Ala73Ser missense AGBL1 1 82528 1.21171E-5 41264 0 2.94719E-5
15-86807573-T-C p.Ser76Pro missense AGBL1 1 82534 1.21162E-5 41267 0 NA
15-86807579-C-T p.Gln78* stop_gained AGBL1 1 82528 1.21171E-5 41264 0 NA
15-86807581-G-A p.Gln78Gln synonymous AGBL1 1 82522 1.2118E-5 41261 0 4.02269E-6
15-86807589-A-G p.Tyr81Cys missense AGBL1 1 82508 1.212E-5 41254 0 9.06355E-6
15-86807595-A-G p.Lys83Arg missense AGBL1 2 82480 2.42483E-5 41240 0 1.27389E-4
15-86807603-A-C p.Ser86Arg missense AGBL1 1 82476 1.21247E-5 41238 0 NA
15-86807607-C-T p.Ser87Phe missense AGBL1 1 82472 1.21253E-5 41236 0 8.72646E-6
15-86807614-G-T p.Gly89Gly synonymous AGBL1 1 82430 1.21315E-5 41215 0 4.01146E-6
15-86807622-G-C p.Arg92Thr missense AGBL1 1 82472 1.21253E-5 41236 0 8.52253E-6
15-86807634-T-C p.Val96Ala missense AGBL1 1 82480 1.21242E-5 41240 0 6.37308E-5
15-86807636-C-T p.Gln97* stop_gained AGBL1 1 82490 1.21227E-5 41245 0 NA
15-86807636-C-G p.Gln97Glu missense AGBL1 2 82490 2.42454E-5 41245 0 8.42929E-6
15-86807640-C-G p.Thr98Ser missense AGBL1 2 82506 2.42407E-5 41253 0 NA
15-86807645-C-G p.Leu100Val missense AGBL1 1 82526 1.21174E-5 41263 0 NA
15-86807650-G-A p.Leu101Leu synonymous AGBL1 1 82538 1.21156E-5 41269 0 NA
15-86807657-G-A p.Val104Met missense AGBL1 1 82554 1.21133E-5 41277 0 NA
15-86807664-C-T p.Thr106Met missense AGBL1 6 82570 7.26656E-5 41285 0 5.03525E-4
15-86807665-G-A p.Thr106Thr synonymous AGBL1 2 82580 2.42189E-5 41290 0 4.41349E-5
15-86807667-G-A p.Gly107Glu missense AGBL1 1 82582 1.21092E-5 41291 0 NA
15-86807670-G-T p.Arg108Met missense AGBL1 2 82586 2.42172E-5 41293 0 NA
15-86807679-T-G p.Val111Gly missense AGBL1 1 82606 1.21057E-5 41303 0 3.18654E-5
15-86807692-C-CA p.Asn118fs frameshift AGBL1 5 82598 6.05342E-5 41299 0 1.41977E-4
15-86807693-A-C p.Lys116Gln missense AGBL1 1 82592 1.21077E-5 41296 0 NA
15-86807705-G-A p.Gly120Arg missense AGBL1 1 82582 1.21092E-5 41291 0 1.20365E-5
15-86807708-G-A p.Val121Met missense AGBL1 1 82566 1.21115E-5 41283 0 8.29009E-6
15-86807716-G-A p.Leu123Leu synonymous AGBL1 5 82554 6.05664E-5 41277 0 2.48649E-5
15-86807722-A-C p.Gln125His missense AGBL1 25 82542 3.02876E-4 41271 0 0.00151057
15-86807725-T-C p.Asn126Asn synonymous AGBL1 1 82540 1.21153E-5 41270 0 4.01297E-6
15-86807729-C-T p.Gln128* stop_gained AGBL1 2 82532 2.4233E-5 41266 0 3.1841E-5
15-86807731-A-G p.Gln128Gln synonymous AGBL1 3 82528 3.63513E-5 41264 0 6.25E-4
15-86807736-A-G p.Asn130Ser missense AGBL1 11 82504 1.33327E-4 41252 0 3.1839E-4
15-86807744-A-G p.Arg133Gly missense AGBL1 22 82466 2.66777E-4 41233 2 0.00187213
15-86807752-T-G p.Asp135Glu missense AGBL1 12 82456 1.45532E-4 41228 0 9.55536E-5
15-86807754-C-A p.Ser136Tyr missense AGBL1 113 82462 0.00137033 41231 1 0.00302548
15-86807761-A-G p.Glu138Glu synonymous AGBL1 39223 82202 0.477154 41101 9532 0.545317
15-86807768-A-T p.Ile141Phe missense AGBL1 2 82428 2.42636E-5 41214 0 4.01452E-6
15-86807777-A-T p.Ile144Phe missense AGBL1 8 82474 9.70003E-5 41237 0 4.14092E-5
15-86807782-G-A p.Gln145Gln synonymous AGBL1 6 82466 7.27573E-5 41233 0 2.86551E-4
15-86807790-C-T p.Pro148Leu missense AGBL1 1259 82482 0.0152639 41241 54 0.0303899
15-86807791-G-A p.Pro148Pro synonymous AGBL1 2 82476 2.42495E-5 41238 0 4.14195E-5
15-86807800-T-C p.Asp151Asp synonymous AGBL1 1 82510 1.21197E-5 41255 0 NA
15-86807809-C-T p.Asp154Asp synonymous AGBL1 3 82528 3.63513E-5 41264 0 3.21453E-5
15-86807809-C-A p.Asp154Glu missense AGBL1 2 82528 2.42342E-5 41264 0 NA
15-86807810-G-A p.Val155Ile missense AGBL1 4 82534 4.84649E-5 41267 0 2.48571E-5
15-86807815-T-G p.Asp156Glu missense AGBL1 1 82536 1.21159E-5 41268 0 NA
15-86807819-A-G p.Ile158Val missense AGBL1 1 82542 1.2115E-5 41271 0 3.1841E-5
15-86807830-A-C p.Pro161Pro synonymous AGBL1 542 82560 0.00656492 41280 8 0.0120685
15-86807830-A-T p.Pro161Pro synonymous AGBL1 1 82564 1.21118E-5 41282 0 NA
15-86807830-A-G p.Pro161Pro synonymous AGBL1 1 82564 1.21118E-5 41282 0 NA
15-86807833-G-A p.Arg162Arg synonymous AGBL1 3 82572 3.63319E-5 41286 0 3.1839E-5
15-86807834-A-T p.Met163Leu missense AGBL1 1 82574 1.21103E-5 41287 0 NA
15-86807840-G-A p.Ala165Thr missense AGBL1 1 82572 1.21106E-5 41286 0 NA
15-86807841-C-A p.Ala165Asp missense AGBL1 1 82568 1.21112E-5 41284 0 5.03525E-4
15-86807843-T-C p.Ser166Pro missense AGBL1 14933 82384 0.181261 41192 1376 0.182276
15-86807856-C-G p.Ser170Cys missense AGBL1 3 82590 3.6324E-5 41295 0 6.83159E-5
15-86807862-G-A p.Arg172Lys missense AGBL1 2 82606 2.42113E-5 41303 0 8.28583E-6
15-86807865-C-T p.Thr173Ile missense AGBL1 2 82602 2.42125E-5 41301 0 NA
15-86807878-C-T p.Val177Val synonymous AGBL1 19 82626 2.29952E-4 41313 0 9.03876E-4
15-86807883-T-G p.Val179Gly missense AGBL1 2 82620 2.42072E-5 41310 0 8.28418E-6
15-86807884-A-C p.Val179Val synonymous AGBL1 15178 82450 0.184087 41225 1415 0.183787
15-86807914-G-T p.Lys189Asn missense AGBL1 1 82626 1.21027E-5 41313 0 NA
15-86807915-C-T p.Arg190Cys missense AGBL1 5 82616 6.0521E-5 41308 0 6.25E-4
15-86807916-G-A p.Arg190His missense AGBL1 5 82616 6.0521E-5 41308 0 6.37024E-5
15-86807926-C-G p.Phe193Leu missense AGBL1 2 82632 2.42037E-5 41316 0 2.00632E-5
15-86807929-C-T p.His194His synonymous AGBL1 3 82622 3.63099E-5 41311 0 4.14099E-5
15-86807930-G-A p.Asp195Asn missense AGBL1 5 82622 6.05166E-5 41311 0 9.55718E-5
15-86807943-A-T p.Tyr199Phe missense AGBL1 2 82612 2.42096E-5 41306 0 NA
15-86807961-G-T p.Arg205Ile missense AGBL1 1 82568 1.21112E-5 41284 0 NA
15-86807966-A-C p.Ser207Arg missense AGBL1 1 82578 1.21098E-5 41289 0 NA
15-86807970-C-G p.Ser208Cys missense AGBL1 54 82558 6.54086E-4 41279 0 0.00151057
15-86807985-A-G p.Lys213Arg missense AGBL1 1 82490 1.21227E-5 41245 0 8.28569E-6
15-86807991-T-A p.Met215Lys missense AGBL1 4 82466 4.85048E-5 41233 0 2.40888E-5
15-86807993-G-T p.Ala216Ser missense AGBL1 23 82478 2.78862E-4 41239 0 4.77616E-4
15-86808013-A-T p.Gly222Gly synonymous AGBL1 1 82486 1.21233E-5 41243 0 1.27421E-4
15-86808013-A-G p.Gly222Gly synonymous AGBL1 1 82486 1.21233E-5 41243 0 NA
15-86808016-C-A p.His223Gln missense AGBL1 1 82480 1.21242E-5 41240 0 NA
15-86808017-T-C p.Cys224Arg missense AGBL1 2 82482 2.42477E-5 41241 0 8.3275E-6
15-86808018-G-C p.Cys224Ser missense AGBL1 15 82474 1.81875E-4 41237 0 0.00100705
15-86808022-C-G p.Pro225Pro synonymous AGBL1 1 82486 1.21233E-5 41243 0 NA
15-86808033-C-T p.Thr229Ile missense AGBL1 1 82444 1.21294E-5 41222 0 NA
15-86808043-G-T p.Met232Ile missense AGBL1 1 82400 1.21359E-5 41200 0 5.03525E-4
15-86808050-C-T p.Arg235* stop_gained AGBL1 2 82368 2.42813E-5 41184 0 1.10212E-4
15-86808051-G-A p.Arg235Gln missense AGBL1 4 82360 4.85673E-5 41180 0 8.31628E-5
15-86808056-T-C p.Cys237Arg missense AGBL1 2 82356 2.42848E-5 41178 0 NA
15-86808069-G-C p.Arg241Thr missense+splice_region AGBL1 1 82264 1.2156E-5 41132 0 NA
15-86808070-G-A c.722+1G>A splice_donor AGBL1 1 82246 1.21586E-5 41123 0 1.72108E-5
15-86808077-C-T c.722+8C>T splice_region AGBL1 1 82126 1.21764E-5 41063 0 3.18695E-5
15-86809605-G-C p.Arg241Ser missense+splice_region AGBL1 1 82386 1.2138E-5 41193 0 NA
15-86809606-A-G p.Ile242Val missense+splice_region AGBL1 1 82430 1.21315E-5 41215 0 NA
15-86809623-T-C p.Asp247Asp synonymous AGBL1 1 82522 1.2118E-5 41261 0 6.23908E-5
15-86809627-C-T p.Arg249Trp missense AGBL1 6 82562 7.26727E-5 41281 0 5.99329E-5
15-86809628-G-C p.Arg249Pro missense AGBL1 2 82562 2.42242E-5 41281 0 NA
15-86809636-A-T p.Ile252Phe missense AGBL1 1 82592 1.21077E-5 41296 0 4.94105E-6
15-86809678-G-A p.Asp266Asn missense AGBL1 1 82560 1.21124E-5 41280 0 NA
15-86809685-C-T p.Pro268Leu missense AGBL1 2 82496 2.42436E-5 41248 0 5.70379E-6
15-86809691-A-G c.806+3A>G splice_region AGBL1 2 82446 2.42583E-5 41223 0 6.36862E-5
15-86810214-A-T c.807-7A>T splice_region AGBL1 2 82220 2.4325E-5 41110 0 6.36821E-5
15-86810252-C-T p.Arg280Trp missense AGBL1 3 82344 3.64325E-5 41172 0 7.34484E-5
15-86810253-G-A p.Arg280Gln missense AGBL1 7 82344 8.50092E-5 41172 0 1.3391E-4
15-86810254-GTTC-G p.Phe282del disruptive_inframe_deletion AGBL1 1 82346 1.21439E-5 41173 0 3.65177E-5
15-86810256-T-G p.Phe281Cys missense AGBL1 1 82338 1.21451E-5 41169 0 NA
15-86810263-C-A p.Ser283Ser synonymous AGBL1 10 82338 1.21451E-4 41169 0 NA
15-86810271-A-G p.Glu286Gly missense AGBL1 1 82328 1.21465E-5 41164 0 3.66838E-5
15-86810277-G-A p.Gly288Glu missense AGBL1 2 82302 2.43007E-5 41151 0 3.69031E-5
15-86810279-A-T p.Asn289Tyr missense AGBL1 2 82292 2.43037E-5 41146 0 NA
15-86810285-C-T p.Arg291Cys missense AGBL1 2 82256 2.43143E-5 41128 0 3.75347E-5
15-86810286-G-A p.Arg291His missense AGBL1 1 82256 1.21572E-5 41128 0 3.75827E-5
15-86810291-G-A p.Ala293Thr missense AGBL1 1 82214 1.21634E-5 41107 0 3.7942E-5
15-86810300-G-C p.Val296Leu missense AGBL1 1 82148 1.21732E-5 41074 0 3.18492E-5
15-86810301-T-G p.Val296Gly missense AGBL1 1 82120 1.21773E-5 41060 0 5.8881E-6
15-86810303-C-T p.Arg297Cys missense AGBL1 5 82078 6.09177E-5 41039 0 3.92218E-5
15-86810304-G-A p.Arg297His missense AGBL1 4 82074 4.87365E-5 41037 0 3.18492E-4
15-86813146-G-A c.894-4G>A splice_region AGBL1 6 82692 7.25584E-5 41346 0 8.42616E-6
15-86813147-C-T c.894-3C>T splice_region AGBL1 1 82692 1.20931E-5 41346 0 3.18532E-5
15-86813153-C-T p.Phe299Phe synonymous AGBL1 6 82694 7.25567E-5 41347 0 5.03525E-4
15-86813160-G-A p.Asp302Asn missense AGBL1 43 82688 5.20027E-4 41344 0 0.00302115
15-86813168-G-C p.Leu304Leu synonymous AGBL1 2 82710 2.41809E-5 41355 0 8.40916E-6
15-86813174-C-T p.Asn306Asn synonymous AGBL1 2 82708 2.41815E-5 41354 0 3.1841E-5
15-86813175-G-A p.Ala307Thr missense AGBL1 2 82708 2.41815E-5 41354 0 4.21131E-5
15-86813198-C-T p.His314His synonymous AGBL1 2 82714 2.41797E-5 41357 0 1.20527E-5
15-86813212-A-G p.Tyr319Cys missense AGBL1 9 82688 1.08843E-4 41344 0 2.86569E-4
15-86813225-C-T p.Ser323Ser synonymous AGBL1 2 82642 2.42008E-5 41321 0 3.62897E-5
15-86813226-G-A p.Gly324Ser missense AGBL1 9 82638 1.08909E-4 41319 0 6.25E-4
15-86813226-G-T p.Gly324Cys missense AGBL1 2 82638 2.42019E-5 41319 0 1.20841E-5
15-86813229-A-G p.Met325Val missense AGBL1 8 82632 9.68148E-5 41316 0 3.12032E-4
15-86813233-A-G p.Gln326Arg missense AGBL1 1 82626 1.21027E-5 41313 0 NA
15-86813236-C-T p.Ala327Val missense AGBL1 3 82616 3.63126E-5 41308 0 6.25E-4
15-86813237-G-A p.Ala327Ala synonymous AGBL1 14 82614 1.69463E-4 41307 0 0.00302115
15-86813249-C-T p.Tyr331Tyr synonymous AGBL1 2 82568 2.42225E-5 41284 0 NA
15-86813252-C-T p.His332His synonymous AGBL1 1 82572 1.21106E-5 41286 0 1.61563E-5
15-86813257-A-G p.Asn334Ser missense AGBL1 3 82550 3.63416E-5 41275 0 3.1839E-5
15-86813271-G-A p.Glu339Lys missense AGBL1 2 82532 2.4233E-5 41266 0 NA
15-86813295-T-C p.Tyr347His missense AGBL1 1 82400 1.21359E-5 41200 0 NA
15-86813297-T-C p.Tyr347Tyr splice_region+synonymous AGBL1 1 82388 1.21377E-5 41194 0 NA
15-86813298-G-A p.Gly348Arg missense+splice_region AGBL1 2 82382 2.42771E-5 41191 0 3.18431E-5
15-86813299-G-T c.1042+1G>T splice_donor AGBL1 1 82378 1.21392E-5 41189 0 NA
15-86813301-A-G c.1042+3A>G splice_region AGBL1 4 82386 4.85519E-5 41193 0 2.32078E-5
15-86813306-C-T c.1042+8C>T splice_region AGBL1 1 82326 1.21468E-5 41163 0 8.41791E-5
15-86814842-T-C c.1043-8T>C splice_region AGBL1 5 81894 6.10545E-5 40947 0 3.18431E-5
15-86814844-G-T c.1043-6G>T splice_region AGBL1 1 81952 1.22023E-5 40976 0 NA
15-86814852-A-T p.Met349Leu missense+splice_region AGBL1 22 82068 2.6807E-4 41034 1 0.00352467
15-86814855-C-T p.Gln350* stop_gained AGBL1 2 82062 2.43718E-5 41031 0 1.20446E-5
15-86814857-G-A p.Gln350Gln synonymous AGBL1 1 82086 1.21823E-5 41043 0 NA
15-86814858-C-T p.Pro351Ser missense AGBL1 2 82098 2.43611E-5 41049 0 4.01426E-6
15-86814862-C-T p.Thr352Ile missense AGBL1 1 82142 1.2174E-5 41071 0 4.01352E-6
15-86814866-A-G p.Leu353Leu synonymous AGBL1 58263 81626 0.71378 40813 21027 0.751259
15-86814869-T-G p.Tyr354* stop_gained AGBL1 1 82204 1.21649E-5 41102 0 NA
15-86814873-G-A p.Val356Met missense AGBL1 1 82242 1.21592E-5 41121 0 3.18613E-5
15-86814875-G-A p.Val356Val synonymous AGBL1 1 82260 1.21566E-5 41130 0 NA
15-86814882-G-A p.Ala359Thr missense AGBL1 1 82274 1.21545E-5 41137 0 6.37349E-5
15-86814883-C-A p.Ala359Asp missense AGBL1 2 82300 2.43013E-5 41150 0 3.31225E-5
15-86814885-C-G p.Leu360Val missense AGBL1 8 82304 9.72006E-5 41152 0 1.90454E-4
15-86814888-C-T p.Leu361Phe missense AGBL1 1 82288 1.21524E-5 41144 0 NA
15-86814901-C-T p.Thr365Ile missense AGBL1 2 82274 2.4309E-5 41137 0 4.01236E-6
15-86814910-G-A p.Arg368Lys missense AGBL1 1 82288 1.21524E-5 41144 0 NA
15-86814918-C-T p.His371Tyr missense AGBL1 1 82240 1.21595E-5 41120 0 NA
15-86814928-G-A p.Cys374Tyr missense AGBL1 2 82138 2.43493E-5 41069 0 1.20398E-5
15-86822880-C-T p.Arg381Cys missense AGBL1 10 82464 1.21265E-4 41232 0 6.25E-4
15-86822881-G-A p.Arg381His missense AGBL1 7 82452 8.48979E-5 41226 0 4.98347E-5
15-86822897-T-TG p.Ala387fs frameshift AGBL1 1 82574 1.21103E-5 41287 0 8.03335E-6
15-86822903-C-T p.Gly388Gly synonymous AGBL1 5 82580 6.05473E-5 41290 0 3.18735E-5
15-86822903-C-A p.Gly388Gly synonymous AGBL1 1 82580 1.21095E-5 41290 0 NA
15-86822904-G-A p.Gly389Arg missense AGBL1 26 82590 3.14808E-4 41295 0 5.03525E-4
15-86822921-C-G p.Cys394Trp missense AGBL1 2 82656 2.41967E-5 41328 0 NA
15-86822926-A-G p.Tyr396Cys missense AGBL1 269 82658 0.00325437 41329 2 0.006875
15-86822927-T-C p.Tyr396Tyr synonymous AGBL1 1 82640 1.21007E-5 41320 0 NA
15-86822931-C-A p.Leu398Ile missense AGBL1 1 82672 1.2096E-5 41336 0 NA
15-86822936-C-T p.Thr399Thr synonymous AGBL1 1 82680 1.20948E-5 41340 0 2.48517E-5
15-86822943-GT-G p.Val402fs frameshift AGBL1 2 82690 2.41867E-5 41345 0 NA
15-86822961-G-A p.Glu408Lys missense AGBL1 1 82666 1.20969E-5 41333 0 4.01516E-6
15-86822964-G-A p.Asp409Asn missense AGBL1 1 82646 1.20998E-5 41323 0 NA
15-86822964-G-T p.Asp409Tyr missense AGBL1 1 82646 1.20998E-5 41323 0 NA
15-86822968-T-C p.Val410Ala missense AGBL1 1 82650 1.20992E-5 41325 0 NA
15-86822985-C-A p.His416Asn missense AGBL1 1 82588 1.21083E-5 41294 0 3.18471E-5
15-86822991-C-A p.Pro418Thr missense AGBL1 1 82560 1.21124E-5 41280 0 NA
15-86822995-A-G p.Tyr419Cys missense AGBL1 2 82534 2.42324E-5 41267 0 8.28391E-6
15-86823004-C-T p.Thr422Ile missense AGBL1 1 82480 1.21242E-5 41240 0 1.65744E-5
15-86823011-C-T p.Leu424Leu synonymous AGBL1 4 82390 4.85496E-5 41195 0 1.65774E-5
15-86823014-G-A p.Met425Ile missense+splice_region AGBL1 1 82366 1.21409E-5 41183 0 3.18634E-5
15-86838481-T-C c.1276-5T>C splice_region AGBL1 1 82102 1.218E-5 41051 0 2.0145E-5
15-86838482-C-G c.1276-4C>G splice_region AGBL1 1 82100 1.21803E-5 41050 0 8.05678E-6
15-86838488-T-A p.Thr426Thr splice_region+synonymous AGBL1 1 82126 1.21764E-5 41063 0 NA
15-86838490-A-G p.His427Arg missense AGBL1 1 82122 1.2177E-5 41061 0 4.02402E-6
15-86838493-T-C p.Leu428Pro missense AGBL1 1 82130 1.21758E-5 41065 0 3.1837E-5
15-86838496-AC-GT p.Asp429Gly missense AGBL1 1 82134 1.21752E-5 41067 0 NA
15-86838497-C-T p.Asp429Asp synonymous AGBL1 7355 81950 0.0897499 40975 796 0.152369
15-86838503-G-A p.Leu431Leu synonymous AGBL1 2 82140 2.43487E-5 41070 0 1.68691E-5
15-86838508-A-G p.Lys433Arg missense AGBL1 3 82130 3.65275E-5 41065 0 1.60854E-5
15-86838511-G-A p.Ser434Asn missense AGBL1 2 82130 2.43516E-5 41065 0 4.02123E-6
15-86838511-G-C p.Ser434Thr missense AGBL1 4 82130 4.87033E-5 41065 0 4.02123E-6
15-86838522-A-G p.Lys438Glu missense AGBL1 1 82158 1.21717E-5 41079 0 8.34154E-6
15-86838529-T-G p.Val440Gly missense AGBL1 1 82128 1.21761E-5 41064 0 NA
15-86838537-C-T p.Arg443Trp missense AGBL1 10 82120 1.21773E-4 41060 0 1.40752E-4
15-86838538-G-A p.Arg443Gln missense AGBL1 2 82120 2.43546E-5 41060 0 0.00100806
15-86838550-T-C p.Leu447Pro missense AGBL1 1 82136 1.21749E-5 41068 0 NA
15-86838554-C-T p.Cys448Cys synonymous AGBL1 2 82134 2.43505E-5 41067 0 NA
15-86838559-C-T p.Thr450Met missense AGBL1 2 82118 2.43552E-5 41059 0 6.36821E-5
15-86838560-G-T p.Thr450Thr synonymous AGBL1 9 82122 1.09593E-4 41061 0 0.00100806
15-86838560-G-A p.Thr450Thr synonymous AGBL1 2 82122 2.4354E-5 41061 0 6.25E-4
15-86838570-A-G p.Asn454Asp missense AGBL1 1 82144 1.21737E-5 41072 0 6.7314E-5
15-86838574-C-A p.Pro455Gln missense AGBL1 3 82144 3.65212E-5 41072 0 1.2738E-4
15-86838574-C-T p.Pro455Leu missense AGBL1 3 82144 3.65212E-5 41072 0 3.18451E-5
15-86838575-G-A p.Pro455Pro synonymous AGBL1 9 82148 1.09558E-4 41074 0 6.36983E-5
15-86838581-C-G p.Pro457Pro synonymous AGBL1 1 82152 1.21726E-5 41076 0 NA
15-86838586-T-C p.Val459Ala missense AGBL1 1 82162 1.21711E-5 41081 0 NA
15-86838595-C-T p.Thr462Met missense AGBL1 1 82164 1.21708E-5 41082 0 3.43053E-5
15-86838596-G-A p.Thr462Thr synonymous AGBL1 4 82152 4.86902E-5 41076 0 4.1115E-6
15-86838597-G-T p.Ala463Ser missense AGBL1 6 82144 7.30425E-5 41072 0 5.03525E-4
15-86838604-C-T p.Pro465Leu missense AGBL1 1 82168 1.21702E-5 41084 0 8.64573E-6
15-86838608-G-A p.Glu466Glu synonymous AGBL1 1 82166 1.21705E-5 41083 0 NA
15-86838615-A-G p.Ser469Gly missense AGBL1 3 82162 3.65132E-5 41081 0 NA
15-86838624-C-T p.His472Tyr missense AGBL1 4 82132 4.87021E-5 41066 0 6.25E-4
15-86838634-A-G p.Gln475Arg missense AGBL1 15 82072 1.82766E-4 41036 0 2.01752E-4
15-86838643-A-G c.1429+4A>G splice_region AGBL1 1 81950 1.22026E-5 40975 0 8.94278E-6
15-86940507-ATCAAAGAAGCAAAAAAGAAGTTTAGAAAACTATAAAATAGAGCAATATTAAAATTTGGGTTTAATTTTCTTATGTCCCTTTTTCTGCAGGACATCG-A p.Arg477fs frameshift AGBL1 1 70252 1.42345E-5 35126 0 NA
15-86940593-G-T c.1430-4G>T splice_region AGBL1 1 78186 1.279E-5 39093 0 NA
15-86940600-A-G p.His478Arg missense AGBL1 1 79714 1.25448E-5 39857 0 NA
15-86940603-G-A p.Arg479His missense AGBL1 8 80498 9.93814E-5 40249 0 3.13027E-4
15-86940607-A-G p.Pro480Pro synonymous AGBL1 1771 80962 0.0218745 40481 29 0.0475297
15-86940613-G-T p.Gln482His missense AGBL1 4 81484 4.90894E-5 40742 0 5.03525E-4
15-86940614-G-A p.Val483Met missense AGBL1 1 81498 1.22702E-5 40749 0 NA
15-86940614-G-T p.Val483Leu missense AGBL1 2 81498 2.45405E-5 40749 0 1.69877E-5
15-86940619-C-T p.Ile484Ile synonymous AGBL1 1 81590 1.22564E-5 40795 0 NA
15-86940622-T-C p.Thr485Thr synonymous AGBL1 43695 79968 0.546406 39984 12760 0.617531
15-86940623-G-A p.Ala486Thr missense AGBL1 1 81792 1.22261E-5 40896 0 6.25E-4
15-86940626-C-T p.Arg487* stop_gained AGBL1 2 81822 2.44433E-5 40911 0 5.03525E-4
15-86940634-T-A p.His489Gln missense AGBL1 7 81986 8.53804E-5 40993 0 1.20918E-5
15-86940644-A-G p.Ser493Gly missense AGBL1 6 82058 7.3119E-5 41029 0 5.03525E-4
15-86940645-G-C p.Ser493Thr missense AGBL1 44 82066 5.36154E-4 41033 0 0.0025
15-86940655-T-A p.Ser496Arg missense AGBL1 2 82110 2.43576E-5 41055 0 8.30882E-6
15-86940657-G-T p.Trp497Leu missense AGBL1 22 82102 2.67959E-4 41051 0 4.1425E-4
15-86940659-G-C p.Val498Leu missense AGBL1 9 82100 1.09622E-4 41050 0 5.03525E-4
15-86940661-G-A p.Val498Val synonymous AGBL1 1 82102 1.218E-5 41051 0 NA
15-86940669-G-A p.Gly501Asp missense AGBL1 2 82128 2.43522E-5 41064 0 NA
15-86940671-A-T p.Thr502Ser missense AGBL1 1 82132 1.21755E-5 41066 0 NA
15-86940673-C-T p.Thr502Thr synonymous AGBL1 9656 81970 0.117799 40985 612 0.127926
15-86940679-G-T p.Glu504Asp missense AGBL1 23 82130 2.80044E-4 41065 0 6.68832E-4
15-86940683-C-T p.Leu506Leu synonymous AGBL1 45 82134 5.47885E-4 41067 1 3.45957E-4
15-86940692-AG-A p.Ser509fs frameshift AGBL1 1 82142 1.2174E-5 41071 0 NA
15-86940709-G-T p.Arg514Ser missense AGBL1 33 82058 4.02155E-4 41029 0 7.33044E-4
15-86940714-T-C p.Leu516Ser missense AGBL1 1 82094 1.21812E-5 41047 0 NA
15-86940715-G-A p.Leu516Leu synonymous AGBL1 2 82082 2.43659E-5 41041 0 4.02395E-6
15-86940721-A-C p.Glu518Asp missense AGBL1 3 82090 3.65453E-5 41045 0 1.20714E-5
15-86940725-T-C p.Phe520Leu missense AGBL1 3 82104 3.6539E-5 41052 0 3.18532E-5
15-86940751-C-T p.Leu528Leu synonymous AGBL1 1 82030 1.21907E-5 41015 0 NA
15-86940752-A-C p.Asn529His missense AGBL1 1 82032 1.21904E-5 41016 0 8.37156E-6
15-86940763-T-C p.Gly532Gly synonymous AGBL1 48 81936 5.85823E-4 40968 0 0.00152925
15-86940767-A-G p.Ile534Val missense AGBL1 1 81886 1.22121E-5 40943 0 9.55353E-5
15-86940772-C-T p.Asn535Asn synonymous AGBL1 1 81702 1.22396E-5 40851 0 8.19706E-6
15-87066034-C-T c.1611-7C>T splice_region AGBL1 2 82560 2.42248E-5 41280 0 4.20975E-5
15-87066035-C-G c.1611-6C>G splice_region AGBL1 2 82560 2.42248E-5 41280 0 1.2068E-5
15-87066037-G-A c.1611-4G>A splice_region AGBL1 2 82558 2.42254E-5 41279 0 1.27389E-4
15-87066046-G-A p.Arg539Lys missense AGBL1 2 82608 2.42107E-5 41304 0 6.36943E-5
15-87066059-C-T p.Ser543Ser synonymous AGBL1 11 82640 1.33107E-4 41320 0 0.00100705
15-87066060-G-A p.Gly544Arg missense AGBL1 1 82640 1.21007E-5 41320 0 5.8071E-5
15-87066063-G-C p.Glu545Gln missense AGBL1 1 82654 1.20986E-5 41327 0 3.18512E-5
15-87066065-A-G p.Glu545Glu synonymous AGBL1 3 82658 3.62941E-5 41329 0 3.1841E-4
15-87066069-T-A p.Leu547Met missense AGBL1 19 82664 2.29846E-4 41332 0 0.00100705
15-87066086-T-G p.Leu552Leu synonymous AGBL1 1 82674 1.20957E-5 41337 0 4.01281E-6
15-87066094-G-A p.Ser555Asn missense AGBL1 25 82700 3.02297E-4 41350 0 2.07142E-4
15-87066094-G-C p.Ser555Thr missense AGBL1 1 82704 1.20913E-5 41352 0 3.18492E-4
15-87066101-T-C p.His557His synonymous AGBL1 1 82708 1.20907E-5 41354 0 NA
15-87066104-G-T p.Leu558Leu synonymous AGBL1 2 82712 2.41803E-5 41356 0 9.55171E-5
15-87066106-AGCCAACCATTTACCAT-A p.Thr561fs frameshift AGBL1 3 82714 3.62696E-5 41357 0 NA
15-87066107-GCCAA-G p.Thr561fs frameshift AGBL1 1 82720 1.2089E-5 41360 0 1.6564E-5
15-87066108-C-A p.Pro560Thr missense AGBL1 1 82714 1.20899E-5 41357 0 NA
15-87066114-A-G p.Ile562Val missense AGBL1 1 82738 1.20863E-5 41369 0 3.1839E-5
15-87066122-T-C p.His564His synonymous AGBL1 1 82730 1.20875E-5 41365 0 1.2738E-4
15-87066125-C-T p.Ala565Ala synonymous AGBL1 2 82734 2.41739E-5 41367 0 3.1839E-5
15-87066129-G-A p.Gly567Ser missense AGBL1 1 82732 1.20872E-5 41366 0 NA
15-87066130-G-A p.Gly567Asp missense AGBL1 2 82732 2.41744E-5 41366 0 3.31252E-5
15-87066130-G-T p.Gly567Val missense AGBL1 4 82730 4.83501E-5 41365 0 8.2813E-6
15-87066136-T-C p.Leu569Pro missense AGBL1 3 82736 3.62599E-5 41368 0 1.20366E-5
15-87066144-C-A p.Leu572Met missense AGBL1 1 82738 1.20863E-5 41369 0 NA
15-87066159-C-T p.Arg577* stop_gained AGBL1 4 82732 4.83489E-5 41366 0 7.45366E-5
15-87066162-A-G p.Ser578Gly missense AGBL1 2 82726 2.41762E-5 41363 0 6.36983E-5
15-87066163-G-A p.Ser578Asn missense AGBL1 1 82728 1.20878E-5 41364 0 8.28226E-6
15-87066167-C-T p.Pro579Pro synonymous AGBL1 1 82714 1.20899E-5 41357 0 6.37064E-5
15-87066168-G-A p.Val580Met missense+splice_region AGBL1 943 82668 0.0114071 41334 12 0.0134757
15-87066170-G-A p.Val580Val splice_region+synonymous AGBL1 1 82700 1.20919E-5 41350 0 NA
15-87089227-T-C c.1741-6T>C splice_region AGBL1 24 82278 2.91694E-4 41139 0 8.28184E-4
15-87089229-G-C c.1741-4G>C splice_region AGBL1 1 82296 1.21513E-5 41148 0 NA
15-87089229-G-A c.1741-4G>A splice_region AGBL1 1 82296 1.21513E-5 41148 0 NA
15-87089233-G-C p.Val581Leu missense+splice_region AGBL1 1 82290 1.21521E-5 41145 0 NA
15-87089233-G-T p.Val581Phe missense+splice_region AGBL1 1 82290 1.21521E-5 41145 0 NA
15-87089235-T-G p.Val581Val splice_region+synonymous AGBL1 1 82298 1.2151E-5 41149 0 3.18593E-5
15-87089252-G-A p.Gly587Asp missense AGBL1 3 82288 3.64573E-5 41144 0 1.68158E-5
15-87089261-A-G p.Gln590Arg missense AGBL1 2 82304 2.43002E-5 41152 0 1.20676E-5
15-87089270-A-T p.Asn593Ile missense AGBL1 1 82298 1.2151E-5 41149 0 1.60861E-5
15-87089271-T-G p.Asn593Lys missense AGBL1 1 82298 1.2151E-5 41149 0 8.04382E-6
15-87089277-C-A p.Phe595Leu missense AGBL1 2 82294 2.43031E-5 41147 0 NA
15-87089282-A-T p.Tyr597Phe missense AGBL1 1 82274 1.21545E-5 41137 0 4.02172E-6
15-87089282-A-G p.Tyr597Cys missense AGBL1 1 82274 1.21545E-5 41137 0 NA
15-87089286-C-T p.Gly598Gly synonymous AGBL1 2 82296 2.43025E-5 41148 0 NA
15-87089295-C-A p.Ile601Ile synonymous AGBL1 18 82286 2.18749E-4 41143 0 0.004375
15-87089299-G-A p.Glu603Lys missense AGBL1 2 82320 2.42954E-5 41160 0 1.20638E-5
15-87089303-C-T p.Thr604Ile missense AGBL1 1 82336 1.21454E-5 41168 0 4.0211E-6
15-87089304-C-T p.Thr604Thr synonymous AGBL1 1 82328 1.21465E-5 41164 0 8.04246E-6
15-87089307-G-A p.Leu605Leu synonymous AGBL1 324 82330 0.00393538 41165 1 0.00799669
15-87089310-G-A p.Trp606* stop_gained AGBL1 1 82334 1.21457E-5 41167 0 4.02162E-6
15-87089314-G-A p.Ala608Thr missense AGBL1 1 82346 1.21439E-5 41173 0 8.34432E-6
15-87089329-G-A p.Gly613Ser missense AGBL1 3 82386 3.6414E-5 41193 0 1.20611E-5
15-87089330-G-A p.Gly613Asp missense AGBL1 5 82392 6.06855E-5 41196 0 0.00125
15-87089333-C-G p.Thr614Arg missense AGBL1 1 82402 1.21356E-5 41201 0 NA
15-87089337-T-A p.Ser615Ser synonymous AGBL1 1 82398 1.21362E-5 41199 0 NA
15-87089344-C-A p.Leu618Ile missense AGBL1 1 82424 1.21324E-5 41212 0 NA
15-87089346-A-G p.Leu618Leu synonymous AGBL1 1 82434 1.21309E-5 41217 0 1.6711E-5
15-87089363-G-A p.Arg624Lys missense+splice_region AGBL1 7 82426 8.49247E-5 41213 0 3.35576E-5
15-87089366-T-C c.1872+2T>C splice_donor AGBL1 11 82398 1.33498E-4 41199 0 1.32968E-4
15-87089371-C-T c.1872+7C>T splice_region AGBL1 7 82366 8.49865E-5 41183 0 1.27673E-4
15-87089372-G-A c.1872+8G>A splice_region AGBL1 26 82310 3.15879E-4 41155 0 8.62124E-4
15-87097590-A-C c.1873-2A>C splice_acceptor AGBL1 2 81922 2.44135E-5 40961 0 NA
15-87097595-C-T p.Leu626Phe missense AGBL1 14 81962 1.70811E-4 40981 0 0.00201613
15-87097638-G-A p.Ser640Asn missense AGBL1 1 81882 1.22127E-5 40941 0 2.50853E-5
15-87097644-G-A p.Cys642Tyr missense AGBL1 1 81854 1.22169E-5 40927 0 NA
15-87097654-C-T p.Leu645Leu synonymous AGBL1 2 81820 2.44439E-5 40910 0 3.18613E-5
15-87097654-C-G p.Leu645Leu synonymous AGBL1 1 81820 1.2222E-5 40910 0 3.18613E-5
15-87097655-G-A p.Val646Met missense AGBL1 1 81818 1.22222E-5 40909 0 4.87377E-5
15-87097668-G-A p.Arg650Gln missense AGBL1 1 81778 1.22282E-5 40889 0 4.79962E-6
15-87097677-C-T p.Thr653Met missense AGBL1 3 81730 3.67062E-5 40865 0 2.42072E-5
15-87097678-G-T p.Thr653Thr synonymous AGBL1 7 81716 8.56625E-5 40858 1 3.18735E-5
15-87097678-G-A p.Thr653Thr synonymous AGBL1 3 81716 3.67125E-5 40858 0 1.20662E-4
15-87097680-C-A p.Ala654Asp missense AGBL1 1 81690 1.22414E-5 40845 0 4.74847E-6
15-87097687-G-T p.Val656Val synonymous AGBL1 2 81634 2.44996E-5 40817 0 NA
15-87097689-T-C p.Val657Ala missense AGBL1 1 81620 1.22519E-5 40810 0 6.38366E-5
15-87097700-G-C p.Glu661Gln missense AGBL1 42 81492 5.15388E-4 40746 0 6.25E-4
15-87097700-GA-G p.Glu661fs frameshift AGBL1 2 81498 2.45405E-5 40749 0 NA
15-87097703-A-G p.Met662Val missense AGBL1 2 81456 2.45531E-5 40728 0 NA
15-87097705-G-A p.Met662Ile missense AGBL1 7 81438 8.5955E-5 40719 0 6.25E-4
15-87097709-G-T p.Val664Leu missense AGBL1 1 81394 1.22859E-5 40697 0 2.38277E-5
15-87097735-C-T p.Ser672Ser synonymous AGBL1 13 80758 1.60975E-4 40379 0 1.29239E-4
15-87097750-C-T p.Cys677Cys synonymous AGBL1 1 79936 1.251E-5 39968 0 3.00734E-5
15-87097753-C-T p.Asn678Asn synonymous AGBL1 1 79814 1.25291E-5 39907 0 3.18715E-5
15-87097759-C-T p.Gly680Gly synonymous AGBL1 1 79364 1.26002E-5 39682 0 NA
15-87097761-C-T p.Pro681Leu missense AGBL1 3 79212 3.78731E-5 39606 0 1.32189E-5
15-87097763-T-C p.Tyr682His missense AGBL1 2 79044 2.53024E-5 39522 0 NA
15-87097774-T-C c.2049+6T>C splice_region AGBL1 148 77886 0.00190021 38943 0 0.00727564
15-87099448-G-A c.2050-6G>A splice_region AGBL1 8 80672 9.9167E-5 40336 0 6.36943E-5
15-87099453-G-C c.2050-1G>C splice_acceptor AGBL1 1 80826 1.23723E-5 40413 0 4.44848E-5
15-87099454-T-A p.Cys684Ser missense+splice_region AGBL1 1 80842 1.23698E-5 40421 0 4.03073E-6
15-87099455-G-A p.Cys684Tyr missense+splice_region AGBL1 1 80858 1.23674E-5 40429 0 NA
15-87099462-G-A p.Gln686Gln synonymous AGBL1 1 80936 1.23554E-5 40468 0 NA
15-87099469-T-C p.Leu689Leu synonymous AGBL1 2 81014 2.46871E-5 40507 0 8.78272E-6
15-87099478-AC-A p.Thr692fs frameshift AGBL1 1 81036 1.23402E-5 40518 0 1.70961E-5
15-87099481-A-G p.Lys693Glu missense AGBL1 388 81030 0.00478835 40515 5 0.00955475
15-87099483-G-A p.Lys693Lys synonymous AGBL1 1 81052 1.23378E-5 40526 0 1.70297E-5
15-87099494-C-T p.Ala697Val missense AGBL1 1 80966 1.23509E-5 40483 0 4.02211E-6
15-87099503-T-A p.Val700Glu missense AGBL1 1 80842 1.23698E-5 40421 0 NA
15-87099508-G-A p.Gly702Ser missense AGBL1 2184 80708 0.0270605 40354 86 0.0456398
15-87099509-G-A p.Gly702Asp missense AGBL1 1 80752 1.23836E-5 40376 0 4.02421E-6
15-87099517-G-T c.2112+1G>T splice_donor AGBL1 3 80630 3.7207E-5 40315 0 4.02615E-6
15-87099520-T-C c.2112+4T>C splice_region AGBL1 2 80552 2.48287E-5 40276 0 3.18451E-5
15-87217500-G-A c.2113-4G>A splice_region AGBL1 2 81968 2.43998E-5 40984 0 3.1835E-5
15-87217500-G-T c.2113-4G>T splice_region AGBL1 1 81968 1.21999E-5 40984 0 8.31767E-6
15-87217504-G-C p.Gly705Arg missense+splice_region AGBL1 3 81968 3.65996E-5 40984 0 0.00125
15-87217504-G-T p.Gly705Cys missense+splice_region AGBL1 1 81968 1.21999E-5 40984 0 4.13664E-6
15-87217506-T-A p.Gly705Gly splice_region+synonymous AGBL1 1 81960 1.22011E-5 40980 0 NA
15-87217510-C-T p.Gln707* stop_gained AGBL1 1 81962 1.22008E-5 40981 0 NA
15-87217513-T-C p.Phe708Leu missense AGBL1 1 81970 1.21996E-5 40985 0 NA
15-87217551-C-G p.Phe720Leu missense AGBL1 1 81782 1.22276E-5 40891 0 4.08854E-6
15-87217553-G-C p.Cys721Ser missense AGBL1 110 81756 0.00134547 40878 0 0.001875
15-87217562-T-C p.Leu724Pro missense AGBL1 1 81696 1.22405E-5 40848 0 4.0819E-6
15-87217563-C-T p.Leu724Leu synonymous AGBL1 4 81682 4.89704E-5 40841 0 2.85717E-5
15-87217568-T-A p.Ile726Asn missense AGBL1 1 81642 1.22486E-5 40821 0 4.0779E-6
15-87217573-G-A p.Glu728Lys missense AGBL1 9 81594 1.10302E-4 40797 0 1.91083E-4
15-87217581-A-G p.Lys730Lys synonymous AGBL1 4 81544 4.90533E-5 40772 0 9.13759E-6
15-87217587-C-T p.Ala732Ala synonymous AGBL1 1 81504 1.22693E-5 40752 0 1.45375E-4
15-87217590-C-G p.Ser733Arg missense AGBL1 1 81462 1.22757E-5 40731 0 NA
15-87217591-T-C p.Cys734Arg missense AGBL1 6 81484 7.36341E-5 40742 0 3.65141E-5
15-87217592-G-C p.Cys734Ser missense AGBL1 6 81456 7.36594E-5 40728 0 9.55292E-5
15-87217612-C-G p.Gln741Glu missense AGBL1 2 81192 2.4633E-5 40596 0 3.18471E-5
15-87217613-A-G p.Gln741Arg missense AGBL1 68029 75560 0.900331 37780 30667 0.945625
15-87217634-C-G p.Ala748Gly missense AGBL1 57 80906 7.04521E-4 40453 0 0.00133784
15-87217634-C-T p.Ala748Val missense AGBL1 1 80906 1.236E-5 40453 0 NA
15-87217639-G-A p.Glu750Lys missense AGBL1 1 80830 1.23716E-5 40415 0 NA
15-87217644-C-T p.Asp751Asp synonymous AGBL1 4 80700 4.95663E-5 40350 0 0.00125156
15-87217645-G-A p.Ala752Thr missense AGBL1 4 80632 4.96081E-5 40316 0 6.37389E-5
15-87217649-T-C p.Leu753Pro missense AGBL1 4 80568 4.96475E-5 40284 0 2.42901E-5
15-87217649-TG-T p.Asp754fs frameshift AGBL1 1 80570 1.24116E-5 40285 0 4.04835E-6
15-87217656-G-C p.Gln755His missense AGBL1 1 80318 1.24505E-5 40159 0 4.05531E-6
15-87217658-A-C p.His756Pro missense AGBL1 2 80212 2.49339E-5 40106 0 1.27413E-4
15-87217659-C-T p.His756His synonymous AGBL1 2 80188 2.49414E-5 40094 0 1.36804E-4
15-87217660-C-T p.Leu757Phe missense AGBL1 1 80162 1.24747E-5 40081 0 NA
15-87217666-C-T p.Arg759* stop_gained AGBL1 199 79848 0.00249224 39924 1 0.00178971
15-87217666-C-A p.Arg759Arg splice_region+synonymous AGBL1 2 79872 2.50401E-5 39936 0 NA
15-87217667-G-A p.Arg759Gln missense+splice_region AGBL1 3 79814 3.75874E-5 39907 0 9.44417E-5
15-87217669-T-C c.2276+2T>C splice_donor AGBL1 1 79708 1.25458E-5 39854 0 NA
15-87217671-A-G c.2276+4A>G splice_region AGBL1 1 79586 1.2565E-5 39793 0 3.18471E-5
15-87217673-A-G c.2276+6A>G splice_region AGBL1 1 79478 1.25821E-5 39739 0 NA
15-87217675-G-A c.2276+8G>A splice_region AGBL1 18 79186 2.27313E-4 39593 0 3.45692E-5
15-87531232-A-G p.Asn764Ser missense AGBL1 1 61672 1.62148E-5 30836 0 8.30261E-6
15-87531241-C-T p.Pro767Leu missense AGBL1 1 61678 1.62132E-5 30839 0 NA
15-87531246-C-T p.His769Tyr missense AGBL1 1 61682 1.62122E-5 30841 0 3.18451E-5
15-87531266-C-G p.His775Gln missense AGBL1 6 61658 9.7311E-5 30829 0 1.3256E-4
15-87531280-C-A p.Thr780Lys missense AGBL1 3 61628 4.86792E-5 30814 0 8.28404E-6
15-87531280-C-T p.Thr780Ile missense AGBL1 1 61628 1.62264E-5 30814 0 NA
15-87531281-A-C p.Thr780Thr synonymous AGBL1 51379 61420 0.836519 30710 21674 0.903125
15-87531281-AAA-CAG p.ThrAsn780ThrSer missense AGBL1 60 61624 9.73647E-4 30812 4 NA
15-87531283-A-G p.Asn781Ser missense AGBL1 314 61616 0.00509608 30808 2 0.0155763
15-87531295-T-C p.Met785Thr missense AGBL1 10 61620 1.62285E-4 30810 0 2.54842E-4
15-87531299-C-G p.Asn786Lys missense AGBL1 1 61612 1.62306E-5 30806 0 6.25E-4
15-87531310-A-G p.His790Arg missense AGBL1 5 61582 8.11926E-5 30791 0 6.36862E-5
15-87531316-C-T p.Ser792Phe missense AGBL1 1 61592 1.62359E-5 30796 0 4.15255E-5
15-87531319-C-T p.Pro1062Leu missense+splice_region AGBL1 2 61580 3.24781E-5 30790 0 6.25E-4
15-87531319-C-G p.Pro1062Arg missense+splice_region AGBL1 3 61580 4.87171E-5 30790 0 NA
15-87531320-G-GT p.Ter794fs frameshift AGBL1 89 61574 0.00144542 30787 0 0.00168811
15-87531320-G-A c.3185+1G>A splice_donor AGBL1 27 61576 4.38483E-4 30788 0 0.00198666
15-87531326-A-G c.3185+7A>G splice_region AGBL1 2 61576 3.24802E-5 30788 0 1.66317E-5
15-87572053-CAG-C c.3186-2_3186-1delAG splice_acceptor AGBL1 2 78844 2.53665E-5 39422 0 8.47529E-6
15-87572057-G-C p.Val1063Leu missense+splice_region AGBL1 4 78890 5.07035E-5 39445 0 3.18776E-5
15-87572057-G-A p.Val1063Ile missense+splice_region AGBL1 1 78890 1.26759E-5 39445 0 8.4528E-6