Variant

Variant ID Consequence Effect Gene AC AN AF NS NHOM maxEAF
12-58120336-T-C p.Ter837Trpext*? stop_lost AGAP2 2 28784 6.9483E-5 14392 0 NA
12-58120343-GC-TT p.AlaLeu834AlaMet missense AGAP2 1 29788 3.35706E-5 14894 0 NA
12-58120354-G-T p.Ala831Asp missense AGAP2 2 31202 6.40985E-5 15601 0 6.60677E-5
12-58120362-G-T p.Arg828Arg synonymous AGAP2 1 31994 3.12559E-5 15997 0 NA
12-58120364-G-A p.Arg828Cys missense AGAP2 1 32248 3.10097E-5 16124 0 NA
12-58120376-C-T p.Ala824Thr missense AGAP2 1 33104 3.02078E-5 16552 0 NA
12-58120377-G-T p.Ala823Ala synonymous AGAP2 1 33126 3.01878E-5 16563 0 NA
12-58120381-C-T p.Ser822Asn missense AGAP2 1 33404 2.99365E-5 16702 0 NA
12-58120394-G-T p.Arg818Ser missense AGAP2 1 34396 2.90731E-5 17198 0 3.43147E-5
12-58120398-G-T p.Ser816Arg missense AGAP2 1 34800 2.87356E-5 17400 0 NA
12-58120409-C-T p.Ala813Thr missense AGAP2 179 36094 0.00495927 18047 4 0.0160428
12-58120409-CGGTGATGCTGGGCGTGGT-C p.Thr807_Thr812del conservative_inframe_deletion AGAP2 2 36110 5.53863E-5 18055 0 3.46332E-5
12-58120411-G-A p.Thr812Ile missense AGAP2 1 36624 2.73045E-5 18312 0 NA
12-58120415-TGCTGGGCGTGGTGGCCGC-T p.Ala805_Ser810del conservative_inframe_deletion AGAP2 52 37106 0.00140139 18553 0 7.64314E-4
12-58120415-T-TGCTGGGCGTGGTGGCCGC p.Ser810_Ile811insAlaAlaThrThrProSer conservative_inframe_insertion AGAP2 2 37106 5.38996E-5 18553 0 6.9483E-5
12-58120426-G-A p.Thr807Ile missense AGAP2 3 38652 7.76156E-5 19326 0 NA
12-58120432-G-A p.Ala805Val missense AGAP2 9 39582 2.27376E-4 19791 0 1.04866E-4
12-58120437-G-A p.Pro803Pro synonymous AGAP2 3 41674 7.19873E-5 20837 0 NA
12-58120441-G-C p.Thr802Arg missense AGAP2 2 42370 4.72032E-5 21185 0 3.48456E-5
12-58120443-G-A p.Thr801Thr synonymous AGAP2 1 43008 2.32515E-5 21504 0 NA
12-58120458-G-A p.Gly796Gly synonymous AGAP2 51 47640 0.00107053 23820 1 0.0018315
12-58120493-C-G p.Asp785His missense AGAP2 1 56336 1.77506E-5 28168 0 3.35031E-5
12-58120536-C-A p.Thr770Thr synonymous AGAP2 1 63654 1.57099E-5 31827 0 NA
12-58120542-G-T p.Gly768Gly synonymous AGAP2 2 65354 3.06026E-5 32677 0 NA
12-58120543-C-T p.Gly768Asp missense AGAP2 2 65154 3.06965E-5 32577 0 NA
12-58120556-G-T p.Arg764Ser missense AGAP2 1 66964 1.49334E-5 33482 0 0.00249377
12-58120560-C-T p.Ala762Ala synonymous AGAP2 2 67694 2.95447E-5 33847 0 NA
12-58120560-C-G p.Ala762Ala synonymous AGAP2 1 67694 1.47724E-5 33847 0 1.30967E-4
12-58120561-G-C p.Ala762Gly missense AGAP2 1 67826 1.47436E-5 33913 0 NA
12-58120774-T-C p.Thr751Ala missense AGAP2 1 81410 1.22835E-5 40705 0 4.95383E-5
12-58120775-G-C p.Ile750Met missense AGAP2 363 81426 0.00445804 40713 6 0.00804187
12-58120786-G-C p.His747Asp missense AGAP2 1 81388 1.22868E-5 40694 0 NA
12-58120804-G-A p.Leu741Leu synonymous AGAP2 1 81256 1.23068E-5 40628 0 NA
12-58120805-G-A p.His740His synonymous AGAP2 19 81220 2.33933E-4 40610 0 6.70156E-4
12-58120808-G-C p.Leu739Leu synonymous AGAP2 1 81154 1.23223E-5 40577 0 NA
12-58120824-T-G p.Gln734Pro missense AGAP2 1 80962 1.23515E-5 40481 0 8.45945E-6
12-58120844-G-A p.Asp727Asp synonymous AGAP2 1 80728 1.23873E-5 40364 0 3.18979E-5
12-58120851-G-A p.Pro725Leu missense AGAP2 1 80614 1.24048E-5 40307 0 NA
12-58120853-C-T p.Gly724Gly synonymous AGAP2 3 80602 3.72199E-5 40301 0 6.0551E-5
12-58120864-C-T p.Ala721Thr missense AGAP2 1 80566 1.24122E-5 40283 0 NA
12-58120879-G-A p.Leu716Leu synonymous AGAP2 1 80780 1.23793E-5 40390 0 4.79327E-6
12-58120886-G-C p.Thr713Thr synonymous AGAP2 1 80684 1.2394E-5 40342 0 4.81232E-6
12-58120895-G-A p.Asp710Asp synonymous AGAP2 1 80652 1.23989E-5 40326 0 NA
12-58120904-C-T p.Gln707Gln synonymous AGAP2 2 80838 2.47408E-5 40419 0 NA
12-58120907-C-T p.Val706Val synonymous AGAP2 1 80802 1.23759E-5 40401 0 NA
12-58120913-G-A p.Ala704Ala synonymous AGAP2 12 80740 1.48625E-4 40370 1 9.29368E-5
12-58120927-G-T p.Arg700Ser missense AGAP2 1 80774 1.23802E-5 40387 0 NA
12-58120936-GCTC-G p.Glu696del conservative_inframe_deletion AGAP2 1 80736 1.2386E-5 40368 0 4.3753E-6
12-58120941-T-G p.Glu695Ala missense AGAP2 1 80670 1.23962E-5 40335 0 NA
12-58120943-C-G p.Ser694Ser synonymous AGAP2 1 80646 1.23999E-5 40323 0 8.62493E-6
12-58120944-G-C p.Ser694Trp missense AGAP2 4 80542 4.96635E-5 40271 0 3.19E-5
12-58120952-C-G p.Leu691Leu synonymous AGAP2 1 80700 1.23916E-5 40350 0 NA
12-58120953-A-C p.Leu691Arg missense AGAP2 1 80674 1.23956E-5 40337 0 1.21681E-5
12-58120955-C-T p.Pro690Pro synonymous AGAP2 2 80676 2.47905E-5 40338 0 1.20662E-5
12-58120988-G-C p.Arg679Arg synonymous AGAP2 42 80356 5.22674E-4 40178 0 3.50832E-4
12-58121003-G-A p.Arg674Arg synonymous AGAP2 1 80148 1.24769E-5 40074 0 NA
12-58121011-CCCTGCAAGACCAGGGATCAACGGAAAAGGCTCTAGGGACCCCCAGCCAGGACTTCTGCCCCTACCCACGGGACCGTCTCAGGTTCGCACACCCTCAGCAACCCTCCCCCCGCTCTGTTCCCTCACGCTTA-C p.Glu672fs frameshift AGAP2 1 80084 1.24869E-5 40042 0 NA
12-58121013-CT-C c.2013-2delA splice_acceptor AGAP2 1 80084 1.24869E-5 40042 0 NA
12-58121015-G-A c.2013-3C>T splice_region AGAP2 2 79992 2.50025E-5 39996 0 1.63425E-5
12-58121016-C-A c.2013-4G>T splice_region AGAP2 8 79962 1.00048E-4 39981 0 2.23271E-4
12-58121143-C-G p.Arg671Pro missense+splice_region AGAP2 1 80162 1.24747E-5 40081 0 NA
12-58121152-T-G p.Asp668Ala missense AGAP2 2 80644 2.48004E-5 40322 0 1.0311E-5
12-58121158-G-A p.Ser666Leu missense AGAP2 1 81068 1.23353E-5 40534 0 4.0458E-5
12-58121168-C-T p.Ala663Thr missense AGAP2 3 81368 3.68695E-5 40684 0 9.55962E-5
12-58121191-C-T p.Trp655* stop_gained AGAP2 1 82002 1.21948E-5 41001 0 NA
12-58121206-G-A p.Thr650Met missense AGAP2 1 82166 1.21705E-5 41083 0 8.49473E-6
12-58121236-G-A p.Thr640Ile missense AGAP2 1 82440 1.213E-5 41220 0 NA
12-58121244-C-T p.Arg637Arg synonymous AGAP2 1 82472 1.21253E-5 41236 0 NA
12-58121285-G-T p.Leu624Met missense AGAP2 1 82460 1.21271E-5 41230 0 8.76117E-6
12-58121319-C-G p.Glu612Asp missense AGAP2 1 82362 1.21415E-5 41181 0 9.49559E-6
12-58121336-C-T p.Ala607Thr missense AGAP2 2 82260 2.43132E-5 41130 0 3.18939E-5
12-58121358-C-T p.Thr599Thr synonymous AGAP2 1 82160 1.21714E-5 41080 0 3.18654E-5
12-58121360-T-G p.Thr599Pro missense AGAP2 1 82156 1.2172E-5 41078 0 NA
12-58121365-TCTGCGGAAGGAGCGTAGAGGTCGGCTCCCAGCCGGGCAGCACAGGCACCCCGGCATTCACTACACTCCCTAGCCCCTCCGCTGCCTCCTGGCACTCAC-T c.1789+1_1790-1delGTGAGTGCCAGGAGGCAGCGGAGGGGCTAGGGAGTGTAGTGAATGCCGGGGTGCCTGTGCTGCCCGGCTGGGAGCCGACCTCTACGCTCCTTCCGCAG splice_acceptor AGAP2 11 82118 1.33954E-4 41059 4 NA
12-58121369-C-A c.1790-4G>T splice_region AGAP2 1 82104 1.21797E-5 41052 0 8.91544E-6
12-58121457-C-T c.1789+7G>A splice_region AGAP2 16 82150 1.94766E-4 41075 0 0.003125
12-58121466-G-A p.Pro596Leu missense+splice_region AGAP2 1 82254 1.21575E-5 41127 0 NA
12-58121467-G-A p.Pro596Ser missense AGAP2 1 82218 1.21628E-5 41109 0 1.35752E-5
12-58121471-C-A p.Gly594Gly synonymous AGAP2 1 82220 1.21625E-5 41110 0 3.18512E-5
12-58121474-G-A p.Cys593Cys synonymous AGAP2 3 82244 3.64768E-5 41122 0 1.69057E-5
12-58121498-C-T p.Lys585Lys synonymous AGAP2 2 82370 2.42807E-5 41185 0 5.04032E-4
12-58121509-G-T p.Arg582Arg synonymous AGAP2 152 82354 0.00184569 41177 0 0.0015121
12-58121510-G-A p.Ile581Ile synonymous AGAP2 2 82364 2.42825E-5 41182 0 8.4894E-6
12-58121528-G-T p.Ala575Ala synonymous AGAP2 1 82336 1.21454E-5 41168 0 NA
12-58121558-C-A c.1699-4G>T splice_region AGAP2 3 82270 3.64653E-5 41135 0 1.36732E-5
12-58121558-C-T c.1699-4G>A splice_region AGAP2 1 82270 1.21551E-5 41135 0 4.55772E-6
12-58121747-C-G p.Leu557Leu synonymous AGAP2 1 82832 1.20726E-5 41416 0 NA
12-58121780-G-A p.Val546Val synonymous AGAP2 4 82864 4.82719E-5 41432 0 6.25E-4
12-58121786-G-A p.Ala544Ala synonymous AGAP2 1 82870 1.20671E-5 41435 0 NA
12-58121798-C-A p.Glu540Asp missense AGAP2 1 82930 1.20584E-5 41465 0 NA
12-58121835-G-A p.Thr528Met missense AGAP2 1 82798 1.20776E-5 41399 0 NA
12-58121841-G-C p.Ser526Cys missense AGAP2 1 82776 1.20808E-5 41388 0 NA
12-58121849-C-T p.Leu523Leu synonymous AGAP2 1 82698 1.20922E-5 41349 0 NA
12-58122124-C-T p.Ser865Asn missense AGAP2 1 82422 1.21327E-5 41211 0 NA
12-58122134-A-G p.Ser862Pro missense AGAP2 1 82432 1.21312E-5 41216 0 NA
12-58122138-T-C p.Leu860Leu synonymous AGAP2 1 82422 1.21327E-5 41211 0 3.18431E-5
12-58122143-T-G p.Lys859Gln missense AGAP2 1 82410 1.21345E-5 41205 0 NA
12-58122154-C-T p.Arg855His missense AGAP2 3 82400 3.64078E-5 41200 0 2.51324E-5
12-58123428-C-G p.Ala515Pro missense AGAP2 1 82980 1.20511E-5 41490 0 NA
12-58123438-C-T p.Ser511Ser synonymous AGAP2 1 83214 1.20172E-5 41607 0 5.04032E-4
12-58123439-G-A p.Ser511Leu missense AGAP2 1 83220 1.20163E-5 41610 0 3.98823E-6
12-58123458-GTGT-G p.Thr504del conservative_inframe_deletion AGAP2 2 83288 2.40131E-5 41644 0 3.98149E-6
12-58123464-T-A p.Thr503Ser missense AGAP2 8 83290 9.60499E-5 41645 0 3.29745E-5
12-58123507-G-A p.Pro488Pro synonymous AGAP2 1 83260 1.20106E-5 41630 0 3.18756E-5
12-58123514-C-T p.Arg486Gln missense AGAP2 2 83246 2.40252E-5 41623 0 3.31011E-5
12-58123515-G-A p.Arg486Trp missense AGAP2 2 83246 2.40252E-5 41623 0 3.18634E-5
12-58123516-A-G p.Ser485Ser synonymous AGAP2 37 83258 4.44402E-4 41629 0 7.33418E-4
12-58123531-G-A p.Asp480Asp synonymous AGAP2 1 83254 1.20114E-5 41627 0 NA
12-58123556-G-A c.1421-6C>T splice_region AGAP2 1 83092 1.20349E-5 41546 0 8.50333E-6
12-58124166-T-C c.*98A>G splice_region AGAP2 1 81768 1.22297E-5 40884 0 NA
12-58124269-C-T p.Gly169Arg missense AGAP2 4 83338 4.79973E-5 41669 0 5.59825E-5
12-58124271-C-T p.Trp168* stop_gained AGAP2 3 83334 3.59997E-5 41667 0 3.1841E-5
12-58124279-C-T p.Thr473Thr splice_region+synonymous AGAP2 3 83360 3.59885E-5 41680 0 3.18451E-5
12-58124292-C-T p.Arg469Gln missense AGAP2 15 83366 1.79929E-4 41683 1 8.23669E-5
12-58124304-C-T p.Arg465Gln missense AGAP2 14 83360 1.67946E-4 41680 0 6.36983E-5
12-58124314-T-G p.Lys462Gln missense AGAP2 3 83370 3.59842E-5 41685 0 9.55597E-5
12-58124337-T-A p.Asp454Val missense AGAP2 1 83382 1.1993E-5 41691 0 2.47105E-5
12-58124353-G-A p.Leu449Leu synonymous AGAP2 1 83390 1.19918E-5 41695 0 2.38658E-5
12-58124354-G-A p.Ser448Ser synonymous AGAP2 1 83390 1.19918E-5 41695 0 NA
12-58124357-ACTGGGG-A p.Pro446_Ser447del disruptive_inframe_deletion AGAP2 1 83392 1.19916E-5 41696 0 1.64766E-5
12-58124357-A-ACTGGGG p.Ser447_Ser448insProSer disruptive_inframe_insertion AGAP2 2 83392 2.39831E-5 41696 0 8.23832E-6
12-58124360-G-C p.Pro446Pro synonymous AGAP2 5 83386 5.99621E-5 41693 0 3.18471E-5
12-58124360-G-A p.Pro446Pro synonymous AGAP2 81 83386 9.71386E-4 41693 0 0.00203822
12-58124388-G-A p.Thr437Ile missense AGAP2 6 83382 7.1958E-5 41691 0 0.0020141
12-58124390-A-G p.Thr436Thr synonymous AGAP2 1 83382 1.1993E-5 41691 0 NA
12-58124392-T-C p.Thr436Ala missense AGAP2 6 83374 7.19649E-5 41687 0 6.36943E-5
12-58124397-TCTGTCGGAAGAAGATGAAACCTCAGTGAGCCTCTTTCTTCTGGCCCCATTCCTTATGTGGTCCCTCTTTATCACCCAGCTTCCTACTCGCCCAGTGCCAGCCCCCTCTTCCCTCTTACCCCTCTTTTTCCCCAGCCCTGGCCCCTCTTCTGCTCCTATGTCATAAACCTTACTCAC-T c.1300+1_1301-1del splice_acceptor AGAP2 1 83380 1.19933E-5 41690 0 NA
12-58124402-C-T c.1301-5G>A splice_region AGAP2 2 83328 2.40015E-5 41664 0 2.48188E-5
12-58124403-G-A c.1301-6C>T splice_region AGAP2 2 83334 2.39998E-5 41667 0 3.31016E-5
12-58124588-A-G p.Met429Thr missense AGAP2 3 83120 3.60924E-5 41560 0 4.99384E-5
12-58124590-C-T p.Gln428Gln synonymous AGAP2 1 83124 1.20302E-5 41562 0 NA
12-58124597-G-A p.Thr426Ile missense AGAP2 1 83126 1.20299E-5 41563 0 NA
12-58124604-T-G p.Met424Leu missense AGAP2 1 83102 1.20334E-5 41551 0 NA
12-58124614-G-A p.Leu420Leu synonymous AGAP2 9 83090 1.08316E-4 41545 0 6.37227E-5
12-58124620-G-A p.Asn418Asn synonymous AGAP2 58 83066 6.9824E-4 41533 0 0.00125
12-58124644-G-A p.Ala410Ala synonymous AGAP2 2 83024 2.40894E-5 41512 0 6.36862E-5
12-58124645-G-T p.Ala410Asp missense AGAP2 2 83018 2.40912E-5 41509 0 NA
12-58124659-C-T p.Pro405Pro synonymous AGAP2 1 82898 1.2063E-5 41449 0 1.22364E-5
12-58124674-C-T p.Pro400Pro synonymous AGAP2 6 82820 7.24463E-5 41410 1 6.03045E-5
12-58124674-C-G p.Pro400Pro synonymous AGAP2 1 82820 1.20744E-5 41410 0 NA
12-58124677-G-A p.Val399Val synonymous AGAP2 1 82782 1.20799E-5 41391 0 NA
12-58124701-G-T p.Asp391Glu missense AGAP2 1 82652 1.20989E-5 41326 0 NA
12-58124715-C-T p.Gly387Ser missense AGAP2 1 82514 1.21192E-5 41257 0 3.18593E-5
12-58124716-G-A p.His386His synonymous AGAP2 8 82538 9.69251E-5 41269 0 3.05064E-4
12-58125142-C-T c.1137+7G>A splice_region AGAP2 3 83146 3.60811E-5 41573 0 8.24022E-6
12-58125149-G-A p.Asn379Asn splice_region+synonymous AGAP2 10 83202 1.20189E-4 41601 1 3.77824E-4
12-58125167-G-A p.Leu373Leu synonymous AGAP2 4 83294 4.80227E-5 41647 0 6.36821E-5
12-58125170-T-C p.Leu372Leu synonymous AGAP2 148 83304 0.00177663 41652 2 0.00408241
12-58125171-A-G p.Leu372Pro missense AGAP2 1 83312 1.20031E-5 41656 0 NA
12-58125179-A-G p.Asn369Asn synonymous AGAP2 7 83320 8.40134E-5 41660 0 3.18492E-5
12-58125185-G-T p.Ser367Ser synonymous AGAP2 1 83336 1.19996E-5 41668 0 6.36862E-5
12-58125245-T-C p.Leu347Leu synonymous AGAP2 1 83386 1.19924E-5 41693 0 1.64747E-5
12-58125252-C-T p.Ser345Asn missense+splice_region AGAP2 3 83382 3.5979E-5 41691 0 1.19294E-5
12-58125253-TCTGGAGAAAGGGGAAAGACACATGTGGGAAAAAAGCCAACTAAGACCAGCTGCCCCTAGCCTGTCCCAGCCCCTGGATCACTCAC-T c.1032+1_1033-1delGTGAGTGATCCAGGGGCTGGGACAGGCTAGGGGCAGCTGGTCTTAGTTGGCTTTTTTCCCACATGTGTCTTTCCCCTTTCTCCAG splice_acceptor AGAP2 13 83378 1.55916E-4 41689 6 NA
12-58125347-T-C p.Ile342Val missense AGAP2 2 83372 2.39889E-5 41686 0 NA
12-58125375-C-T p.Glu332Glu synonymous AGAP2 118 83358 0.00141558 41679 2 0.020625
12-58125377-C-A p.Glu332* stop_gained AGAP2 1 83362 1.19959E-5 41681 0 NA
12-58125379-C-A p.Gly331Val missense AGAP2 3 83372 3.59833E-5 41686 0 1.64788E-5
12-58125381-C-T p.Arg330Arg synonymous AGAP2 1 83362 1.19959E-5 41681 0 3.9764E-6
12-58125383-G-T p.Arg330Arg synonymous AGAP2 1 83360 1.19962E-5 41680 0 NA
12-58125404-C-T p.Glu323Lys missense AGAP2 2 83380 2.39866E-5 41690 0 3.29598E-5
12-58125405-G-A p.Ser322Ser synonymous AGAP2 4 83378 4.79743E-5 41689 0 6.37146E-5
12-58125405-G-C p.Ser322Ser synonymous AGAP2 1 83378 1.19936E-5 41689 0 8.24008E-6
12-58125418-C-T p.Arg318Gln missense AGAP2 1 83378 1.19936E-5 41689 0 3.18715E-5
12-58125420-A-C p.Arg317Arg synonymous AGAP2 2 83374 2.39883E-5 41687 0 3.18796E-5
12-58125421-C-T p.Arg317His missense AGAP2 2 83374 2.39883E-5 41687 0 3.18756E-5
12-58125588-A-G c.945+4T>C splice_region AGAP2 2 82812 2.41511E-5 41406 0 5.40418E-6
12-58125593-G-A p.Ala315Val missense+splice_region AGAP2 6 82832 7.24358E-5 41416 0 1.03391E-4
12-58125604-G-A p.Thr311Thr synonymous AGAP2 1 82862 1.20683E-5 41431 0 9.5584E-5
12-58125611-C-T p.Arg309His missense AGAP2 3 82848 3.62109E-5 41424 0 5.54426E-5
12-58125624-G-A p.Arg305Trp missense AGAP2 2 82862 2.41365E-5 41431 0 1.36644E-5
12-58125625-G-A p.His304His synonymous AGAP2 1 82860 1.20685E-5 41430 0 4.48591E-6
12-58125626-T-C p.His304Arg missense AGAP2 2 82842 2.41423E-5 41421 0 3.18735E-5
12-58125631-G-A p.Ser302Ser synonymous AGAP2 1 82866 1.20677E-5 41433 0 1.4576E-5
12-58125634-C-G p.Gly301Gly synonymous AGAP2 1 82848 1.20703E-5 41424 0 2.17223E-5
12-58125646-C-T p.Leu297Leu synonymous AGAP2 2 82826 2.4147E-5 41413 0 3.18674E-5
12-58125650-C-A p.Gly296Val missense AGAP2 2 82884 2.41301E-5 41442 0 8.38764E-6
12-58125663-C-T p.Ala292Thr missense AGAP2 3 82946 3.61681E-5 41473 0 3.18654E-5
12-58125670-G-A p.Ala289Ala synonymous AGAP2 25 82964 3.01336E-4 41482 0 5.03525E-4
12-58125674-C-T p.Arg288Gln missense AGAP2 4 82972 4.8209E-5 41486 0 4.06445E-5
12-58125681-C-T p.Glu286Lys missense AGAP2 1 82980 1.20511E-5 41490 0 9.60596E-6
12-58125697-C-T p.Pro280Pro synonymous AGAP2 38 83028 4.57677E-4 41514 0 0.00119387
12-58125706-C-T p.Pro277Pro synonymous AGAP2 48 83012 5.7823E-4 41506 0 0.00151057
12-58125707-G-A p.Pro277Leu missense AGAP2 2 83034 2.40865E-5 41517 0 4.00863E-6
12-58125719-G-A p.Ser273Phe missense AGAP2 2 83042 2.40842E-5 41521 0 3.18573E-5
12-58125727-G-A p.Ser270Ser synonymous AGAP2 4 83026 4.81777E-5 41513 0 6.93794E-5
12-58125730-A-G p.Thr269Thr synonymous AGAP2 1 83032 1.20435E-5 41516 0 8.65771E-6
12-58125731-G-A p.Thr269Ile missense AGAP2 1 83040 1.20424E-5 41520 0 3.18552E-5
12-58125736-G-GC p.His268fs frameshift AGAP2 1 83016 1.20459E-5 41508 0 NA
12-58125737-C-A p.Gly267Val missense AGAP2 1 83024 1.20447E-5 41512 0 8.66611E-6
12-58125742-G-A p.Asn265Asn synonymous AGAP2 3 83034 3.61298E-5 41517 0 1.2141E-4
12-58126198-C-T p.Pro258Pro synonymous AGAP2 3 80608 3.72171E-5 40304 0 9.67193E-5
12-58126199-G-T p.Pro258Gln missense AGAP2 14 80642 1.73607E-4 40321 0 0.0010101
12-58126199-G-A p.Pro258Leu missense AGAP2 1 80642 1.24005E-5 40321 0 5.62746E-5
12-58126204-G-A p.Ser256Ser synonymous AGAP2 1 80716 1.23891E-5 40358 0 1.76081E-5
12-58126214-G-A p.Ser253Leu missense AGAP2 1 80782 1.2379E-5 40391 0 3.30819E-5
12-58126231-G-A p.Pro247Pro synonymous AGAP2 1 80528 1.2418E-5 40264 0 NA
12-58126234-C-A p.Leu246Leu synonymous AGAP2 30728 79182 0.388068 39591 6579 0.457404
12-58126240-C-T p.Lys244Lys synonymous AGAP2 5 80542 6.20794E-5 40271 0 3.90798E-4
12-58126247-G-A p.Ala242Val missense AGAP2 4 80596 4.96303E-5 40298 0 5.37018E-5
12-58126254-G-A p.Leu240Leu synonymous AGAP2 2 80586 2.48182E-5 40293 0 3.18431E-5
12-58126303-G-C c.677-8C>G splice_region AGAP2 1 80662 1.23974E-5 40331 0 NA
12-58126642-C-T p.Arg221Gln missense AGAP2 9 83050 1.08368E-4 41525 0 3.18715E-5
12-58126651-T-C p.Asn218Ser missense AGAP2 1 83110 1.20322E-5 41555 0 3.18715E-5
12-58126690-C-A p.Arg205Leu missense AGAP2 3 83044 3.61254E-5 41522 0 2.38684E-5
12-58126701-C-T p.Ala201Ala synonymous AGAP2 2 83002 2.40958E-5 41501 0 6.37471E-5
12-58126702-G-A p.Ala201Val missense AGAP2 1 82946 1.2056E-5 41473 0 9.5584E-5
12-58126703-C-T p.Ala201Thr missense AGAP2 12 82938 1.44686E-4 41469 0 6.25E-4
12-58126704-G-A p.Cys200Cys synonymous AGAP2 4 82948 4.8223E-5 41474 0 2.38955E-4
12-58126707-C-G p.Leu199Leu synonymous AGAP2 2 82944 2.41127E-5 41472 0 NA
12-58126711-G-T p.Ala198Asp missense AGAP2 3 82936 3.61725E-5 41468 0 1.59124E-5
12-58126720-C-T p.Arg195His missense AGAP2 1 82864 1.2068E-5 41432 0 3.97864E-6
12-58126731-C-T p.Val191Val synonymous AGAP2 96 82826 0.00115906 41413 1 0.00184772
12-58126738-C-T p.Arg189Gln missense AGAP2 1 82760 1.20831E-5 41380 0 3.97994E-6
12-58126746-GGAAGCACTGATCCTGTCTGAGGGGAC-G p.Asp181fs frameshift AGAP2 1 82722 1.20887E-5 41361 0 NA
12-58126758-C-G p.Arg182Ser missense AGAP2 2 82588 2.42166E-5 41294 0 NA
12-58126761-G-A p.Asp181Asp splice_region+synonymous AGAP2 4 82536 4.84637E-5 41268 0 2.06485E-4
12-58127822-C-A p.Leu176Leu synonymous AGAP2 3 82838 3.62153E-5 41419 0 8.8143E-6
12-58127832-G-T p.Ala173Asp missense AGAP2 1 82886 1.20648E-5 41443 0 NA
12-58127838-C-G p.Gly171Ala missense AGAP2 5 82908 6.03078E-5 41454 0 3.18512E-4
12-58127838-C-A p.Gly171Val missense AGAP2 8 82908 9.64925E-5 41454 0 2.22958E-4
12-58127839-C-T p.Gly171Ser missense AGAP2 6 82918 7.23606E-5 41459 0 4.5786E-4
12-58127843-T-C p.Arg169Arg synonymous AGAP2 1 82932 1.20581E-5 41466 0 NA
12-58127844-C-T p.Arg169Gln missense AGAP2 1 82922 1.20595E-5 41461 0 6.37064E-5
12-58127855-G-A p.Arg165Arg synonymous AGAP2 4 82948 4.8223E-5 41474 0 1.91144E-4
12-58127857-G-A p.Arg165Cys missense AGAP2 2 82966 2.41063E-5 41483 0 3.18532E-5
12-58127881-G-A p.Leu157Phe missense AGAP2 11 83032 1.32479E-4 41516 0 3.5043E-4
12-58127883-C-T p.Arg156His missense AGAP2 2 83018 2.40912E-5 41509 0 5.03525E-4
12-58127893-C-A p.Ala153Ser missense AGAP2 2 83028 2.40883E-5 41514 0 3.32624E-5
12-58127902-T-C p.Ser150Gly missense AGAP2 1 83070 1.2038E-5 41535 0 NA
12-58127906-C-T p.Glu148Glu synonymous AGAP2 3 83064 3.61167E-5 41532 0 NA
12-58127917-G-A p.Leu145Leu synonymous AGAP2 1 83078 1.20369E-5 41539 0 7.98512E-6
12-58127926-C-T p.Val142Ile missense AGAP2 2 83080 2.40732E-5 41540 0 1.59205E-4
12-58127936-A-G p.Ala138Ala synonymous AGAP2 2 83096 2.40685E-5 41548 0 8.00275E-6
12-58127948-G-A p.Gly134Gly synonymous AGAP2 5 83098 6.01699E-5 41549 0 4.18732E-5
12-58127961-C-T c.394-5G>A splice_region AGAP2 17 83062 2.04666E-4 41531 0 6.25E-4
12-58127961-C-A c.394-5G>T splice_region AGAP2 1 83064 1.20389E-5 41532 0 2.52402E-5
12-58127962-G-A c.394-6C>T splice_region AGAP2 10 83066 1.20386E-4 41533 0 8.40421E-6
12-58128099-C-T c.393+3G>A splice_region AGAP2 1 83202 1.20189E-5 41601 0 3.29674E-5
12-58128119-C-T p.Gly126Arg missense AGAP2 1 83238 1.20137E-5 41619 0 1.6478E-5
12-58128130-C-T p.Arg122Gln missense AGAP2 2 83218 2.40333E-5 41609 0 4.11882E-5
12-58128144-A-G p.His117His synonymous AGAP2 1 83206 1.20184E-5 41603 0 3.97671E-6
12-58128149-T-C p.Thr116Ala missense AGAP2 1 83190 1.20207E-5 41595 0 NA
12-58128153-T-C p.Gly114Gly synonymous AGAP2 2 83180 2.40442E-5 41590 0 NA
12-58128156-A-G p.Asp113Asp synonymous AGAP2 2 83176 2.40454E-5 41588 0 NA
12-58128166-A-G p.Met110Thr missense AGAP2 199 83178 0.00239246 41589 1 0.00225719
12-58128182-G-GC p.Gln105fs frameshift AGAP2 1 83116 1.20314E-5 41558 0 NA
12-58128184-T-TAGAATTGGGTAAAGTTTTC p.Glu104fs frameshift AGAP2 1 83106 1.20328E-5 41553 0 NA
12-58128186-A-C p.Ser103Arg missense+splice_region AGAP2 1 83090 1.20351E-5 41545 0 NA
12-58128376-C-G p.Glu102Asp missense+splice_region AGAP2 1 82778 1.20805E-5 41389 0 8.239E-6
12-58128378-C-G p.Glu102Gln missense AGAP2 250 82788 0.00301976 41394 3 0.00243755
12-58128382-C-T p.Lys100Lys synonymous AGAP2 1 82766 1.20823E-5 41383 0 NA
12-58128387-C-T p.Glu99Lys missense AGAP2 1 82754 1.2084E-5 41377 0 NA
12-58128390-G-A p.Leu98Leu synonymous AGAP2 1 82738 1.20863E-5 41369 0 NA
12-58128400-T-C p.Ser94Ser synonymous AGAP2 36 82740 4.35098E-4 41370 1 7.96381E-4
12-58128421-G-A p.Ile87Ile synonymous AGAP2 2 82742 2.41715E-5 41371 0 NA
12-58128427-C-T p.Ser85Ser synonymous AGAP2 16 82690 1.93494E-4 41345 0 3.50341E-4
12-58128437-C-T p.Gly82Glu missense AGAP2 1 82666 1.20969E-5 41333 0 1.64861E-5
12-58128467-G-A c.220-5C>T splice_region AGAP2 1 82418 1.21333E-5 41209 0 NA
12-58128468-G-T c.220-6C>A splice_region AGAP2 1 82404 1.21353E-5 41202 0 NA
12-58129157-G-A p.Arg72Cys missense AGAP2 1 81956 1.22017E-5 40978 0 1.99636E-5
12-58129175-G-A p.Arg66Cys missense AGAP2 1 82024 1.21916E-5 41012 0 NA
12-58129193-G-T p.Gln60Lys missense AGAP2 1 82042 1.21889E-5 41021 0 NA
12-58129199-T-C p.Asn58Asp missense AGAP2 1 82016 1.21927E-5 41008 0 3.18979E-5
12-58129201-A-G p.Ile57Thr missense AGAP2 1 81992 1.21963E-5 40996 0 1.73427E-5
12-58129217-C-T c.161-7G>A splice_region AGAP2 1 81886 1.22121E-5 40943 0 3.18878E-5
12-58129218-G-A c.161-8C>T splice_region AGAP2 6 81876 7.32815E-5 40938 0 3.21197E-5
12-58130862-T-C p.Lys253Glu missense+splice_region AGAP2 2 78758 2.53942E-5 39379 0 1.0533E-4
12-58130863-A-G p.Pro252Pro splice_region+synonymous AGAP2 3 78782 3.80798E-5 39391 0 6.37836E-5
12-58130866-G-T p.Ser251Ser synonymous AGAP2 1 78830 1.26855E-5 39415 0 NA
12-58130870-GC-AA p.Ala250Phe missense AGAP2 1 78946 1.26669E-5 39473 0 NA
12-58130871-C-T p.Ala250Thr missense AGAP2 1 78918 1.26714E-5 39459 0 9.51294E-5
12-58130872-G-A p.Arg249Arg synonymous AGAP2 32 79046 4.04828E-4 39523 0 0.00101626
12-58130889-GC-TT p.LeuLeu243LeuMet missense AGAP2 213 79838 0.0026679 39919 2 NA
12-58130889-G-T p.Leu244Met missense AGAP2 15 79844 1.87866E-4 39922 1 0.00595921
12-58130890-C-T p.Leu243Leu synonymous AGAP2 15 79848 1.87857E-4 39924 1 0.00595807
12-58130892-G-A p.Leu243Leu synonymous AGAP2 1 79952 1.25075E-5 39976 0 NA
12-58130903-C-T p.Gly239Glu missense AGAP2 1 80318 1.24505E-5 40159 0 5.72122E-6
12-58130907-T-A p.Ser238Cys missense AGAP2 1 80444 1.2431E-5 40222 0 1.70864E-5
12-58130908-G-A p.Gly237Gly synonymous AGAP2 1 80462 1.24282E-5 40231 0 NA
12-58130927-G-C p.Pro231Arg missense AGAP2 2 80754 2.47666E-5 40377 0 1.15687E-5
12-58130930-C-T p.Gly230Glu missense AGAP2 2 80730 2.47739E-5 40365 0 6.26566E-4
12-58130934-G-A p.Pro229Ser missense AGAP2 1 80956 1.23524E-5 40478 0 1.6793E-5
12-58130938-G-A p.Pro227Pro synonymous AGAP2 1 81106 1.23295E-5 40553 0 NA
12-58130939-G-A p.Pro227Leu missense AGAP2 1 81100 1.23305E-5 40550 0 5.51353E-6
12-58130941-C-T p.Gly226Gly synonymous AGAP2 1 81052 1.23378E-5 40526 0 1.58806E-4
12-58130943-C-T p.Gly226Arg missense AGAP2 1 81104 1.23298E-5 40552 0 5.43685E-6
12-58130944-G-A p.Ser225Ser synonymous AGAP2 1 81170 1.23198E-5 40585 0 3.79305E-5
12-58130957-C-T p.Gly221Glu missense AGAP2 1 81468 1.22748E-5 40734 0 NA
12-58130980-G-A p.Gly213Gly synonymous AGAP2 2 81748 2.44654E-5 40874 0 NA
12-58130992-C-T p.Lys209Lys synonymous AGAP2 1 81860 1.2216E-5 40930 0 NA
12-58131025-G-A p.Gly198Gly synonymous AGAP2 3 81842 3.6656E-5 40921 0 8.93895E-5
12-58131027-C-T p.Gly198Ser missense AGAP2 1 81892 1.22112E-5 40946 0 1.08852E-5
12-58131032-T-C p.Glu196Gly missense AGAP2 1 81824 1.22214E-5 40912 0 NA
12-58131052-C-G p.Pro189Pro synonymous AGAP2 22 81858 2.68758E-4 40929 0 6.69472E-4
12-58131060-G-A p.Pro187Ser missense AGAP2 4 81872 4.88568E-5 40936 0 3.18715E-5
12-58131064-C-G p.Glu185Asp missense AGAP2 1 81828 1.22208E-5 40914 0 1.75846E-5
12-58131068-A-T p.Leu184Gln missense AGAP2 1 81818 1.22222E-5 40909 0 NA
12-58131069-G-C p.Leu184Val missense AGAP2 3 81846 3.66542E-5 40923 0 2.61429E-4
12-58131084-C-A p.Ala179Ser missense AGAP2 1 81816 1.22225E-5 40908 0 4.04891E-6
12-58131085-A-C p.Pro178Pro synonymous AGAP2 2 81854 2.44337E-5 40927 0 2.83245E-5
12-58131100-C-G p.Ala173Ala synonymous AGAP2 1 81846 1.22181E-5 40923 0 4.46286E-4
12-58131119-G-A p.Ala167Val missense AGAP2 107 82022 0.00130453 41011 1 0.00704935
12-58131127-TGGACTC-T p.Ser163_Pro164del disruptive_inframe_deletion AGAP2 1 82076 1.21838E-5 41038 0 4.03633E-6
12-58131133-C-A p.Pro162Pro synonymous AGAP2 1 81996 1.21957E-5 40998 0 3.18979E-5
12-58131133-C-G p.Pro162Pro synonymous AGAP2 2 81996 2.43914E-5 40998 0 8.43925E-6
12-58131134-G-T p.Pro162Gln missense AGAP2 1 82028 1.2191E-5 41014 0 1.21119E-5
12-58131134-G-C p.Pro162Arg missense AGAP2 1 82028 1.2191E-5 41014 0 NA
12-58131135-G-A p.Pro162Ser missense AGAP2 1 82046 1.21883E-5 41023 0 2.01782E-5
12-58131136-A-G p.Thr161Thr synonymous AGAP2 10 81898 1.22103E-4 40949 0 1.18387E-4
12-58131145-G-C p.Leu158Leu synonymous AGAP2 21 82112 2.55748E-4 41056 0 6.37592E-4
12-58131152-A-G p.Leu156Pro missense AGAP2 2 82126 2.43528E-5 41063 0 NA
12-58131156-G-A p.Pro155Ser missense AGAP2 2 82140 2.43487E-5 41070 0 NA
12-58131165-A-G p.Ser152Pro missense AGAP2 4 82114 4.87128E-5 41057 0 1.68396E-5
12-58131174-G-C p.Pro149Ala missense AGAP2 1 82128 1.21761E-5 41064 0 8.42304E-6
12-58131182-G-A p.Pro146Leu missense AGAP2 8 82152 9.73805E-5 41076 0 7.58674E-5
12-58131191-T-C p.Asp143Gly missense AGAP2 5 82190 6.08347E-5 41095 0 8.43967E-6
12-58131200-T-A p.Asp140Val missense AGAP2 1 82202 1.21652E-5 41101 0 4.03323E-6
12-58131210-T-C p.Lys137Glu missense AGAP2 3 82196 3.64981E-5 41098 0 6.39141E-5
12-58131217-G-C p.Gly134Gly synonymous AGAP2 1 82132 1.21755E-5 41066 0 NA
12-58131218-C-G p.Gly134Ala missense AGAP2 9 82120 1.09596E-4 41060 0 9.58099E-5
12-58131225-G-A p.Arg132Trp missense AGAP2 2 82018 2.43849E-5 41009 0 NA
12-58131229-G-C p.Ser130Ser synonymous AGAP2 2 82000 2.43902E-5 41000 0 7.30807E-5
12-58131247-T-TCCAGCC p.Gly124_Ala125insAlaGly disruptive_inframe_insertion AGAP2 4 81770 4.89177E-5 40885 0 1.07745E-5
12-58131251-G-T p.Ala123Asp missense AGAP2 145 81756 0.00177357 40878 0 0.0040282
12-58131252-C-G p.Ala123Pro missense AGAP2 1 81752 1.22321E-5 40876 0 4.18291E-6
12-58131257-G-A p.Ala121Val missense AGAP2 1 81682 1.22426E-5 40841 0 NA
12-58131260-C-G p.Gly120Ala missense AGAP2 1 81676 1.22435E-5 40838 0 NA
12-58131267-C-A p.Gly118Trp missense AGAP2 2 81562 2.45212E-5 40781 0 3.19264E-5
12-58131269-C-T p.Gly117Asp missense AGAP2 3 81550 3.67872E-5 40775 0 9.57732E-5
12-58131272-G-A p.Ser116Phe missense AGAP2 1 81536 1.22645E-5 40768 0 2.67494E-5
12-58131281-G-A p.Ala113Val missense AGAP2 1 81360 1.22911E-5 40680 0 NA
12-58131289-G-A p.Gly110Gly synonymous AGAP2 3 81130 3.69777E-5 40565 0 2.87541E-5
12-58131299-CCGG-C p.Ala106del disruptive_inframe_deletion AGAP2 2 80720 2.4777E-5 40360 0 6.89819E-4
12-58131300-C-CGGCGGCGGCGGCGGT p.Ala106_Gly107insThrAlaAlaAlaAla conservative_inframe_insertion AGAP2 2 80748 2.47684E-5 40374 0 NA
12-58131303-CGGCGGCGGCGGT-C p.Thr102_Ala105del conservative_inframe_deletion AGAP2 10 80570 1.24116E-4 40285 0 3.01335E-4
12-58131306-C-CGGCGGCGGT p.Ala104_Ala105insThrAlaAla conservative_inframe_insertion AGAP2 1 80500 1.24224E-5 40250 0 2.84625E-5
12-58131307-G-A p.Ala104Ala synonymous AGAP2 1 80482 1.24251E-5 40241 0 1.21099E-5
12-58131310-G-T p.Ala103Ala synonymous AGAP2 5 80388 6.21983E-5 40194 0 3.19673E-5
12-58131313-G-C p.Thr102Thr synonymous AGAP2 1 80330 1.24486E-5 40165 0 4.19428E-5
12-58131336-C-T p.Ala95Thr missense AGAP2 1 79912 1.25138E-5 39956 0 NA
12-58131345-C-T p.Gly92Arg missense AGAP2 1 79686 1.25493E-5 39843 0 NA
12-58131359-G-A p.Ser87Leu missense AGAP2 1 79330 1.26056E-5 39665 0 NA
12-58131363-C-T p.Gly86Arg missense AGAP2 9 79276 1.13527E-4 39638 0 3.19366E-5
12-58131375-G-A p.Pro82Ser missense AGAP2 4 78860 5.07228E-5 39430 0 3.19468E-5
12-58131385-G-C p.Ser78Arg missense AGAP2 1 78306 1.27704E-5 39153 0 6.76343E-6
12-58131389-T-G p.Glu77Ala missense AGAP2 1 78106 1.28031E-5 39053 0 6.76544E-6
12-58131396-A-G p.Trp75Arg missense AGAP2 2 77644 2.57586E-5 38822 0 NA
12-58131397-T-G p.Ser74Ser synonymous AGAP2 1 77636 1.28806E-5 38818 0 NA
12-58131401-A-T p.Leu73Gln missense AGAP2 3 77246 3.8837E-5 38623 0 NA
12-58131413-G-A p.Ala69Val missense AGAP2 2 74732 2.67623E-5 37366 0 NA
12-58131422-C-A p.Gly66Val missense AGAP2 8 73180 1.09319E-4 36590 1 6.25782E-4
12-58131431-G-T p.Ala63Asp missense AGAP2 1 70906 1.41032E-5 35453 0 6.25782E-4
12-58131443-C-T p.Ser59Asn missense AGAP2 1 68886 1.45167E-5 34443 0 NA
12-58131445-C-T p.Thr58Thr synonymous AGAP2 1 68232 1.46559E-5 34116 0 NA
12-58131488-G-C p.Ala44Gly missense AGAP2 1 54378 1.83898E-5 27189 0 NA
12-58131523-C-A p.Pro32Pro synonymous AGAP2 1 46068 2.1707E-5 23034 0 1.46918E-5
12-58131529-G-A p.Ser30Ser synonymous AGAP2 3 45460 6.59921E-5 22730 0 NA
12-58131529-G-C p.Ser30Ser synonymous AGAP2 1 45460 2.19974E-5 22730 0 8.19037E-5
12-58131544-GC-TT p.Gly25Glu missense AGAP2 7 43374 1.61387E-4 21687 0 NA
12-58131544-G-T p.Gly25Gly synonymous AGAP2 1 43374 2.30553E-5 21687 0 1.39425E-4
12-58131545-C-T p.Gly25Asp missense AGAP2 1 43242 2.31257E-5 21621 0 1.39438E-4
12-58131551-C-A p.Gly23Val missense AGAP2 2 42440 4.71254E-5 21220 0 NA
12-58131555-C-A p.Ala22Ser missense AGAP2 1 42040 2.37869E-5 21020 0 1.56647E-5
12-58131557-C-G p.Arg21Pro missense AGAP2 2 41842 4.77989E-5 20921 0 0.00131406
12-58131563-TCGGGCTC-T p.Glu17fs frameshift AGAP2 1 41564 2.40593E-5 20782 0 NA
12-58131568-C-G p.Glu17Asp missense AGAP2 4 41296 9.68617E-5 20648 0 3.20862E-5
12-58131571-C-T p.Pro16Pro synonymous AGAP2 2 41104 4.86571E-5 20552 0 3.2144E-5
12-58131580-C-G p.Trp13Cys missense AGAP2 7 40894 1.71174E-4 20447 0 NA
12-58131596-A-G p.Leu8Pro missense AGAP2 1 40446 2.47243E-5 20223 0 NA
12-58131601-G-A p.Pro6Pro synonymous AGAP2 1 40336 2.47917E-5 20168 0 6.42013E-5
12-58131604-G-T p.Arg5Arg synonymous AGAP2 8 40136 1.99322E-4 20068 0 5.46097E-4
12-58131604-G-C p.Arg5Arg synonymous AGAP2 2 40136 4.98306E-5 20068 0 8.98614E-5
12-58131609-G-A p.Arg4Trp missense AGAP2 3 39970 7.50563E-5 19985 0 1.28783E-4
12-58131621-G-T p.Pro137Thr missense AGAP2 1 39612 2.52449E-5 19806 0 NA
12-58131622-G-A p.Ala136Ala synonymous AGAP2 3 39570 7.5815E-5 19785 0 3.21978E-5
12-58131633-G-A p.Pro133Ser missense AGAP2 1 39484 2.53267E-5 19742 0 1.63816E-5
12-58131643-G-T p.Pro129Pro synonymous AGAP2 1 39352 2.54117E-5 19676 0 3.22144E-5
12-58131667-G-T p.Pro121Pro synonymous AGAP2 4 39300 1.01781E-4 19650 0 NA
12-58131669-G-T p.Pro121Thr missense AGAP2 21 39280 5.34623E-4 19640 1 0.00296736
12-58131674-G-T p.Pro119Gln missense AGAP2 2 39216 5.09996E-5 19608 0 NA
12-58131691-G-A p.Ser113Ser synonymous AGAP2 1 39280 2.54582E-5 19640 0 NA
12-58131697-G-A p.Arg111Arg synonymous AGAP2 2 39164 5.10673E-5 19582 0 NA
12-58131716-G-C p.Ser105Cys missense AGAP2 1 40236 2.48534E-5 20118 0 NA
12-58131718-G-T p.Val104Val synonymous AGAP2 3 40264 7.45082E-5 20132 0 NA
12-58131722-G-A p.Pro103Leu missense AGAP2 6 40550 1.47965E-4 20275 0 6.45619E-5
12-58131731-G-C p.Pro100Arg missense AGAP2 1 41176 2.4286E-5 20588 0 NA
12-58131732-G-T p.Pro100Thr missense AGAP2 1 41264 2.42342E-5 20632 0 NA
12-58131745-C-G p.Pro95Pro synonymous AGAP2 1 42556 2.34984E-5 21278 0 NA
12-58131749-G-T p.Ser94Tyr missense AGAP2 1 43228 2.31332E-5 21614 0 NA
12-58131750-A-G p.Ser94Pro missense AGAP2 2 43086 4.64188E-5 21543 0 NA
12-58131753-G-C p.Leu93Val missense AGAP2 3 43462 6.90258E-5 21731 0 NA
12-58131773-C-G p.Gly86Ala missense AGAP2 1 45842 2.18141E-5 22921 0 NA
12-58131774-C-T p.Gly86Arg missense AGAP2 1 45902 2.17855E-5 22951 0 NA
12-58131775-G-C p.Thr85Thr synonymous AGAP2 1 45940 2.17675E-5 22970 0 1.73864E-4
12-58131784-G-T p.Ser82Arg missense AGAP2 1 47560 2.10261E-5 23780 0 NA
12-58131820-G-A p.Phe70Phe synonymous AGAP2 1 52074 1.92034E-5 26037 0 NA
12-58131831-C-T p.Glu67Lys missense AGAP2 1 51798 1.93058E-5 25899 0 NA
12-58131836-C-T p.Arg65Gln missense AGAP2 1 51674 1.93521E-5 25837 0 8.31241E-6
12-58131840-T-G p.Lys64Gln missense AGAP2 1 51438 1.94409E-5 25719 0 NA
12-58131850-C-T p.Glu60Glu synonymous AGAP2 1 50832 1.96726E-5 25416 0 1.48539E-4
12-58131858-C-T p.Ala58Thr missense AGAP2 1 49954 2.00184E-5 24977 0 3.23123E-5
12-58131868-G-T p.Ser54Arg missense AGAP2 1 48882 2.04574E-5 24441 0 8.23927E-6
12-58131881-C-T p.Gly50Glu missense AGAP2 8 47994 1.66688E-4 23997 0 4.19897E-4
12-58131886-C-T p.Glu48Glu synonymous AGAP2 4 47656 8.39349E-5 23828 0 0.00239808
12-58131888-C-T p.Glu48Lys missense AGAP2 1 47352 2.11184E-5 23676 0 1.61457E-4
12-58131919-G-A p.Ala37Ala synonymous AGAP2 2 43136 4.6365E-5 21568 0 NA
12-58131940-C-A p.Pro30Pro synonymous AGAP2 1 41798 2.39246E-5 20899 0 NA
12-58131984-G-A p.Leu16Phe missense AGAP2 1 40452 2.47207E-5 20226 0 3.23604E-5
12-58131998-C-G p.Arg11Pro missense AGAP2 2 39948 5.00651E-5 19974 0 NA
12-58132009-C-A p.Ala7Ala synonymous AGAP2 1 39566 2.52742E-5 19783 0 NA
12-58135683-CCTTT-C c.160+8_160+11delAAAG splice_region AGAP2 1 83350 1.19976E-5 41675 0 NA
12-58135688-C-G c.160+7G>C splice_region AGAP2 1 83356 1.19967E-5 41678 0 3.30983E-5
12-58135691-T-C c.160+4A>G splice_region AGAP2 1 83360 1.19962E-5 41680 0 NA
12-58135697-C-T p.Arg53Gln missense+splice_region AGAP2 3 83360 3.59885E-5 41680 0 3.58717E-5
12-58135698-G-T p.Arg53Arg synonymous AGAP2 158 83350 0.00189562 41675 0 0.00143367
12-58135698-G-A p.Arg53* stop_gained AGAP2 4 83354 4.79881E-5 41677 0 1.27437E-4
12-58135710-A-G p.Leu49Leu synonymous AGAP2 1 83368 1.1995E-5 41684 0 3.98029E-5
12-58135711-T-G p.Ser48Ser synonymous AGAP2 2 83368 2.399E-5 41684 0 8.24892E-6
12-58135725-T-C p.Ser44Gly missense AGAP2 7 83362 8.39711E-5 41681 0 3.57987E-5
12-58135731-G-A p.Gln42* stop_gained AGAP2 1 83370 1.19947E-5 41685 0 6.37349E-5
12-58135738-G-A p.Pro39Pro synonymous AGAP2 6 83358 7.19787E-5 41679 0 1.27494E-4
12-58135743-C-T p.Asp38Asn missense AGAP2 1 83348 1.19979E-5 41674 0 8.23859E-6
12-58135744-G-A p.Asp37Asp synonymous AGAP2 3 83348 3.59937E-5 41674 0 3.29527E-5
12-58135749-C-T p.Val36Met missense AGAP2 8 83358 9.59716E-5 41679 0 9.55779E-5
12-58135757-G-A p.Ala33Val missense AGAP2 1 83368 1.1995E-5 41684 0 NA
12-58135765-C-T p.Arg30Arg synonymous AGAP2 2 83368 2.399E-5 41684 0 3.18593E-5
12-58135772-C-T p.Arg28His missense AGAP2 1 83352 1.19973E-5 41676 0 4.37442E-5
12-58135786-C-A p.Lys23Asn missense AGAP2 2 83332 2.40004E-5 41666 0 1.5906E-5
12-58135792-C-T p.Val21Val synonymous AGAP2 2 83332 2.40004E-5 41666 0 8.23764E-6
12-58135798-A-C p.His19Gln missense AGAP2 2 83324 2.40027E-5 41662 0 NA
12-58135802-C-T p.Arg18Gln missense AGAP2 4 83318 4.80088E-5 41659 0 5.03525E-4
12-58135823-G-A p.Ala11Val missense AGAP2 24 83292 2.88143E-4 41646 0 0.00100705
12-58135827-C-T p.Ala10Thr missense AGAP2 1 83272 1.20088E-5 41636 0 NA
12-58135833-C-T p.Val8Ile missense AGAP2 3 83248 3.60369E-5 41624 0 2.38639E-5
12-58135834-G-A p.Phe7Phe synonymous AGAP2 1 83242 1.20132E-5 41621 0 5.03525E-4
12-58135836-A-T p.Phe7Ile missense AGAP2 69 83246 8.28869E-4 41623 0 0.00143477
12-58135850-T-C p.His2Arg missense AGAP2 3 83182 3.60655E-5 41591 0 1.59429E-4
12-58135918-G-A c.-64C>T 5_prime_UTR_premature_start_codon_gain AGAP2 2 79438 2.51769E-5 39719 0 3.18878E-5