Variant

Variant ID Consequence Effect Gene AC AN AF NS NHOM maxEAF
12-58120744-C-T c.-28-4C>T splice_region AGAP2-AS1 2 80874 2.47298E-5 40437 0 1.01379E-5
12-58120744-C-G c.-28-4C>G splice_region AGAP2-AS1 1 80874 1.23649E-5 40437 0 9.97069E-6
12-58120744-C-A c.-28-4C>A splice_region AGAP2-AS1 1 80874 1.23649E-5 40437 0 9.97069E-6
12-58120748-C-T c.-28C>T splice_region AGAP2-AS1 1 80958 1.23521E-5 40479 0 NA
12-58120786-G-C p.Trp4Ser missense AGAP2-AS1 1 81388 1.22868E-5 40694 0 NA
12-58120804-G-A p.Arg10Lys missense AGAP2-AS1 1 81256 1.23068E-5 40628 0 NA
12-58120805-G-A p.Arg10Arg synonymous AGAP2-AS1 19 81220 2.33933E-4 40610 0 6.70156E-4
12-58120808-G-C p.Trp11Cys missense AGAP2-AS1 1 81154 1.23223E-5 40577 0 NA
12-58120824-T-G p.Cys17Gly missense AGAP2-AS1 1 80962 1.23515E-5 40481 0 8.45945E-6
12-58120844-G-A p.Val23Val synonymous AGAP2-AS1 1 80728 1.23873E-5 40364 0 3.18979E-5
12-58120851-G-A p.Gly26Ser missense AGAP2-AS1 1 80614 1.24048E-5 40307 0 NA
12-58120853-C-T p.Gly26Gly synonymous AGAP2-AS1 3 80602 3.72199E-5 40301 0 6.0551E-5
12-58120864-C-T p.Ala30Val missense AGAP2-AS1 1 80566 1.24122E-5 40283 0 NA
12-58120879-G-A p.Arg35Lys missense AGAP2-AS1 1 80780 1.23793E-5 40390 0 4.79327E-6
12-58120886-G-C p.Thr37Thr synonymous AGAP2-AS1 1 80684 1.2394E-5 40342 0 4.81232E-6
12-58120895-G-A p.Thr40Thr synonymous AGAP2-AS1 1 80652 1.23989E-5 40326 0 NA
12-58120904-C-T p.Ala43Ala synonymous AGAP2-AS1 2 80838 2.47408E-5 40419 0 NA
12-58120907-C-T p.Cys44Cys synonymous AGAP2-AS1 1 80802 1.23759E-5 40401 0 NA
12-58120913-G-A p.Ala46Ala synonymous AGAP2-AS1 12 80740 1.48625E-4 40370 1 9.29368E-5
12-58120927-G-T p.Arg51Leu missense AGAP2-AS1 1 80774 1.23802E-5 40387 0 NA
12-58120936-GCTC-G p.Ser56del conservative_inframe_deletion AGAP2-AS1 1 80736 1.2386E-5 40368 0 4.3753E-6
12-58120941-T-G p.Ser56Ala missense AGAP2-AS1 1 80670 1.23962E-5 40335 0 NA
12-58120943-C-G p.Ser56Ser synonymous AGAP2-AS1 1 80646 1.23999E-5 40323 0 8.62493E-6
12-58120944-G-C p.Glu57Gln missense AGAP2-AS1 4 80542 4.96635E-5 40271 0 3.19E-5
12-58120952-C-G p.Leu59Leu synonymous AGAP2-AS1 1 80700 1.23916E-5 40350 0 NA
12-58120953-A-C p.Ser60Arg missense AGAP2-AS1 1 80674 1.23956E-5 40337 0 1.21681E-5
12-58120955-C-T p.Ser60Ser synonymous AGAP2-AS1 2 80676 2.47905E-5 40338 0 1.20662E-5
12-58120988-G-C p.Ala71Ala synonymous AGAP2-AS1 42 80356 5.22674E-4 40178 0 3.50832E-4
12-58121003-G-A p.Ser76Ser synonymous AGAP2-AS1 1 80148 1.24769E-5 40074 0 NA
12-58121011-CCCTGCAAGACCAGGGATCAACGGAAAAGGCTCTAGGGACCCCCAGCCAGGACTTCTGCCCCTACCCACGGGACCGTCTCAGGTTCGCACACCCTCAGCAACCCTCCCCCCGCTCTGTTCCCTCACGCTTA-C p.Leu80fs frameshift AGAP2-AS1 1 80084 1.24869E-5 40042 0 NA
12-58121013-CT-C p.Leu80fs frameshift AGAP2-AS1 1 80084 1.24869E-5 40042 0 NA
12-58121015-G-A p.Leu80Leu synonymous AGAP2-AS1 2 79992 2.50025E-5 39996 0 1.63425E-5
12-58121016-C-A p.Gln81Lys missense AGAP2-AS1 8 79962 1.00048E-4 39981 0 2.23271E-4
12-58121051-C-G p.Thr92Thr synonymous AGAP2-AS1 2 78282 2.55487E-5 39141 0 8.21645E-6
12-58121054-C-G p.Pro93Pro synonymous AGAP2-AS1 1 78244 1.27805E-5 39122 0 NA
12-58121077-C-T p.Pro101Leu missense AGAP2-AS1 3 77548 3.86857E-5 38774 0 1.27486E-4
12-58121080-G-C p.Arg102Pro missense AGAP2-AS1 75 77356 9.69543E-4 38678 1 0.00169059
12-58121080-G-A p.Arg102Gln missense AGAP2-AS1 1 77360 1.29266E-5 38680 0 NA
12-58121082-G-T p.Asp103Tyr missense AGAP2-AS1 1 77358 1.29269E-5 38679 0 NA
12-58121088-C-T p.Leu105Phe missense AGAP2-AS1 1 77548 1.28952E-5 38774 0 3.14591E-5
12-58121103-C-A p.Pro110Thr missense AGAP2-AS1 1 77874 1.28413E-5 38937 0 NA
12-58121120-C-G p.Pro115Pro synonymous AGAP2-AS1 2 78560 2.54582E-5 39280 0 2.16125E-5
12-58121130-C-G p.Pro119Ala missense AGAP2-AS1 1 79506 1.25777E-5 39753 0 4.24441E-6
12-58121130-C-A p.Pro119Thr missense AGAP2-AS1 1 79506 1.25777E-5 39753 0 4.24441E-6
12-58121132-C-T p.Pro119Pro synonymous AGAP2-AS1 2 79646 2.51111E-5 39823 0 3.18471E-5
12-58121143-C-G p.Pro123Arg missense AGAP2-AS1 1 80162 1.24747E-5 40081 0 NA
12-58121152-T-G p.Val126Gly missense AGAP2-AS1 2 80644 2.48004E-5 40322 0 1.0311E-5
12-58121158-G-A p.Arg128Gln missense AGAP2-AS1 1 81068 1.23353E-5 40534 0 4.0458E-5
12-58121168-C-T p.Gly131Gly synonymous AGAP2-AS1 3 81368 3.68695E-5 40684 0 9.55962E-5
12-58121191-C-T p.Pro139Leu missense AGAP2-AS1 1 82002 1.21948E-5 41001 0 NA
12-58121206-G-A p.Arg144His missense AGAP2-AS1 1 82166 1.21705E-5 41083 0 8.49473E-6
12-58121236-G-A p.Gly154Asp missense AGAP2-AS1 1 82440 1.213E-5 41220 0 NA
12-58121244-C-T p.Pro157Ser missense AGAP2-AS1 1 82472 1.21253E-5 41236 0 NA
12-58121285-G-T p.Gln170His missense AGAP2-AS1 1 82460 1.21271E-5 41230 0 8.76117E-6
12-58121319-C-G p.Leu182Val missense AGAP2-AS1 1 82362 1.21415E-5 41181 0 9.49559E-6
12-58121336-C-T p.Gly187Gly synonymous AGAP2-AS1 2 82260 2.43132E-5 41130 0 3.18939E-5
12-58121358-C-T p.Arg195Cys missense AGAP2-AS1 1 82160 1.21714E-5 41080 0 3.18654E-5
12-58121360-T-G p.Arg195Arg synonymous AGAP2-AS1 1 82156 1.2172E-5 41078 0 NA
12-58121365-TCTGCGGAAGGAGCGTAGAGGTCGGCTCCCAGCCGGGCAGCACAGGCACCCCGGCATTCACTACACTCCCTAGCCCCTCCGCTGCCTCCTGGCACTCAC-T p.Cys198fs frameshift AGAP2-AS1 11 82118 1.33954E-4 41059 4 NA
12-58121369-C-A p.Cys198* stop_gained AGAP2-AS1 1 82104 1.21797E-5 41052 0 8.91544E-6
12-58121378-C-T p.Ser201Ser synonymous AGAP2-AS1 1 82086 1.21823E-5 41043 0 4.59327E-6
12-58121378-C-A p.Ser201Arg missense AGAP2-AS1 2 82086 2.43647E-5 41043 0 2.76434E-5
12-58121388-G-C p.Gly205Arg missense AGAP2-AS1 1 81968 1.21999E-5 40984 0 NA
12-58121403-A-G p.Ser210Gly missense AGAP2-AS1 127 81978 0.0015492 40989 0 0.00212509
12-58121407-C-T p.Thr211Ile missense AGAP2-AS1 1 81988 1.21969E-5 40994 0 NA
12-58121416-C-T p.Pro214Leu missense AGAP2-AS1 3 81986 3.65916E-5 40993 0 NA
12-58121418-G-C p.Ala215Pro missense AGAP2-AS1 2 81956 2.44033E-5 40978 0 NA
12-58121419-CA-C p.Phe216fs frameshift AGAP2-AS1 1 81962 1.22008E-5 40981 0 4.84534E-6
12-58121419-C-A p.Ala215Glu missense AGAP2-AS1 3 81962 3.66023E-5 40981 0 1.60005E-5
12-58121422-T-G p.Phe216Cys missense AGAP2-AS1 1 81990 1.21966E-5 40995 0 4.81065E-6
12-58121423-CA-C p.Thr217fs frameshift AGAP2-AS1 1 81978 1.21984E-5 40989 0 4.81413E-6
12-58121426-TACACTC-T p.Thr218_Leu219del conservative_inframe_deletion AGAP2-AS1 1 81984 1.21975E-5 40992 0 4.79056E-6
12-58121426-T-G p.Thr217Thr synonymous AGAP2-AS1 2 81984 2.4395E-5 40992 0 3.18654E-5
12-58121435-T-C p.Pro220Pro synonymous AGAP2-AS1 1 82022 1.21919E-5 41011 0 3.18532E-5
12-58121436-A-G p.Ser221Gly missense AGAP2-AS1 1 82042 1.21889E-5 41021 0 4.63637E-6
12-58121444-C-T p.Ser223Ser synonymous AGAP2-AS1 2 82100 2.43605E-5 41050 0 1.80765E-5
12-58121457-C-T p.His228Tyr missense AGAP2-AS1 16 82150 1.94766E-4 41075 0 0.003125
12-58121466-G-A p.Gly231Arg missense AGAP2-AS1 1 82254 1.21575E-5 41127 0 NA
12-58121467-G-A p.Gly231Glu missense AGAP2-AS1 1 82218 1.21628E-5 41109 0 1.35752E-5
12-58121471-C-A p.Ala232Ala synonymous AGAP2-AS1 1 82220 1.21625E-5 41110 0 3.18512E-5
12-58121474-G-A p.Pro233Pro synonymous AGAP2-AS1 3 82244 3.64768E-5 41122 0 1.69057E-5
12-58121498-C-T p.Pro241Pro synonymous AGAP2-AS1 2 82370 2.42807E-5 41185 0 5.04032E-4
12-58121509-G-T p.Arg245Leu missense AGAP2-AS1 152 82354 0.00184569 41177 0 0.0015121
12-58121510-G-A p.Arg245Arg synonymous AGAP2-AS1 2 82364 2.42825E-5 41182 0 8.4894E-6
12-58121528-G-T p.Thr251Thr synonymous AGAP2-AS1 1 82336 1.21454E-5 41168 0 NA
12-58121558-C-A p.Cys261* stop_gained AGAP2-AS1 3 82270 3.64653E-5 41135 0 1.36732E-5
12-58121558-C-T p.Cys261Cys synonymous AGAP2-AS1 1 82270 1.21551E-5 41135 0 4.55772E-6
12-58121577-C-T p.His268Tyr missense AGAP2-AS1 1 82218 1.21628E-5 41109 0 2.28818E-5
12-58122138-T-C c.*556T>C splice_region AGAP2-AS1 1 82422 1.21327E-5 41211 0 3.18431E-5