Variant

Variant ID Consequence Effect Gene AC AN AF NS NHOM maxEAF
7-150783103-G-A c.-354+7G>A splice_region AGAP3 3 64 0.046875 32 0 0.106705
7-150783860-C-CGCA p.Gln15dup conservative_inframe_insertion AGAP3 2 6176 3.23834E-4 3088 0 1.27627E-4
7-150783891-G-T p.Gly21Gly synonymous AGAP3 1 5492 1.82083E-4 2746 0 NA
7-150783897-C-CGGT p.Gly24dup disruptive_inframe_insertion AGAP3 11 5156 0.00213344 2578 0 0.0400615
7-150783900-C-CG p.Ala25fs frameshift AGAP3 4942 4982 0.991971 2491 2459 0.981747
7-150783901-GCT-G p.Ala25fs frameshift AGAP3 7 5032 0.0013911 2516 0 0.49345
7-150783901-GCTGCC-G p.Ala25fs frameshift AGAP3 1 5044 1.98255E-4 2522 0 0.00218341
7-150783903-T-G p.Ala25Ala synonymous AGAP3 2730 2736 0.997807 1368 1362 1.0
7-150783906-C-G p.Ala26Ala synonymous AGAP3 2732 2734 0.999268 1367 1365 0.999585
7-150783908-C-CG p.Gln28fs frameshift AGAP3 2920 2922 0.999316 1461 1459 1.0
7-150783909-GCA-G p.Gln28fs frameshift AGAP3 1 3004 3.32889E-4 1502 0 0.214286
7-150783911-A-G p.Gln28Arg missense AGAP3 2785 2788 0.998924 1394 1391 1.0
7-150783917-T-G p.Leu30Arg missense AGAP3 2706 2708 0.999261 1354 1352 1.0
7-150783919-GTCT-G p.Val31_Cys32delinsGly disruptive_inframe_deletion AGAP3 2918 2920 0.999315 1460 1458 0.999587
7-150783922-T-TGGGG p.Cys32fs frameshift AGAP3 2998 3000 0.999333 1500 1498 0.999628
7-150783951-C-T p.Pro41Pro synonymous AGAP3 1 32628 3.06485E-5 16314 0 9.48407E-5
7-150783961-G-C p.Gly45Arg missense AGAP3 1 40964 2.44117E-5 20482 0 NA
7-150783963-C-A p.Gly45Gly synonymous AGAP3 2 41516 4.81742E-5 20758 0 2.21926E-4
7-150783963-C-T p.Gly45Gly synonymous AGAP3 2 41516 4.81742E-5 20758 0 2.21926E-4
7-150783974-C-T p.Pro49Leu missense AGAP3 1 53412 1.87224E-5 26706 0 7.818E-6
7-150783977-C-T p.Ser50Leu missense AGAP3 7 55438 1.26267E-4 27719 0 7.31475E-5
7-150783989-C-T p.Ala54Val missense AGAP3 2 63650 3.14218E-5 31825 0 5.76449E-6
7-150783996-G-T p.Gly56Gly synonymous AGAP3 1 67704 1.47702E-5 33852 0 1.15428E-5
7-150783998-C-T p.Pro57Leu missense AGAP3 6 69850 8.58984E-5 34925 0 3.44234E-5
7-150784000-C-T p.Pro58Ser missense AGAP3 5 72308 6.91486E-5 36154 0 1.36073E-4
7-150784000-C-A p.Pro58Thr missense AGAP3 1 72308 1.38297E-5 36154 0 NA
7-150784001-C-T p.Pro58Leu missense AGAP3 10 72308 1.38297E-4 36154 0 1.24159E-4
7-150784013-C-T p.Ala62Val missense AGAP3 1 75408 1.32612E-5 37704 0 8.689E-6
7-150784023-C-T p.Asn65Asn synonymous AGAP3 2 77820 2.57003E-5 38910 0 1.22884E-5
7-150784032-C-A p.Ala68Ala synonymous AGAP3 2 78754 2.53955E-5 39377 0 NA
7-150784041-C-G p.Ala71Ala synonymous AGAP3 1 79502 1.25783E-5 39751 0 1.73602E-5
7-150784053-C-G p.Arg75Arg synonymous AGAP3 1 80096 1.2485E-5 40048 0 NA
7-150784062-C-T p.Ser78Ser synonymous AGAP3 48 80450 5.96644E-4 40225 0 5.12481E-4
7-150784073-A-G p.Asn82Ser missense AGAP3 1 80786 1.23784E-5 40393 0 8.61178E-6
7-150784098-C-A p.Ile90Ile synonymous AGAP3 2 80892 2.47243E-5 40446 0 NA
7-150784108-G-C p.Glu94Gln missense AGAP3 1 80768 1.23811E-5 40384 0 NA
7-150784109-A-G p.Glu94Gly missense AGAP3 1 80704 1.2391E-5 40352 0 NA
7-150784187-C-G p.Pro11Arg missense AGAP3 1 77794 1.28545E-5 38897 0 5.76389E-6
7-150784188-G-T p.Pro11Pro synonymous AGAP3 1 77854 1.28446E-5 38927 0 NA
7-150784207-G-C p.Gly18Arg missense AGAP3 2 76550 2.61267E-5 38275 0 NA
7-150784211-C-A p.Ala19Asp missense AGAP3 1 76166 1.31292E-5 38083 0 NA
7-150784212-C-G p.Ala19Ala synonymous AGAP3 8 76040 1.05208E-4 38020 0 6.06502E-5
7-150784235-G-C p.Cys27Ser missense AGAP3 1 74144 1.34873E-5 37072 0 6.38162E-5
7-150784243-A-G p.Met30Val missense AGAP3 1 73878 1.35358E-5 36939 0 6.38407E-5
7-150784244-T-C p.Met30Thr missense AGAP3 3 73764 4.06702E-5 36882 0 6.38244E-5
7-150784248-C-T p.Leu31Leu synonymous AGAP3 2 73224 2.73134E-5 36612 0 3.19244E-5
7-150784252-C-T p.Leu33Leu synonymous AGAP3 1 72858 1.37253E-5 36429 0 7.44258E-6
7-150784252-C-A p.Leu33Met missense AGAP3 6 72856 8.23542E-5 36428 0 1.03135E-4
7-150784256-C-T p.Ser34Leu missense AGAP3 3 72036 4.16458E-5 36018 0 2.2884E-5
7-150784259-G-GA p.Val36fs frameshift AGAP3 1 71768 1.39338E-5 35884 0 3.12969E-5
7-150784260-GGTCCT-AGGACA p.GlyValLeu35GlyGlyHis missense AGAP3 1164 71562 0.0162656 35781 1 NA
7-150784260-G-A p.Gly35Gly synonymous AGAP3 45 71618 6.28334E-4 35809 0 0.0214337
7-150784260-GGT-AGG p.GlyVal35GlyGly missense AGAP3 3 71632 4.18807E-5 35816 0 NA
7-150784260-GGTC-AGGA p.GlyVal35GlyGly missense AGAP3 2 71632 2.79205E-5 35816 0 NA
7-150784261-G-T p.Val36Phe missense AGAP3 1 71422 1.40013E-5 35711 0 NA
7-150784262-T-G p.Val36Gly missense AGAP3 38 71224 5.33528E-4 35612 0 0.0219482
7-150784262-TCCT-GACA p.ValLeu36GlyHis missense AGAP3 4 71236 5.61514E-5 35618 0 NA
7-150784262-TC-GA p.Val36Gly missense AGAP3 1 71236 1.40378E-5 35618 0 NA
7-150784263-C-A p.Val36Val synonymous AGAP3 38 71130 5.34233E-4 35565 0 0.0218319
7-150784263-CCT-ACA p.ValLeu36ValHis missense AGAP3 3 71138 4.21716E-5 35569 0 NA
7-150784265-T-A p.Leu37His missense AGAP3 41 70950 5.77872E-4 35475 0 0.0229504
7-150784267-GC-G p.Ala38fs frameshift AGAP3 1227 70414 0.0174255 35207 15 0.0231761
7-150784280-C-T p.Thr42Ile missense AGAP3 2 68560 2.91715E-5 34280 0 3.1904E-5
7-150811784-C-T c.-74C>T 5_prime_UTR_premature_start_codon_gain AGAP3 13 26140 4.97322E-4 13070 0 2.67469E-4
7-150811791-G-T c.-67G>T 5_prime_UTR_premature_start_codon_gain AGAP3 1 26386 3.78989E-5 13193 0 NA
7-150811844-C-T c.-14C>T 5_prime_UTR_premature_start_codon_gain AGAP3 261 27350 0.00954296 13675 3 0.0109942
7-150811876-C-A p.Gln7Lys missense AGAP3 28 26974 0.00103804 13487 0 0.00352853
7-150811880-G-A p.Gly8Glu missense AGAP3 3 26932 1.11392E-4 13466 0 3.75009E-5
7-150811881-G-T p.Gly8Gly synonymous AGAP3 1 26924 3.71416E-5 13462 0 NA
7-150811884-C-A p.Asp9Glu missense AGAP3 1 26964 3.70865E-5 13482 0 NA
7-150811894-G-A p.Gly13Arg missense AGAP3 1 26470 3.77786E-5 13235 0 NA
7-150811899-G-A p.Glu14Glu synonymous AGAP3 1 26210 3.81534E-5 13105 0 1.79856E-4
7-150811899-GC-AA p.GluArg14GluArg synonymous AGAP3 1 26210 3.81534E-5 13105 0 NA
7-150811900-C-A p.Arg15Arg synonymous AGAP3 1 26070 3.83583E-5 13035 0 NA
7-150811923-C-T p.Ala22Ala synonymous AGAP3 1 24804 4.03161E-5 12402 0 NA
7-150811935-C-T p.Cys26Cys synonymous AGAP3 8 23968 3.33778E-4 11984 1 1.32767E-4
7-150811954-G-A p.Gly33Ser missense AGAP3 1 21440 4.66418E-5 10720 0 NA
7-150811966-GGCCGCGCTGCC-G p.Ala39fs frameshift AGAP3 1 18668 5.35676E-5 9334 0 NA
7-150811976-C-T p.Ala40Val missense AGAP3 1 17174 5.82276E-5 8587 0 NA
7-150811993-G-A p.Ala46Thr missense AGAP3 1 15120 6.61376E-5 7560 0 0.00688705
7-150812019-G-T p.Pro54Pro synonymous AGAP3 1 12382 8.07624E-5 6191 0 NA
7-150812044-G-T p.Gly63Cys missense AGAP3 1 10552 9.47688E-5 5276 0 NA
7-150812046-C-A p.Gly63Gly synonymous AGAP3 1 10318 9.6918E-5 5159 0 NA
7-150812060-CG-C p.Thr70fs frameshift AGAP3 1 9580 1.04384E-4 4790 0 NA
7-150812070-C-A p.Gly71Gly synonymous AGAP3 2 9460 2.11416E-4 4730 0 0.00197255
7-150812085-GCTCGGCCTCCTGCGCCCGCGC-G p.Leu79_Gly85del disruptive_inframe_deletion AGAP3 1 9886 1.01153E-4 4943 0 NA
7-150812086-C-T p.Leu77Phe missense AGAP3 3 9946 3.01629E-4 4973 0 1.23092E-4
7-150812088-C-T p.Leu77Leu synonymous AGAP3 1 9966 1.00341E-4 4983 0 NA
7-150812103-G-A p.Pro82Pro synonymous AGAP3 1 10496 9.52744E-5 5248 0 NA
7-150812133-G-C p.Ser92Ser synonymous AGAP3 1 13556 7.37681E-5 6778 0 NA
7-150812151-T-TGCGCCCAGCCCC p.Pro100_Ala103dup conservative_inframe_insertion AGAP3 1 15640 6.39386E-5 7820 0 1.63787E-4
7-150812155-C-CCCAGCCCCGCGT p.Ser104_Ala107dup conservative_inframe_insertion AGAP3 5 16110 3.10366E-4 8055 0 4.07531E-5
7-150812155-CCCAGCCCCGCGT-C p.Ser104_Ala107del conservative_inframe_deletion AGAP3 2 16110 1.24146E-4 8055 0 NA
7-150812159-G-A p.Ser101Asn missense AGAP3 5 16444 3.04062E-4 8222 0 4.08363E-5
7-150812194-C-A p.Arg113Ser missense AGAP3 1 18536 5.39491E-5 9268 0 NA
7-150812233-A-G p.Ser126Gly missense AGAP3 1 19826 5.04388E-5 9913 0 NA
7-150812244-C-A p.Phe129Leu missense AGAP3 1 20190 4.95295E-5 10095 0 NA
7-150812260-C-T p.Leu135Leu synonymous AGAP3 1 19704 5.07511E-5 9852 0 6.04887E-4
7-150812263-G-A p.Glu136Lys missense AGAP3 1 19628 5.09476E-5 9814 0 NA
7-150812267-T-G p.Leu137Arg missense AGAP3 3 18984 1.58028E-4 9492 0 NA
7-150812270-C-T p.Ala138Val missense AGAP3 2 18944 1.05574E-4 9472 0 5.96659E-4
7-150812278-G-A p.Glu141Lys missense AGAP3 1 18954 5.27593E-5 9477 0 4.05318E-5
7-150812338-T-C p.Leu161Leu synonymous AGAP3 2 19420 1.02987E-4 9710 0 NA
7-150812364-G-A p.Val169Val synonymous AGAP3 4 19626 2.03811E-4 9813 0 2.42758E-4
7-150812379-C-T p.Arg174Arg synonymous AGAP3 2 19294 1.03659E-4 9647 0 NA
7-150812384-C-G p.Pro176Arg missense AGAP3 1 19530 5.12033E-5 9765 0 2.8347E-4
7-150812403-C-T p.Gly182Gly synonymous AGAP3 2 20034 9.98303E-5 10017 0 NA
7-150812406-G-A p.Leu183Leu synonymous AGAP3 1 20196 4.95148E-5 10098 0 NA
7-150812411-C-G p.Ala185Gly missense AGAP3 1 20342 4.91594E-5 10171 0 NA
7-150812415-C-G p.Leu186Leu synonymous AGAP3 1 20616 4.8506E-5 10308 0 NA
7-150812421-G-C p.Lys188Asn missense AGAP3 2 20948 9.54745E-5 10474 0 NA
7-150812422-A-T p.Ser189Cys missense AGAP3 1 20886 4.7879E-5 10443 0 NA
7-150812423-G-A p.Ser189Asn missense AGAP3 1 21046 4.7515E-5 10523 0 NA
7-150812423-G-C p.Ser189Thr missense AGAP3 1 21046 4.7515E-5 10523 0 4.00834E-5
7-150812429-G-C p.Ser191Thr missense AGAP3 1 21440 4.66418E-5 10720 0 NA
7-150812430-C-T p.Ser191Ser synonymous AGAP3 1 21414 4.66984E-5 10707 0 8.0032E-5
7-150812433-C-T p.Phe192Phe synonymous AGAP3 1 21530 4.64468E-5 10765 0 NA
7-150812434-C-T p.Arg193Cys missense AGAP3 1 21558 4.63865E-5 10779 0 NA
7-150812436-C-G p.Arg193Arg synonymous AGAP3 1 21706 4.60702E-5 10853 0 NA
7-150812437-C-T p.Leu194Leu synonymous AGAP3 2 21646 9.23958E-5 10823 0 3.99074E-5
7-150812438-T-C p.Leu194Pro missense AGAP3 24 21532 0.00111462 10766 0 3.20256E-4
7-150812439-G-A p.Leu194Leu synonymous AGAP3 1 21674 4.61382E-5 10837 0 NA
7-150812441-G-C p.Arg195Pro missense AGAP3 1 21670 4.61467E-5 10835 0 NA
7-150812447-G-A p.Gly197Asp missense AGAP3 1 21948 4.55622E-5 10974 0 NA
7-150812449-C-G p.Gln198Glu missense AGAP3 1 22026 4.54009E-5 11013 0 NA
7-150812462-G-C p.Arg202Pro missense AGAP3 7 21974 3.18558E-4 10987 0 9.56938E-4
7-150812470-T-G p.Ser205Ala missense AGAP3 1 22012 4.54298E-5 11006 0 3.98851E-5
7-150812478-G-A p.Leu207Leu synonymous AGAP3 2 22158 9.02609E-5 11079 0 NA
7-150812480-T-A p.Leu208Gln missense AGAP3 16 22018 7.26678E-4 11009 0 3.99457E-4
7-150812486-G-A p.Arg210Gln missense AGAP3 131 21866 0.00599104 10933 6 0.0183512
7-150812488-C-G p.Pro211Ala missense AGAP3 1 21874 4.57164E-5 10937 0 7.97766E-5
7-150812491-CCG-C p.Arg215fs frameshift AGAP3 1 21938 4.5583E-5 10969 0 NA
7-150812493-G-C p.Pro212Pro synonymous AGAP3 15811 21510 0.735053 10755 5898 0.766616
7-150812493-G-T p.Pro212Pro synonymous AGAP3 4 21898 1.82665E-4 10949 0 3.61649E-4
7-150812496-C-G p.Arg213Arg synonymous AGAP3 2 21990 9.09504E-5 10995 0 3.98153E-5
7-150812498-C-G p.Ala214Gly missense AGAP3 3 22014 1.36277E-4 11007 0 NA
7-150812515-G-C p.Gly220Arg missense AGAP3 2 22042 9.07359E-5 11021 0 NA
7-150812517-C-G p.Gly220Gly synonymous AGAP3 1 21982 4.54918E-5 10991 0 NA
7-150812554-G-T p.Asp233Tyr missense AGAP3 3 21514 1.39444E-4 10757 0 8.77053E-4
7-150812564-G-A p.Gly236Asp missense AGAP3 3 21444 1.39899E-4 10722 0 NA
7-150812565-C-T p.Gly236Gly synonymous AGAP3 591 21340 0.0276945 10670 14 0.0486111
7-150812565-CTC-TTT p.GlySer236GlyPhe missense AGAP3 1 21396 4.67377E-5 10698 0 NA
7-150812566-T-C p.Ser237Pro missense AGAP3 1 21300 4.69484E-5 10650 0 3.99361E-5
7-150812567-C-T p.Ser237Phe missense AGAP3 1 21328 4.68867E-5 10664 0 NA
7-150812568-C-T p.Ser237Ser synonymous AGAP3 1 21258 4.70411E-5 10629 0 NA
7-150812570-A-G p.Asp238Gly missense AGAP3 1 21100 4.73934E-5 10550 0 NA
7-150812576-C-T p.Pro240Leu missense AGAP3 3 21122 1.42032E-4 10561 0 NA
7-150812595-C-T p.Pro246Pro synonymous AGAP3 1 22154 4.51386E-5 11077 0 NA
7-150812600-G-T p.Arg248Leu missense AGAP3 14 22684 6.17175E-4 11342 0 1.17133E-4
7-150812603-C-G p.Pro249Arg missense AGAP3 8 23196 3.44887E-4 11598 0 4.26026E-4
7-150812605-C-T p.Arg250Cys missense AGAP3 1 23294 4.29295E-5 11647 0 NA
7-150812606-G-T p.Arg250Leu missense AGAP3 1 23320 4.28816E-5 11660 0 NA
7-150812613-C-T p.Ala252Ala synonymous AGAP3 3 24080 1.24585E-4 12040 0 3.82468E-5
7-150812623-T-C p.Trp256Arg missense AGAP3 1 25584 3.90869E-5 12792 0 NA
7-150812647-C-T p.Arg264Cys missense AGAP3 1 27192 3.67755E-5 13596 0 NA
7-150812650-C-T p.Arg265Trp missense AGAP3 2 27256 7.33783E-5 13628 0 NA
7-150812652-G-A p.Arg265Arg synonymous AGAP3 532 27312 0.0194786 13656 10 0.0373529
7-150812668-G-C p.Ala271Pro missense AGAP3 2 27596 7.24743E-5 13798 0 3.44637E-5
7-150812677-C-T p.Leu274Leu synonymous AGAP3 4 27728 1.44259E-4 13864 0 NA
7-150812683-G-A p.Gly276Ser missense AGAP3 6541 26966 0.242565 13483 724 0.375
7-150812692-G-A p.Ala279Thr missense AGAP3 1 27722 3.60724E-5 13861 0 NA
7-150812702-C-T p.Ala282Val missense AGAP3 1 27668 3.61428E-5 13834 0 NA
7-150812704-C-T p.Pro283Ser missense AGAP3 3 27634 1.08562E-4 13817 0 3.30447E-4
7-150812705-C-G p.Pro283Arg missense AGAP3 1 27630 3.61925E-5 13815 0 NA
7-150812710-C-T p.Leu285Phe missense AGAP3 2 27608 7.24428E-5 13804 0 NA
7-150812720-C-T p.Ala288Val missense AGAP3 8 27368 2.92312E-4 13684 0 3.27139E-5
7-150812729-G-A c.871+1G>A splice_donor AGAP3 1 27124 3.68677E-5 13562 0 NA
7-150812730-T-G c.871+2T>G splice_donor AGAP3 2 26674 7.49794E-5 13337 0 NA
7-150812732-A-AG c.871+4_871+5insG splice_region AGAP3 2 26670 7.49906E-5 13335 1 NA
7-150812734-G-C c.871+6G>C splice_region AGAP3 1 26970 3.70782E-5 13485 0 NA
7-150813738-G-C n.344+1G>C splice_donor AGAP3 1 75836 1.31863E-5 37918 0 6.37105E-5
7-150813743-G-A n.344+6G>A splice_region AGAP3 1 76472 1.30767E-5 38236 0 NA
7-150813745-T-C n.344+8T>C splice_region AGAP3 1 76486 1.30743E-5 38243 0 NA
7-150813875-C-T c.872-5C>T splice_region AGAP3 1 82982 1.20508E-5 41491 0 2.00682E-5
7-150813884-G-A p.Ser292Ser synonymous AGAP3 1 83024 1.20447E-5 41512 0 8.42521E-5
7-150813899-G-A p.Gln297Gln synonymous AGAP3 1 83076 1.20372E-5 41538 0 8.3282E-6
7-150813908-G-A p.Thr300Thr synonymous AGAP3 1 83036 1.2043E-5 41518 0 6.81887E-5
7-150813909-C-T c.-324C>T 5_prime_UTR_premature_start_codon_gain AGAP3 1 83022 1.2045E-5 41511 0 NA
7-150813916-G-C p.Arg303Pro missense AGAP3 1 82960 1.2054E-5 41480 0 NA
7-150813920-C-T c.-313C>T 5_prime_UTR_premature_start_codon_gain AGAP3 4 82960 4.8216E-5 41480 0 6.65945E-5
7-150813921-G-A p.Val305Ile missense AGAP3 1 82946 1.2056E-5 41473 0 3.18939E-5
7-150813925-C-T p.Pro306Leu missense AGAP3 3 82924 3.61777E-5 41462 0 4.01162E-6
7-150813926-G-A p.Pro306Pro synonymous AGAP3 1 82920 1.20598E-5 41460 0 2.00586E-5
7-150813926-G-C p.Pro306Pro synonymous AGAP3 1 82920 1.20598E-5 41460 0 NA
7-150813932-T-TA p.Val310fs frameshift AGAP3 1 82894 1.20636E-5 41447 0 NA
7-150813939-GT-G c.930+2delT splice_donor AGAP3 6 82844 7.24253E-5 41422 2 NA
7-150813944-T-A c.930+6T>A splice_region AGAP3 1 82766 1.20823E-5 41383 0 NA
7-150814177-C-G c.931-5C>G splice_region AGAP3 1 82362 1.21415E-5 41181 0 NA
7-150814178-G-A c.931-4G>A splice_region AGAP3 5 82346 6.07194E-5 41173 0 5.62927E-5
7-150814205-C-T p.Ser318Ser synonymous AGAP3 1 82554 1.21133E-5 41277 0 NA
7-150814214-A-G p.Ser321Ser synonymous AGAP3 1 82572 1.21106E-5 41286 0 NA
7-150814217-C-T p.Ala322Ala synonymous AGAP3 1 82568 1.21112E-5 41284 0 8.31615E-6
7-150814231-A-G p.Tyr327Cys missense AGAP3 2 82574 2.42207E-5 41287 0 3.18715E-5
7-150814238-G-A p.Thr329Thr synonymous AGAP3 12 82542 1.45381E-4 41271 0 0.001875
7-150814247-T-C p.Tyr332Tyr synonymous AGAP3 1 82530 1.21168E-5 41265 0 0.001875
7-150814275-C-T c.1018+6C>T splice_region AGAP3 10 82238 1.21598E-4 41119 0 5.04821E-5
7-150814276-G-A c.1018+7G>A splice_region AGAP3 12 82230 1.45932E-4 41115 0 2.94747E-4
7-150814462-G-T p.Gly341Gly synonymous AGAP3 2 82488 2.4246E-5 41244 0 6.36983E-5
7-150814471-G-C p.Lys344Asn missense AGAP3 1 82702 1.20916E-5 41351 0 NA
7-150814480-T-C p.Ile347Ile synonymous AGAP3 1 82846 1.20706E-5 41423 0 NA
7-150814485-T-C p.Val349Ala missense AGAP3 1 82902 1.20624E-5 41451 0 4.00705E-6
7-150814492-C-T p.Gly351Gly synonymous AGAP3 1 82906 1.20619E-5 41453 0 8.0141E-6
7-150814514-C-A p.Arg359Arg synonymous AGAP3 1 82950 1.20555E-5 41475 0 8.01372E-6
7-150814514-C-G p.Arg359Gly missense AGAP3 1 82950 1.20555E-5 41475 0 NA
7-150814542-A-AGTTTGCTGCCTG p.Leu356_Leu357insLeuLeuProGly disruptive_inframe_insertion AGAP3 2 82912 2.4122E-5 41456 0 NA
7-150814548-T-A c.1104+5T>A splice_region AGAP3 1 82884 1.20651E-5 41442 0 NA
7-150814728-TG-T p.Ala371fs frameshift AGAP3 1 83336 1.19996E-5 41668 0 NA
7-150814731-C-T c.-112C>T 5_prime_UTR_premature_start_codon_gain AGAP3 19 83350 2.27954E-4 41675 0 0.00100705
7-150814761-C-T p.Ser381Ser synonymous AGAP3 1 83338 1.19993E-5 41669 0 NA
7-150814779-T-C p.Ser387Ser synonymous AGAP3 1 83310 1.20034E-5 41655 0 4.00737E-6
7-150814785-G-A p.Gln389Gln synonymous AGAP3 1 83292 1.2006E-5 41646 0 NA
7-150814787-C-T p.Thr390Met missense AGAP3 2 83274 2.40171E-5 41637 0 4.80889E-5
7-150814802-T-C p.Phe395Ser missense AGAP3 1 83216 1.20169E-5 41608 0 4.00769E-6
7-150814804-C-T c.-39C>T 5_prime_UTR_premature_start_codon_gain AGAP3 209 83178 0.00251268 41589 0 0.00573358
7-150814806-G-A p.Leu396Leu synonymous AGAP3 1 83156 1.20256E-5 41578 0 8.29449E-6
7-150814808-G-A p.Arg397His missense AGAP3 2 83134 2.40575E-5 41567 0 8.296E-6
7-150814809-T-C p.Arg397Arg synonymous AGAP3 1 83134 1.20288E-5 41567 0 8.29724E-6
7-150814817-G-A p.Ser400Asn missense AGAP3 1 83066 1.20386E-5 41533 0 NA
7-150814827-C-T c.-16C>T 5_prime_UTR_premature_start_codon_gain AGAP3 5 82858 6.03442E-5 41429 0 9.55657E-5
7-150814828-G-A p.Ala404Thr missense AGAP3 2 82814 2.41505E-5 41407 0 6.25E-4
7-150814860-G-A p.Thr414Thr synonymous AGAP3 1 81106 1.23295E-5 40553 0 0.00151057
7-150814871-C-T c.1246+7C>T splice_region AGAP3 1 79802 1.2531E-5 39901 0 3.18796E-5
7-150814872-G-A c.1246+8G>A splice_region AGAP3 2 79674 2.51023E-5 39837 0 9.56023E-5
7-150815247-C-A n.590C>A splice_region AGAP3 1 81684 1.22423E-5 40842 0 NA
7-150815248-C-A n.591C>A splice_region AGAP3 1 81730 1.22354E-5 40865 0 3.18674E-5
7-150815289-T-G c.1247-8T>G splice_region AGAP3 1 82942 1.20566E-5 41471 0 NA
7-150815312-C-T p.Ala421Val missense AGAP3 1 83026 1.20444E-5 41513 0 NA
7-150815313-G-A p.Ala421Ala synonymous AGAP3 3 83040 3.61272E-5 41520 0 8.39363E-6
7-150815321-G-T p.Arg424Leu missense AGAP3 1 83084 1.2036E-5 41542 0 NA
7-150815322-G-A p.Arg424Arg synonymous AGAP3 1 83078 1.20369E-5 41539 0 4.01436E-5
7-150815328-C-T p.Ile426Ile synonymous AGAP3 1 83068 1.20383E-5 41534 0 1.6052E-5
7-150815328-C-A p.Ile426Ile synonymous AGAP3 2 83068 2.40767E-5 41534 0 NA
7-150815331-C-T p.Asp427Asp synonymous AGAP3 1 83074 1.20375E-5 41537 0 5.03525E-4
7-150815345-G-A p.Arg432His missense AGAP3 1 83084 1.2036E-5 41542 0 NA
7-150815346-C-T p.Arg432Arg synonymous AGAP3 1028 83076 0.0123742 41538 29 0.0241478
7-150815352-C-T p.Leu434Leu synonymous AGAP3 1 83128 1.20296E-5 41564 0 NA
7-150815357-C-T p.Thr436Ile missense AGAP3 1 83148 1.20267E-5 41574 0 4.00882E-6
7-150815368-C-T p.Arg440Trp missense AGAP3 1 83114 1.20317E-5 41557 0 NA
7-150815371-T-C p.Cys441Arg missense AGAP3 1 83130 1.20294E-5 41565 0 NA
7-150815391-C-T p.Cys447Cys synonymous AGAP3 2 83120 2.40616E-5 41560 0 2.49675E-5
7-150815394-G-A p.Ala448Ala synonymous AGAP3 18 83114 2.1657E-4 41557 0 0.00503525
7-150815397-C-G p.Thr449Thr synonymous AGAP3 1 83124 1.20302E-5 41562 0 1.66578E-5
7-150815400-C-T p.Tyr450Tyr synonymous AGAP3 2 83124 2.40604E-5 41562 0 0.00100705
7-150815417-G-A p.Arg456His missense AGAP3 2 83096 2.40685E-5 41548 0 2.51223E-5
7-150815430-C-T p.Asp460Asp splice_region+synonymous AGAP3 1 83032 1.20435E-5 41516 0 5.89186E-5
7-150815438-C-T c.1381+7C>T splice_region AGAP3 1 82952 1.20552E-5 41476 0 9.56145E-5
7-150815439-G-A c.1381+8G>A splice_region AGAP3 23 82958 2.77249E-4 41479 0 8.43768E-6
7-150815553-C-T n.78-8C>T splice_region AGAP3 4 82996 4.81951E-5 41498 0 1.66728E-5
7-150815629-A-G p.Gln473Gln synonymous AGAP3 1 83094 1.20346E-5 41547 0 4.00956E-6
7-150815630-C-T p.Leu474Leu synonymous AGAP3 686 83080 0.0082571 41540 10 0.0185433
7-150815636-A-G p.Ile476Val missense AGAP3 1 83038 1.20427E-5 41519 0 NA
7-150815642-C-A p.Pro478Thr missense AGAP3 4 82976 4.82067E-5 41488 0 2.49938E-5
7-150815680-C-T p.Ala490Ala synonymous AGAP3 23 82780 2.77845E-4 41390 0 0.001875
7-150815681-G-A p.Val491Met missense AGAP3 1 82768 1.2082E-5 41384 0 3.18634E-5
7-150815685-C-G p.Ser492Cys missense AGAP3 1 82760 1.20831E-5 41380 0 3.18552E-5
7-150815686-C-T p.Ser492Ser synonymous AGAP3 24 82742 2.90058E-4 41371 0 0.00100705
7-150815689-C-T p.Ala493Ala synonymous AGAP3 3 82670 3.62889E-5 41335 0 6.25E-4
7-150815690-G-A p.Ala494Thr missense AGAP3 11 82610 1.33156E-4 41305 0 1.67763E-4
7-150815696-A-G p.Ile496Val missense AGAP3 3 82582 3.63275E-5 41291 0 4.8679E-4
7-150815701-G-A p.Pro497Pro synonymous AGAP3 1 82366 1.21409E-5 41183 0 3.18695E-5
7-150815701-G-C p.Pro497Pro synonymous AGAP3 3 82366 3.64228E-5 41183 0 3.18695E-5
7-150815704-C-T p.Ala498Ala synonymous AGAP3 4 82250 4.86322E-5 41125 0 0.00125
7-150815705-G-A p.Val499Met missense AGAP3 103 82148 0.00125383 41074 0 0.002773
7-150815708-C-T p.His500Tyr missense AGAP3 1 82084 1.21826E-5 41042 0 NA
7-150815723-C-T c.1509+4C>T splice_region AGAP3 6 80912 7.41546E-5 40456 0 6.25E-4
7-150815724-G-A c.1509+5G>A splice_region AGAP3 2 80768 2.47623E-5 40384 0 1.22198E-5
7-150817069-C-T c.1510-5C>T splice_region AGAP3 1 77840 1.28469E-5 38920 0 1.73563E-5
7-150817070-T-G c.1510-4T>G splice_region AGAP3 308 77862 0.00395572 38931 0 0.00545107
7-150817075-C-T p.Ala504Val missense+splice_region AGAP3 5 78314 6.38455E-5 39157 0 9.73813E-5
7-150817078-C-T p.Thr505Met missense AGAP3 22 78670 2.79649E-4 39335 0 0.00201613
7-150817079-G-A p.Thr505Thr synonymous AGAP3 3 78808 3.80672E-5 39404 0 NA
7-150817085-C-T p.Gly507Gly synonymous AGAP3 6 78776 7.61653E-5 39388 0 3.69297E-5
7-150817086-G-A p.Gly508Ser missense AGAP3 12 78914 1.52064E-4 39457 0 5.04032E-4
7-150817094-C-T p.Ser510Ser synonymous AGAP3 1 78670 1.27113E-5 39335 0 8.66776E-6
7-150817095-G-A p.Ala511Thr missense AGAP3 1 78796 1.2691E-5 39398 0 8.65561E-5
7-150817103-C-T p.Ser513Ser synonymous AGAP3 1 79550 1.25707E-5 39775 0 8.59328E-6
7-150817104-G-A p.Asp514Asn missense AGAP3 5 79636 6.27857E-5 39818 0 8.57883E-5
7-150817108-A-G p.Tyr515Cys missense AGAP3 4 80018 4.99888E-5 40009 0 2.02167E-5
7-150817112-G-A p.Ser516Ser synonymous AGAP3 6 80196 7.48167E-5 40098 0 7.68023E-5
7-150817135-G-A p.Ser524Asn missense AGAP3 1 80908 1.23597E-5 40454 0 3.19203E-5
7-150817155-C-T p.Arg531Cys missense AGAP3 1 81572 1.22591E-5 40786 0 1.08574E-4
7-150817166-C-T p.Thr534Thr synonymous AGAP3 10 82002 1.21948E-4 41001 0 4.01723E-6
7-150817169-C-T p.Ile535Ile synonymous AGAP3 2 81972 2.43986E-5 40986 0 9.5645E-5
7-150817170-G-A p.Ala536Thr missense AGAP3 2 81872 2.44284E-5 40936 0 1.20595E-5
7-150817175-C-T p.Ala537Ala synonymous AGAP3 1 82048 1.2188E-5 41024 0 4.01781E-6
7-150817191-C-G p.Pro543Ala missense AGAP3 5 82268 6.0777E-5 41134 0 8.35939E-6
7-150817195-T-C p.Ile544Thr missense AGAP3 1 82160 1.21714E-5 41080 0 NA
7-150817202-G-A p.Lys546Lys synonymous AGAP3 1 82164 1.21708E-5 41082 0 NA
7-150817208-C-T p.Ser548Ser synonymous AGAP3 1 82126 1.21764E-5 41063 0 8.46095E-6
7-150817215-C-T p.Arg551Cys missense AGAP3 2 81944 2.44069E-5 40972 0 8.51586E-6
7-150817236-C-G c.1668+4C>G splice_region AGAP3 1 81284 1.23025E-5 40642 0 8.80096E-6
7-150817236-C-T c.1668+4C>T splice_region AGAP3 6 81284 7.38153E-5 40642 0 1.32591E-4
7-150817237-G-A c.1668+5G>A splice_region AGAP3 1 81186 1.23174E-5 40593 0 NA
7-150817606-G-C n.76-1G>C splice_acceptor AGAP3 1 73896 1.35325E-5 36948 0 NA
7-150817609-A-G p.Leu149Leu splice_region+synonymous AGAP3 2 74040 2.70124E-5 37020 0 3.18959E-5
7-150817616-C-T p.Arg152Trp missense AGAP3 3 74712 4.01542E-5 37356 0 NA
7-150817620-G-T p.Arg153Leu missense AGAP3 3 74984 4.00085E-5 37492 0 NA
7-150817622-C-T p.Pro154Ser missense AGAP3 1 75096 1.33163E-5 37548 0 NA
7-150817623-C-T p.Pro154Leu missense AGAP3 1 75236 1.32915E-5 37618 0 7.43262E-6
7-150817624-G-C p.Pro154Pro synonymous AGAP3 1 75320 1.32767E-5 37660 0 7.43329E-6
7-150817628-G-A p.Gly156Ser missense AGAP3 1 75614 1.32251E-5 37807 0 NA
7-150817633-T-G p.Cys157Trp missense AGAP3 2 75742 2.64054E-5 37871 0 NA
7-150817644-C-G p.Ala161Gly missense AGAP3 1 76018 1.31548E-5 38009 0 NA
7-150817645-G-A p.Ala161Ala synonymous AGAP3 1 76046 1.31499E-5 38023 0 NA
7-150817840-CT-AG c.*160+8_*160+9delCTinsAG splice_region AGAP3 1 67000 1.49254E-5 33500 0 NA
7-150817840-C-T c.*160+8C>T splice_region AGAP3 1 67000 1.49254E-5 33500 0 NA
7-150817840-C-G c.*160+8C>G splice_region AGAP3 1 67000 1.49254E-5 33500 0 NA
7-150819856-C-T p.Phe571Phe synonymous AGAP3 1 82310 1.21492E-5 41155 0 8.36232E-6
7-150819865-T-A p.Leu574Leu synonymous AGAP3 2 82336 2.42907E-5 41168 0 0.00125
7-150820877-C-T c.1129-4C>T splice_region AGAP3 5 82198 6.08287E-5 41099 0 1.27445E-4
7-150820906-G-A p.Arg385Gln missense AGAP3 1 82076 1.21838E-5 41038 0 2.51185E-5
7-150820910-G-A p.Glu386Glu synonymous AGAP3 2 82036 2.43795E-5 41018 0 3.18573E-5
7-150820917-G-A p.Ala389Thr missense AGAP3 12 81836 1.46635E-4 40918 0 5.04032E-4
7-150820922-C-T p.Ala390Ala synonymous AGAP3 7 81730 8.56479E-5 40865 0 5.04032E-4
7-150820925-G-C p.Glu391Asp missense AGAP3 1 81686 1.2242E-5 40843 0 NA
7-150820937-C-T n.413C>T splice_region AGAP3 40 81168 4.92805E-4 40584 1 2.19065E-4
7-150820941-A-T p.Ile397Phe missense AGAP3 1 80782 1.2379E-5 40391 0 4.0564E-6
7-150820942-T-C p.Ile397Thr missense AGAP3 1 80642 1.24005E-5 40321 0 4.05913E-6
7-150820943-C-T p.Ile397Ile synonymous AGAP3 2 80408 2.48731E-5 40204 0 NA
7-150820949-C-T p.Ser399Ser synonymous AGAP3 8 79430 1.00718E-4 39715 0 7.64033E-4
7-150820958-C-T p.Ala402Ala synonymous AGAP3 4 77360 5.17063E-5 38680 0 8.53257E-6
7-150820977-A-C c.1221+4A>C splice_region AGAP3 1 72298 1.38316E-5 36149 0 NA
7-150820979-C-T c.1221+6C>T splice_region AGAP3 4 70672 5.65995E-5 35336 0 3.18552E-5
7-150825659-G-C c.1222-8G>C splice_region AGAP3 1 82606 1.21057E-5 41303 0 NA
7-150825664-C-T c.1222-3C>T splice_region AGAP3 2 82726 2.41762E-5 41363 0 9.56267E-5
7-150825669-G-T p.Gly408Gly splice_region+synonymous AGAP3 2 82842 2.41423E-5 41421 0 2.81118E-5
7-150825676-C-T p.Leu411Leu synonymous AGAP3 7 82946 8.43923E-5 41473 0 3.53255E-4
7-150825687-C-T p.Ser414Ser synonymous AGAP3 1 83042 1.20421E-5 41521 0 3.21043E-5
7-150825688-G-A p.Gly415Ser missense AGAP3 5 83048 6.02061E-5 41524 0 1.75412E-4
7-150825696-C-T p.Ser417Ser synonymous AGAP3 1 83108 1.20325E-5 41554 0 5.03525E-4
7-150825708-G-A p.Glu421Glu synonymous AGAP3 9 83150 1.08238E-4 41575 0 1.59459E-4
7-150825726-G-C p.Val427Val synonymous AGAP3 6 83180 7.21327E-5 41590 0 0.00151057
7-150825729-G-T p.Thr428Thr synonymous AGAP3 17 83168 2.04406E-4 41584 0 0.00151057
7-150825729-G-A p.Thr428Thr synonymous AGAP3 1 83168 1.20239E-5 41584 0 0.00375
7-150825741-C-T p.Asn432Asn synonymous AGAP3 3 83132 3.60872E-5 41566 0 0.00100705
7-150825756-T-C p.Tyr437Tyr synonymous AGAP3 1 82972 1.20523E-5 41486 0 4.01274E-6
7-150825768-G-A p.Leu441Leu synonymous AGAP3 1 82992 1.20494E-5 41496 0 2.01069E-4
7-150825772-G-GATTACATGCAGAACATCCACGGCAAGGAGAT c.1326+1_1326+2insATTACATGCAGAACATCCACGGCAAGGAGAT splice_donor AGAP3 2 82912 2.4122E-5 41456 1 NA
7-150831507-C-T p.His449His synonymous AGAP3 1 81844 1.22184E-5 40922 0 2.51122E-5
7-150831508-G-A p.Gly450Ser missense AGAP3 2 81844 2.44367E-5 40922 0 1.21255E-5
7-150831521-A-T p.Asp454Val missense AGAP3 1 81912 1.22082E-5 40956 0 NA
7-150831529-C-T p.Arg457Trp missense AGAP3 2 81786 2.44541E-5 40893 0 4.19421E-5
7-150831530-G-A p.Arg457Gln missense AGAP3 7 81804 8.55704E-5 40902 0 0.00100705
7-150831535-A-T p.Thr459Ser missense AGAP3 1 81726 1.2236E-5 40863 0 NA
7-150831537-G-A p.Thr459Thr synonymous AGAP3 5 81626 6.1255E-5 40813 0 3.18776E-5
7-150831549-A-G p.Pro463Pro synonymous AGAP3 1 81094 1.23314E-5 40547 0 0.0015121
7-150831550-G-A p.Gly464Arg missense AGAP3 1 81080 1.23335E-5 40540 0 6.37511E-5
7-150831554-A-G p.Lys465Arg missense AGAP3 1 80794 1.23772E-5 40397 0 NA
7-150831556-C-T p.Arg466Cys missense AGAP3 4 80502 4.96882E-5 40251 0 4.36491E-5
7-150831557-G-A p.Arg466His missense AGAP3 2 80332 2.48967E-5 40166 0 8.33229E-6
7-150831573-A-C p.Thr471Thr synonymous AGAP3 2 80040 2.49875E-5 40020 0 0.200906
7-150831587-C-T p.Pro476Leu missense AGAP3 3 81570 3.67782E-5 40785 0 8.66731E-6
7-150831588-G-A p.Pro476Pro synonymous AGAP3 2 81480 2.45459E-5 40740 0 2.44385E-5
7-150831591-C-T p.Gly477Gly synonymous AGAP3 1 81392 1.22862E-5 40696 0 NA
7-150831595-A-G p.Ser479Gly missense AGAP3 1 81394 1.22859E-5 40697 0 3.18654E-5
7-150831597-C-T p.Ser479Ser synonymous AGAP3 1 81350 1.22926E-5 40675 0 NA
7-150831597-CCCCCG-C p.Pro480fs frameshift AGAP3 1 81350 1.22926E-5 40675 0 NA
7-150831601-C-T p.Arg481Cys missense AGAP3 2 81284 2.46051E-5 40642 0 1.76788E-5
7-150831602-G-A p.Arg481His missense AGAP3 1 81258 1.23065E-5 40629 0 2.44946E-5
7-150831603-TGCCAAC-T p.Ala482_Asn483del disruptive_inframe_deletion AGAP3 1 81202 1.2315E-5 40601 0 NA
7-150831609-C-T p.Asn483Asn synonymous AGAP3 3 81118 3.69832E-5 40559 0 4.52423E-5
7-150831610-G-A p.Gly484Arg missense AGAP3 1 81050 1.23381E-5 40525 0 1.22633E-5
7-150831611-G-T p.Gly484Val missense AGAP3 1 81018 1.23429E-5 40509 0 NA
7-150831618-C-T p.Ser486Ser synonymous AGAP3 3 80828 3.71158E-5 40414 0 3.18796E-5
7-150831618-C-G p.Ser486Ser synonymous AGAP3 1 80828 1.2372E-5 40414 0 NA
7-150831619-G-A p.Val487Met missense AGAP3 1 80786 1.23784E-5 40393 0 2.87698E-5
7-150831620-T-A p.Val487Glu missense AGAP3 1 80754 1.23833E-5 40377 0 NA
7-150831624-G-A p.Glu488Glu synonymous AGAP3 1 80692 1.23928E-5 40346 0 4.11824E-6
7-150831625-C-T p.Arg489Trp missense AGAP3 9 80640 1.11607E-4 40320 1 8.256E-5
7-150831626-G-A p.Arg489Gln missense AGAP3 5 80602 6.20332E-5 40301 0 4.92097E-5
7-150831635-C-T p.Thr492Ile missense AGAP3 1 80352 1.24452E-5 40176 0 3.18878E-5
7-150831640-C-T p.Leu494Leu synonymous AGAP3 513 80186 0.00639763 40093 5 0.0135825
7-150831655-G-GAGGCAGAGGAGTCGTTTGAATTT c.1495_1495+1insAGGCAGAGGAGTCGTTTGAATTT splice_donor AGAP3 1 79656 1.2554E-5 39828 0 NA
7-150831662-C-T c.1495+7C>T splice_region AGAP3 40 79058 5.05958E-4 39529 0 0.00319285
7-150831663-G-A c.1495+8G>A splice_region AGAP3 1 79014 1.2656E-5 39507 0 3.18979E-5
7-150835222-G-A c.1496-8G>A splice_region AGAP3 5 75464 6.62568E-5 37732 0 0.00115296
7-150835225-C-T c.1496-5C>T splice_region AGAP3 2 76342 2.61979E-5 38171 0 2.91053E-5
7-150835227-C-T c.1496-3C>T splice_region AGAP3 1 76478 1.30757E-5 38239 0 NA
7-150835231-T-C p.Gly499Gly splice_region+synonymous AGAP3 15 76362 1.96433E-4 38181 0 2.34754E-4
7-150835234-C-A p.Ala500Ala synonymous AGAP3 1 76738 1.30314E-5 38369 0 9.44822E-6
7-150835236-C-T p.Pro501Leu missense AGAP3 7 76948 9.09705E-5 38474 0 0.00204082
7-150835238-C-G p.His502Asp missense AGAP3 1 77036 1.29809E-5 38518 0 1.39575E-5
7-150835243-G-A p.Ser503Ser synonymous AGAP3 3 76984 3.89691E-5 38492 0 1.03691E-4
7-150835252-C-T p.Ser506Ser synonymous AGAP3 1 77806 1.28525E-5 38903 0 1.76616E-5
7-150835272-G-A p.Arg513His missense AGAP3 1 78482 1.27418E-5 39241 0 8.62984E-6
7-150835273-C-T p.Arg513Arg synonymous AGAP3 1 78588 1.27246E-5 39294 0 3.18959E-5
7-150835287-C-T p.Ser518Leu missense AGAP3 1 79282 1.26132E-5 39641 0 3.58337E-5
7-150835294-G-A p.Trp520* stop_gained AGAP3 1 79580 1.2566E-5 39790 0 NA
7-150835302-C-T p.Pro523Leu missense AGAP3 5 79842 6.26237E-5 39921 0 4.1395E-5
7-150835303-G-A p.Pro523Pro synonymous AGAP3 2 79774 2.50708E-5 39887 0 3.19163E-5
7-150835306-C-T p.Arg524Arg synonymous AGAP3 129 79936 0.00161379 39968 2 0.00808081
7-150835321-C-G p.His529Gln missense AGAP3 7 80482 8.6976E-5 40241 0 NA
7-150835325-C-T p.Arg531Cys missense AGAP3 12 80520 1.49031E-4 40260 0 0.00100908
7-150835328-T-C p.Ser532Pro missense AGAP3 1 80616 1.24045E-5 40308 0 6.38203E-5
7-150835336-C-G p.Ser534Ser synonymous AGAP3 1 80754 1.23833E-5 40377 0 9.1949E-6
7-150835336-CGTTTCCAGCGCCGACCAGTG-C p.Val535fs frameshift AGAP3 1 80754 1.23833E-5 40377 0 NA
7-150835336-C-A p.Ser534Ser synonymous AGAP3 1 80754 1.23833E-5 40377 0 NA
7-150835337-G-A p.Val535Ile missense AGAP3 3 80760 3.71471E-5 40380 0 1.83597E-5
7-150835345-C-T p.Ser537Ser synonymous AGAP3 1 80774 1.23802E-5 40387 0 1.82608E-5
7-150835346-G-A p.Ala538Thr missense AGAP3 2 80724 2.47758E-5 40362 0 6.37633E-5
7-150835349-G-A p.Asp539Asn missense AGAP3 1 80714 1.23894E-5 40357 0 6.3857E-5
7-150835349-G-T p.Asp539Tyr missense AGAP3 1 80714 1.23894E-5 40357 0 NA
7-150835357-G-C p.Trp541Cys missense AGAP3 2 80658 2.47961E-5 40329 0 9.13709E-6
7-150835365-C-T p.Ala544Val missense AGAP3 1 80428 1.24335E-5 40214 0 NA
7-150835376-C-T p.Leu548Leu synonymous AGAP3 2 80276 2.4914E-5 40138 0 1.88335E-5
7-150835382-C-T p.Pro550Ser missense AGAP3 2 80116 2.49638E-5 40058 0 9.58846E-6
7-150835384-A-C p.Pro550Pro synonymous AGAP3 2 79950 2.50156E-5 39975 0 NA
7-150835388-A-G p.Met552Val missense AGAP3 18 79846 2.25434E-4 39923 0 5.04032E-4
7-150835396-C-T p.His554His synonymous AGAP3 1 79390 1.2596E-5 39695 0 NA
7-150835400-GGTGAGTGGTGGCTCTGCTGCTTC-G c.1666+1_1666+23delGTGAGTGGTGGCTCTGCTGCTTC splice_donor AGAP3 3 79250 3.78549E-5 39625 0 NA
7-150837058-C-T c.1667-8C>T splice_region AGAP3 6 80460 7.45712E-5 40230 0 3.66838E-5
7-150837058-C-G c.1667-8C>G splice_region AGAP3 3 80460 3.72856E-5 40230 0 1.20605E-5
7-150837067-C-T p.Ala556Ala splice_region+synonymous AGAP3 11 80930 1.3592E-4 40465 0 3.17241E-4
7-150837089-A-G p.Ser564Gly missense AGAP3 10 81210 1.23138E-4 40605 0 0.00117053
7-150837094-C-T p.Ser565Ser synonymous AGAP3 4 81326 4.91848E-5 40663 0 NA
7-150837098-C-A p.Pro567Thr missense AGAP3 1 81386 1.22871E-5 40693 0 4.48998E-6
7-150837118-A-C p.Pro573Pro synonymous AGAP3 1 81270 1.23047E-5 40635 0 NA
7-150837133-C-T p.Asn578Asn synonymous AGAP3 4 81248 4.9232E-5 40624 0 5.04032E-4
7-150837134-C-T p.Arg579Trp missense AGAP3 1 81186 1.23174E-5 40593 0 3.20877E-4
7-150837135-G-A p.Arg579Gln missense AGAP3 3 81202 3.69449E-5 40601 0 6.37146E-5
7-150837136-G-C p.Arg579Arg synonymous AGAP3 1 81220 1.23122E-5 40610 0 NA
7-150837151-G-A p.Arg584Arg synonymous AGAP3 1 81136 1.2325E-5 40568 0 NA
7-150837161-A-G p.Thr588Ala missense AGAP3 5 80998 6.17299E-5 40499 0 2.51329E-4
7-150837163-C-T p.Thr588Thr synonymous AGAP3 3 80930 3.70691E-5 40465 0 1.59972E-4
7-150837164-G-T p.Gly589Trp missense AGAP3 4 80928 4.94266E-5 40464 0 4.91388E-5
7-150837167-A-AC p.Arg592fs frameshift AGAP3 1 80738 1.23857E-5 40369 0 2.47868E-5
7-150837171-C-G p.Pro591Arg missense AGAP3 1 80922 1.23576E-5 40461 0 NA
7-150837173-C-T p.Arg592* stop_gained AGAP3 1 80870 1.23655E-5 40435 0 3.18471E-5
7-150837174-G-A p.Arg592Gln missense AGAP3 23 80866 2.84421E-4 40433 0 0.00100806
7-150837181-C-T p.Asp594Asp synonymous AGAP3 7 80714 8.6726E-5 40357 0 5.04032E-4
7-150837182-G-A p.Gly595Ser missense AGAP3 4 80632 4.96081E-5 40316 0 2.64711E-5
7-150837183-G-T p.Gly595Val missense AGAP3 1 80622 1.24036E-5 40311 0 NA
7-150838972-A-AC c.1805-6dupC splice_region AGAP3 4 83048 4.81649E-5 41524 1 8.65297E-4
7-150838972-AC-A c.1805-6delC splice_region AGAP3 1 83074 1.20375E-5 41537 0 3.19734E-5
7-150838981-A-T c.1805-4A>T splice_region AGAP3 21 83140 2.52586E-4 41570 0 1.08204E-4
7-150838998-G-A p.Ser606Ser synonymous AGAP3 61 83160 7.33526E-4 41580 0 0.00133852
7-150839000-T-G p.Phe607Cys missense AGAP3 1 78132 1.27989E-5 39066 0 NA
7-150839008-G-T p.Val610Leu missense AGAP3 1 82890 1.20642E-5 41445 0 NA
7-150839011-G-T p.Val611Leu missense AGAP3 2 83174 2.4046E-5 41587 0 NA
7-150839011-G-A p.Val611Met missense AGAP3 3 83172 3.60698E-5 41586 0 8.28281E-6
7-150839014-G-A p.Val612Met missense AGAP3 1 83170 1.20236E-5 41585 0 NA
7-150839033-C-T p.Thr618Met missense AGAP3 1 83170 1.20236E-5 41585 0 5.03525E-4
7-150839034-G-A p.Thr618Thr synonymous AGAP3 10 83176 1.20227E-4 41588 0 7.45379E-5
7-150839040-C-G p.His620Gln missense AGAP3 1 83188 1.2021E-5 41594 0 3.18756E-5
7-150839043-C-T p.Phe621Phe synonymous AGAP3 1 83178 1.20224E-5 41589 0 5.03525E-4
7-150839054-C-T p.Thr625Met missense AGAP3 1 83150 1.20265E-5 41575 0 1.20219E-5
7-150839055-G-A p.Thr625Thr synonymous AGAP3 1 83136 1.20285E-5 41568 0 5.79845E-5
7-150839057-C-T p.Ala626Val missense AGAP3 3 83130 3.60881E-5 41565 0 NA
7-150839058-G-A p.Ala626Ala synonymous AGAP3 145 83122 0.00174442 41561 0 0.00144276
7-150839086-G-T p.Val636Leu missense AGAP3 2 83034 2.40865E-5 41517 0 8.28858E-6
7-150839088-G-C p.Val636Val synonymous AGAP3 1 83002 1.20479E-5 41501 0 4.00831E-6
7-150839090-A-G p.Gln637Arg missense AGAP3 1 83016 1.20459E-5 41508 0 NA
7-150839093-C-T p.Ala638Val missense AGAP3 1 82994 1.20491E-5 41497 0 4.00888E-6
7-150839123-G-A p.Arg648His missense AGAP3 4 82934 4.82311E-5 41467 0 0.001875
7-150839135-A-G p.Asp652Gly missense AGAP3 5 82964 6.02671E-5 41482 0 1.27551E-4
7-150839137-AAGGTGGGTACAGAGTGACTGGGCCCACACAGAGCACCTGGCTGGGGTGGGACTGAAAGGGGCCTCATGACTGACCAACCGCCCCTTGTCTTGTCTCTCCTGCTGTGCGAC-A p.Lys653fs frameshift AGAP3 4 82950 4.82218E-5 41475 1 NA
7-150839245-G-A c.1960-5G>A splice_region AGAP3 1 82690 1.20934E-5 41345 0 4.02039E-6
7-150839254-G-A p.Arg655Gln missense AGAP3 2 82704 2.41826E-5 41352 0 1.08259E-4
7-150839256-C-T p.Leu656Leu synonymous AGAP3 96 82702 0.00116079 41351 0 6.25E-4
7-150839258-G-A p.Leu656Leu synonymous AGAP3 2 82730 2.4175E-5 41365 0 1.27429E-4
7-150839262-A-G p.Asn658Asp missense AGAP3 1 82700 1.20919E-5 41350 0 NA
7-150839264-C-T p.Asn658Asn synonymous AGAP3 9 82694 1.08835E-4 41347 0 4.99226E-5
7-150839270-C-T p.Asn660Asn synonymous AGAP3 1 82670 1.20963E-5 41335 0 NA
7-150839271-G-A p.Ala661Thr missense AGAP3 7 82666 8.46781E-5 41333 0 3.18492E-5
7-150839283-G-A p.Val665Met missense AGAP3 2 82610 2.42101E-5 41305 0 6.37186E-5
7-150839284-T-G p.Val665Gly missense AGAP3 1 82584 1.21089E-5 41292 0 NA
7-150839285-G-A p.Val665Val synonymous AGAP3 5 82576 6.05503E-5 41288 0 8.31864E-6
7-150839288-G-GGCCGTCCGC p.Ala667_Arg669dup conservative_inframe_insertion AGAP3 3 82570 3.63328E-5 41285 0 3.32779E-5
7-150839292-G-A p.Val668Ile missense AGAP3 13 82510 1.57557E-4 41255 0 1.27413E-4
7-150839295-C-G p.Arg669Gly missense AGAP3 1 82496 1.21218E-5 41248 0 NA
7-150839296-G-A p.Arg669His missense AGAP3 2 82474 2.42501E-5 41237 0 1.6645E-4
7-150839300-C-T p.Thr670Thr synonymous AGAP3 5 82492 6.06119E-5 41246 0 1.27453E-4
7-150839301-G-A p.Val671Ile missense AGAP3 3 82480 3.63725E-5 41240 0 2.81382E-5
7-150839305-G-A p.Arg672His missense AGAP3 2 82466 2.42524E-5 41233 0 3.18552E-5
7-150839306-C-T p.Arg672Arg synonymous AGAP3 3 82470 3.63769E-5 41235 0 6.03185E-5
7-150839307-G-A p.Gly673Ser missense AGAP3 2 82460 2.42542E-5 41230 0 2.81534E-5
7-150839318-T-C p.Phe676Phe synonymous AGAP3 2 82476 2.42495E-5 41238 0 1.66675E-5
7-150839330-C-T p.Cys680Cys synonymous AGAP3 54 82220 6.56775E-4 41110 0 5.73394E-4
7-150839333-T-C p.Asp681Asp synonymous AGAP3 2 82206 2.43291E-5 41103 0 3.18492E-5
7-150839337-C-T p.Pro683Ser missense AGAP3 1 82140 1.21743E-5 41070 0 NA
7-150839337-C-CCCAAT p.Asp679fs frameshift AGAP3 2 82140 2.43487E-5 41070 1 NA
7-150839345-G-A c.2050+5G>A splice_region AGAP3 2 82038 2.43789E-5 41019 0 NA
7-150839524-G-C p.Leu692Leu synonymous AGAP3 1 82006 1.21942E-5 41003 0 1.44697E-4
7-150839554-C-T p.Gly702Gly synonymous AGAP3 2 82504 2.42412E-5 41252 0 2.49663E-5
7-150839566-C-G p.His706Gln missense AGAP3 2 82646 2.41996E-5 41323 0 3.18573E-5
7-150839573-G-A p.Ala709Thr missense AGAP3 1 82582 1.21092E-5 41291 0 8.31794E-6
7-150839592-G-A p.Arg715His missense AGAP3 1 82512 1.21194E-5 41256 0 3.18756E-5
7-150839600-G-A p.Asp718Asn missense AGAP3 3 82516 3.63566E-5 41258 0 8.32473E-6
7-150839616-C-T p.Pro723Leu missense AGAP3 7 82236 8.51209E-5 41118 0 9.998E-5
7-150839617-G-A p.Pro723Pro synonymous AGAP3 3 82232 3.64821E-5 41116 0 5.00008E-5
7-150839631-C-A p.Ala728Asp missense AGAP3 8 82036 9.75182E-5 41018 0 2.41161E-5
7-150839644-C-T p.Ala732Ala synonymous AGAP3 1 81788 1.22267E-5 40894 0 NA
7-150839654-G-A p.Ala736Thr missense AGAP3 1 81560 1.22609E-5 40780 0 4.0223E-6
7-150839659-C-T p.Leu737Leu synonymous AGAP3 1 81384 1.22874E-5 40692 0 1.67918E-5
7-150839660-G-A p.Ala738Thr missense AGAP3 3 81278 3.69104E-5 40639 0 6.25E-4
7-150839668-C-T p.Ser740Ser synonymous AGAP3 4 80940 4.94193E-5 40470 0 2.52338E-5
7-150839669-G-A p.Val741Ile missense AGAP3 2 80884 2.47268E-5 40442 0 2.41935E-5
7-150839687-G-A p.Gly747Ser missense AGAP3 3 80290 3.73646E-5 40145 0 1.26597E-4
7-150839710-T-G p.Pro754Pro synonymous AGAP3 1 79976 1.25038E-5 39988 0 4.05729E-6
7-150839724-G-A c.2273+3G>A splice_region AGAP3 2 79476 2.51648E-5 39738 0 1.62929E-5
7-150840424-G-A c.2274-4G>A splice_region AGAP3 2 81970 2.43992E-5 40985 0 NA
7-150840435-A-G p.Lys761Glu missense AGAP3 1 82192 1.21666E-5 41096 0 NA
7-150840436-A-G p.Lys761Arg missense AGAP3 1 82256 1.21572E-5 41128 0 1.21613E-5
7-150840440-A-T p.Glu762Asp missense AGAP3 124 82296 0.00150676 41148 0 0.001875
7-150840441-C-T p.Arg763Cys missense AGAP3 5 82280 6.07681E-5 41140 0 1.27397E-4
7-150840442-GC-AT p.Arg763His missense AGAP3 1 82326 1.21468E-5 41163 0 NA
7-150840442-G-A p.Arg763His missense AGAP3 3 82326 3.64405E-5 41163 0 6.86475E-5
7-150840450-C-T p.Arg766Trp missense AGAP3 8 82574 9.68828E-5 41287 0 3.62801E-5
7-150840451-G-A p.Arg766Gln missense AGAP3 1 82588 1.21083E-5 41294 0 1.68657E-5
7-150840452-G-A p.Arg766Arg synonymous AGAP3 1 82622 1.21033E-5 41311 0 NA
7-150840477-C-T p.Leu775Leu synonymous AGAP3 1 83034 1.20433E-5 41517 0 NA
7-150840493-G-A p.Ser780Asn missense AGAP3 1 83106 1.20328E-5 41553 0 4.00991E-6
7-150840494-C-T p.Ser780Ser synonymous AGAP3 1 83112 1.2032E-5 41556 0 NA
7-150840508-T-C p.Leu785Pro missense AGAP3 1 83176 1.20227E-5 41588 0 8.28789E-6
7-150840512-G-A p.Gly786Gly synonymous AGAP3 1 83176 1.20227E-5 41588 0 NA
7-150840521-G-A p.Leu789Leu synonymous AGAP3 1 83214 1.20172E-5 41607 0 8.28542E-6
7-150840525-C-T p.Arg791Trp missense AGAP3 1 83194 1.20201E-5 41597 0 2.00422E-5
7-150840526-G-A p.Arg791Gln missense AGAP3 17 83206 2.04312E-4 41603 0 1.91083E-4
7-150840530-C-T p.Ala792Ala synonymous AGAP3 5 83214 6.0086E-5 41607 0 8.01571E-6
7-150840549-C-G p.Arg799Gly missense AGAP3 5 83186 6.01063E-5 41593 0 1.5741E-4
7-150840549-C-T p.Arg799Trp missense AGAP3 2 83186 2.40425E-5 41593 0 3.31389E-5
7-150840550-G-A p.Arg799Gln missense AGAP3 5 83198 6.00976E-5 41599 0 0.00100705
7-150840554-G-A p.Leu800Leu synonymous AGAP3 1 83196 1.20198E-5 41598 0 2.40464E-5
7-150840555-T-C p.Leu801Leu synonymous AGAP3 2 83176 2.40454E-5 41588 0 NA
7-150840556-T-G p.Leu801Trp missense AGAP3 1 83178 1.20224E-5 41589 0 NA
7-150840580-C-T p.Ser809Phe missense AGAP3 1 83090 1.20351E-5 41545 0 2.48558E-5
7-150840611-C-T p.Asp819Asp synonymous AGAP3 2 82688 2.41873E-5 41344 0 2.49725E-5
7-150840617-C-T p.Asp821Asp synonymous AGAP3 3 82504 3.63619E-5 41252 0 8.43902E-5
7-150840619-G-A p.Gly822Glu missense AGAP3 1 82470 1.21256E-5 41235 0 NA
7-150840622-G-A p.Arg823Gln missense AGAP3 1 82344 1.21442E-5 41172 0 NA
7-150840625-C-T p.Thr824Met missense AGAP3 1 82276 1.21542E-5 41138 0 3.18613E-5
7-150840654-A-T p.Asn834Tyr missense AGAP3 1 81632 1.22501E-5 40816 0 NA
7-150840656-C-T p.Asn834Asn synonymous AGAP3 5 81598 6.1276E-5 40799 0 5.03525E-4
7-150840657-G-A p.Val835Ile missense AGAP3 6 81588 7.35402E-5 40794 0 3.41373E-5
7-150840668-G-A p.Thr838Thr synonymous AGAP3 2 81474 2.45477E-5 40737 0 3.18573E-5
7-150840827-G-A p.Gly845Arg missense AGAP3 1 83126 1.20299E-5 41563 0 8.30427E-6
7-150840836-G-A p.Val848Met missense AGAP3 4 83126 4.81197E-5 41563 0 6.36983E-5
7-150840836-G-T p.Val848Leu missense AGAP3 1 83126 1.20299E-5 41563 0 4.013E-6
7-150840838-G-A p.Val848Val synonymous AGAP3 1 83120 1.20308E-5 41560 0 NA
7-150840841-G-A p.Arg849Arg synonymous AGAP3 2 83114 2.40633E-5 41557 0 NA
7-150840845-C-T p.Arg851Trp missense AGAP3 1 83124 1.20302E-5 41562 0 3.18593E-5
7-150840845-C-A p.Arg851Arg synonymous AGAP3 1 83124 1.20302E-5 41562 0 NA
7-150840846-G-A p.Arg851Gln missense AGAP3 1 83136 1.20285E-5 41568 0 4.1578E-5
7-150840850-C-T p.Asp852Asp synonymous AGAP3 5 83126 6.01497E-5 41563 0 2.40753E-5
7-150840854-C-T p.Arg854Trp missense AGAP3 1 83132 1.20291E-5 41566 0 1.2037E-5
7-150840855-G-A p.Arg854Gln missense AGAP3 4 83132 4.81162E-5 41566 0 6.37146E-5
7-150840858-G-A p.Gly855Asp missense AGAP3 1 83134 1.20288E-5 41567 0 4.01162E-6
7-150840866-C-T p.Pro858Ser missense AGAP3 1 83144 1.20273E-5 41572 0 NA
7-150840869-C-A p.Leu859Met missense AGAP3 8 83136 9.62279E-5 41568 0 8.31919E-6
7-150840872-G-A p.Ala860Thr missense AGAP3 1 83138 1.20282E-5 41569 0 8.32251E-6
7-150840876-A-G p.Tyr861Cys missense AGAP3 1 83160 1.2025E-5 41580 0 4.01152E-6
7-150840881-C-T p.Arg863Cys missense AGAP3 2 83144 2.40547E-5 41572 0 4.99509E-5
7-150840882-G-T p.Arg863Leu missense AGAP3 1 83138 1.20282E-5 41569 0 4.01268E-6
7-150840884-C-T p.Arg864Trp missense AGAP3 1 83148 1.20267E-5 41574 0 3.18573E-5
7-150840885-G-A p.Arg864Gln missense AGAP3 1 83150 1.20265E-5 41575 0 4.16237E-5
7-150840888-C-T p.Ala865Val missense AGAP3 1 83148 1.20267E-5 41574 0 NA
7-150840889-C-T p.Ala865Ala synonymous AGAP3 1 83148 1.20267E-5 41574 0 2.49792E-5
7-150840890-G-A p.Gly866Ser missense AGAP3 4 83142 4.81105E-5 41571 0 3.33106E-5
7-150840892-C-G p.Gly866Gly synonymous AGAP3 3 83156 3.60768E-5 41578 0 9.55536E-5
7-150840901-G-A p.Glu869Glu synonymous AGAP3 1 83178 1.20224E-5 41589 0 6.37064E-5
7-150840911-A-G p.Ile873Val missense AGAP3 2 83174 2.4046E-5 41587 0 8.32806E-6
7-150840914-T-C p.Leu874Leu synonymous AGAP3 3 83162 3.60742E-5 41581 0 3.18674E-5
7-150840934-T-C p.Pro880Pro synonymous AGAP3 1 83062 1.20392E-5 41531 0 NA
7-150840954-C-T p.Ala887Val missense AGAP3 1 82974 1.2052E-5 41487 0 6.25E-4
7-150840955-G-A p.Ala887Ala synonymous AGAP3 1 82948 1.20557E-5 41474 0 3.18613E-5
7-150840960-C-T p.Thr889Ile missense AGAP3 1 83014 1.20462E-5 41507 0 NA
7-150840962-C-T p.Pro890Ser missense AGAP3 1 83012 1.20465E-5 41506 0 3.18532E-5
7-150840963-C-T p.Pro890Leu missense AGAP3 199 83006 0.00239742 41503 0 0.00618031
7-150840963-C-G p.Pro890Arg missense AGAP3 1 83012 1.20465E-5 41506 0 6.37146E-5
7-150840984-G-A p.Gly897Asp missense AGAP3 5 82988 6.02497E-5 41494 0 7.2212E-5
7-150840997-T-C p.Ser901Ser synonymous AGAP3 1 82940 1.20569E-5 41470 0 NA
7-150841006-G-A p.Leu904Leu synonymous AGAP3 1 82882 1.20653E-5 41441 0 2.00755E-5
7-150841010-C-T p.Arg906Cys missense AGAP3 1 82854 1.20694E-5 41427 0 8.36862E-6
7-150841011-G-A p.Arg906His missense AGAP3 15 82838 1.81076E-4 41419 0 0.00151057
7-150841017-C-G p.Pro908Arg missense AGAP3 1 82792 1.20785E-5 41396 0 NA
7-150841024-C-T p.Leu910Leu synonymous AGAP3 2 82742 2.41715E-5 41371 0 1.20733E-5
7-150841027-A-G p.Leu911Leu synonymous AGAP3 1 82692 1.20931E-5 41346 0 2.0124E-5
7-150841518-C-T c.*488C>T splice_region AGAP3 1 3184 3.1407E-4 1592 0 3.82409E-4