Variant

Variant ID Consequence Effect Gene AC AN AF NS NHOM maxEAF
2-236403282-G-T c.-49G>T 5_prime_UTR_premature_start_codon_gain AGAP1 2 9388 2.13038E-4 4694 0 NA
2-236403313-G-T c.-18G>T 5_prime_UTR_premature_start_codon_gain AGAP1 1 30594 3.26861E-5 15297 0 NA
2-236403333-G-T p.Met1? start_lost AGAP1 1 55362 1.80629E-5 27681 0 NA
2-236403341-A-G p.Gln4Arg missense AGAP1 1 61152 1.63527E-5 30576 0 NA
2-236403343-C-G p.Gln5Glu missense AGAP1 1 62246 1.60653E-5 31123 0 NA
2-236403349-C-T p.Leu7Leu synonymous AGAP1 5 65238 7.66424E-5 32619 0 8.93256E-6
2-236403354-C-T p.Ala8Ala synonymous AGAP1 1 68806 1.45336E-5 34403 0 NA
2-236403358-T-A p.Ser10Thr missense AGAP1 1 70442 1.41961E-5 35221 0 NA
2-236403366-C-T p.Ala12Ala synonymous AGAP1 2 73290 2.72889E-5 36645 0 2.56525E-4
2-236403395-C-T p.Ser22Leu missense AGAP1 1 77742 1.28631E-5 38871 0 8.52384E-6
2-236403413-A-C p.Tyr28Ser missense AGAP1 1 78590 1.27243E-5 39295 0 NA
2-236403414-C-T p.Tyr28Tyr synonymous AGAP1 5 78732 6.35066E-5 39366 0 3.27847E-5
2-236403420-C-G p.Ile30Met missense AGAP1 1 78922 1.26707E-5 39461 0 NA
2-236403439-G-T p.Val37Leu missense AGAP1 11 78770 1.39647E-4 39385 0 1.96014E-4
2-236403441-G-A p.Val37Val synonymous AGAP1 3 78828 3.80575E-5 39414 0 6.52358E-5
2-236403442-G-A p.Glu38Lys missense AGAP1 1 78776 1.26942E-5 39388 0 4.37821E-6
2-236403446-A-G p.Glu39Gly missense AGAP1 2 78710 2.54097E-5 39355 0 4.39329E-6
2-236403453-G-A p.Val41Val synonymous AGAP1 1 78716 1.27039E-5 39358 0 2.60671E-4
2-236403454-C-A p.Leu42Met missense AGAP1 1 78706 1.27055E-5 39353 0 2.56608E-5
2-236403462-C-T p.Asn44Asn synonymous AGAP1 1885 78464 0.0240238 39232 33 0.0199346
2-236403468-C-G p.Ile46Met missense AGAP1 1 78552 1.27304E-5 39276 0 NA
2-236403470-G-A p.Arg47Gln missense AGAP1 1 78528 1.27343E-5 39264 0 4.52985E-6
2-236403486-C-T p.Ala52Ala synonymous AGAP1 19 78306 2.42638E-4 39153 0 2.61455E-4
2-236403489-C-A p.Ile53Ile synonymous AGAP1 1 78218 1.27848E-5 39109 0 NA
2-236403497-A-T c.163+4A>T splice_region AGAP1 5 78036 6.4073E-5 39018 0 0.00125
2-236432971-C-T c.-209C>T 5_prime_UTR_premature_start_codon_gain AGAP1 44 38170 0.00115274 19085 0 0.00251801
2-236432994-G-T c.-186G>T 5_prime_UTR_premature_start_codon_gain AGAP1 5 42160 1.18596E-4 21080 0 2.54923E-4
2-236433066-G-A c.-114G>A 5_prime_UTR_premature_start_codon_gain AGAP1 1 47704 2.09626E-5 23852 0 1.91095E-4
2-236433068-G-T c.-112G>T 5_prime_UTR_premature_start_codon_gain AGAP1 2 47650 4.19727E-5 23825 0 NA
2-236433100-C-T c.-80C>T 5_prime_UTR_premature_start_codon_gain AGAP1 1 48364 2.06765E-5 24182 0 NA
2-236433174-GCCCCCATGGGTAAGTATAACCCCCAC-G c.-5_4+17delCCCCCATGGGTAAGTATAACCCCCAC splice_donor AGAP1 1 49070 2.0379E-5 24535 0 NA
2-236433181-T-C p.Met1? start_lost AGAP1 1 48706 2.05314E-5 24353 0 NA
2-236433187-A-C c.4+4A>C splice_region AGAP1 1055 48212 0.0218825 24106 55 0.0375263
2-236578685-C-T c.-59C>T 5_prime_UTR_premature_start_codon_gain AGAP1 101 9436 0.0107037 4718 1 0.0302531
2-236578709-C-T c.-35C>T 5_prime_UTR_premature_start_codon_gain AGAP1 1 11180 8.94454E-5 5590 0 NA
2-236578773-C-T p.Pro10Pro synonymous AGAP1 1 26522 3.77045E-5 13261 0 1.02958E-4
2-236578781-C-T p.Pro13Leu missense AGAP1 10 28232 3.54208E-4 14116 0 3.44947E-4
2-236578784-C-T p.Pro14Leu missense AGAP1 1 29124 3.43359E-5 14562 0 NA
2-236578799-C-G p.Pro19Arg missense AGAP1 1 31476 3.17702E-5 15738 0 NA
2-236578805-G-C p.Gly21Ala missense AGAP1 2 32410 6.17093E-5 16205 0 1.02515E-4
2-236578807-A-G p.Thr22Ala missense AGAP1 2 32458 6.16181E-5 16229 0 6.25782E-4
2-236578808-C-T p.Thr22Met missense AGAP1 1 32866 3.04266E-5 16433 0 NA
2-236578810-C-T p.Pro23Ser missense AGAP1 1 33364 2.99724E-5 16682 0 6.86483E-5
2-236578813-C-T p.Pro24Ser missense AGAP1 1 34106 2.93204E-5 17053 0 NA
2-236578815-C-T p.Pro24Pro synonymous AGAP1 1 34212 2.92295E-5 17106 0 3.4181E-5
2-236578836-C-T p.Ile31Ile synonymous AGAP1 1 34766 2.87637E-5 17383 0 2.56898E-5
2-236578845-C-T p.Thr34Thr synonymous AGAP1 1 34314 2.91426E-5 17157 0 1.28396E-5
2-236578857-G-A p.Lys38Lys synonymous AGAP1 58 33112 0.00175163 16556 1 0.00250627
2-236578871-C-T p.Ala43Val missense AGAP1 1 29848 3.35031E-5 14924 0 NA
2-236578872-G-T p.Ala43Ala synonymous AGAP1 1 29680 3.36927E-5 14840 0 NA
2-236578880-CCGGCGGCCCGGACCCACGCCCGGTT-C p.Asp50fs frameshift AGAP1 1 29020 3.4459E-5 14510 0 1.35234E-5
2-236578894-C-T p.Pro51Ser missense AGAP1 1 26256 3.80865E-5 13128 0 NA
2-236578902-G-T p.Pro53Pro synonymous AGAP1 399 23088 0.0172817 11544 17 0.030028
2-236578902-GG-TA p.ProVal53ProIle missense AGAP1 1 23162 4.31742E-5 11581 0 NA
2-236578903-G-A p.Val54Ile missense AGAP1 1 23134 4.32264E-5 11567 0 2.37917E-4
2-236578914-C-G p.Pro57Pro synonymous AGAP1 1 21108 4.73754E-5 10554 0 NA
2-236578915-C-T p.Arg58Trp missense AGAP1 3 20874 1.43719E-4 10437 0 3.79795E-4
2-236578938-G-A p.Ala65Ala synonymous AGAP1 1 17914 5.58223E-5 8957 0 3.38616E-5
2-236578956-G-A p.Glu71Glu synonymous AGAP1 301 18646 0.0161429 9323 9 0.172131
2-236578965-G-T p.Glu74Asp missense AGAP1 131 18716 0.00699936 9358 1 0.0183915
2-236578967-A-C p.Glu75Ala missense AGAP1 1 18600 5.37634E-5 9300 0 NA
2-236578973-A-AGGGCGCCGAGGAACCGGAG p.Pro85fs frameshift AGAP1 2 18648 1.0725E-4 9324 0 NA
2-236578990-G-T p.Glu83* stop_gained AGAP1 1 19328 5.17384E-5 9664 0 NA
2-236578996-C-A p.Pro85Thr missense AGAP1 1 20146 4.96376E-5 10073 0 1.6756E-4
2-236578999-C-G p.Arg86Gly missense AGAP1 303 19944 0.0151925 9972 16 0.174102
2-236579008-G-A p.Ala89Thr missense AGAP1 173 20202 0.00856351 10101 2 0.00598897
2-236579008-G-C p.Ala89Pro missense AGAP1 1 20232 4.94266E-5 10116 0 2.33879E-4
2-236579008-G-T p.Ala89Ser missense AGAP1 2 20234 9.88435E-5 10117 0 0.00254291
2-236579009-C-G p.Ala89Gly missense AGAP1 1 20396 4.90292E-5 10198 0 NA
2-236579019-C-G p.Phe92Leu missense AGAP1 17 20874 8.1441E-4 10437 0 0.0016377
2-236579029-C-T p.Arg96Cys missense AGAP1 1 20596 4.85531E-5 10298 0 1.67118E-5
2-236579030-G-C p.Arg96Pro missense AGAP1 1 20492 4.87995E-5 10246 0 NA
2-236579033-C-G p.Thr97Ser missense AGAP1 1 20686 4.83419E-5 10343 0 3.33422E-5
2-236579034-C-T p.Thr97Thr synonymous AGAP1 1 20734 4.823E-5 10367 0 NA
2-236579043-C-A p.Thr100Thr synonymous AGAP1 2 19930 1.00351E-4 9965 0 NA
2-236579053-G-A p.Glu104Lys missense AGAP1 1 19426 5.14774E-5 9713 0 NA
2-236579065-C-T p.Leu108Phe missense AGAP1 1 18046 5.54139E-5 9023 0 9.42152E-5
2-236579066-T-C p.Leu108Pro missense AGAP1 1 17852 5.60161E-5 8926 0 3.14861E-5
2-236579069-G-A p.Arg109Gln missense AGAP1 2 17528 1.14103E-4 8764 0 3.19908E-5
2-236579077-G-A p.Ala112Thr missense AGAP1 1 16660 6.0024E-5 8330 0 1.69872E-5
2-236579086-C-T p.Leu115Leu synonymous AGAP1 1 16498 6.06134E-5 8249 0 NA
2-236579087-T-C p.Leu115Pro missense AGAP1 6 16334 3.67332E-4 8167 0 6.72631E-5
2-236579088-G-A p.Leu115Leu synonymous AGAP1 1 16272 6.14553E-5 8136 0 2.03169E-4
2-236579150-C-T p.Ser136Phe missense AGAP1 5 12106 4.13018E-4 6053 0 0.00139683
2-236579160-C-T p.Pro139Pro synonymous AGAP1 2 11866 1.68549E-4 5933 0 5.96145E-4
2-236579184-G-A p.Ala147Ala synonymous AGAP1 1 11180 8.94454E-5 5590 0 NA
2-236579205-C-T p.Ser154Ser synonymous AGAP1 1 12816 7.80275E-5 6408 0 NA
2-236579221-G-C p.Gly160Arg missense AGAP1 1 14314 6.98617E-5 7157 0 NA
2-236579242-C-A p.Arg167Arg synonymous AGAP1 4 18664 2.14316E-4 9332 0 7.42556E-5
2-236579244-G-T p.Arg167Arg synonymous AGAP1 2 19014 1.05186E-4 9507 0 NA
2-236579256-C-T p.Gly171Gly synonymous AGAP1 1 20506 4.87662E-5 10253 0 NA
2-236579267-A-G p.His175Arg missense AGAP1 1 22440 4.45633E-5 11220 0 NA
2-236579268-C-T p.His175His synonymous AGAP1 1 22916 4.36376E-5 11458 0 3.2684E-5
2-236579277-C-T p.Ser178Ser synonymous AGAP1 1 24226 4.1278E-5 12113 0 4.57429E-5
2-236579280-G-T p.Gly179Gly synonymous AGAP1 1 24658 4.05548E-5 12329 0 1.4928E-5
2-236579287-G-T p.Ala182Ser missense AGAP1 18 25650 7.01754E-4 12825 0 1.99304E-4
2-236579288-C-T p.Ala182Val missense AGAP1 1 25716 3.88863E-5 12858 0 3.26755E-5
2-236579289-C-T p.Ala182Ala synonymous AGAP1 2 25884 7.72678E-5 12942 0 1.3101E-5
2-236579292-G-C p.Trp183Cys missense AGAP1 5 26284 1.9023E-4 13142 0 3.43997E-4
2-236579294-C-T p.Ala184Val missense AGAP1 1 26294 3.80315E-5 13147 0 NA
2-236579297-C-T p.Pro185Leu missense AGAP1 1 26842 3.7255E-5 13421 0 5.05127E-5
2-236579301-C-T p.Cys186Cys synonymous AGAP1 9 27310 3.2955E-4 13655 0 6.25E-4
2-236579317-G-A p.Gly192Arg missense AGAP1 5076 29516 0.171975 14758 379 0.243756
2-236579325-C-G p.Thr194Thr synonymous AGAP1 2 32120 6.22665E-5 16060 0 3.28623E-5
2-236579340-C-T p.Thr199Thr synonymous AGAP1 2 35260 5.67215E-5 17630 0 1.00438E-5
2-236579343-C-T p.Ala200Ala synonymous AGAP1 2 36114 5.53802E-5 18057 0 3.29207E-5
2-236579345-C-G p.Thr201Arg missense AGAP1 1 36500 2.73973E-5 18250 0 NA
2-236579345-C-T p.Thr201Met missense AGAP1 1 36500 2.73973E-5 18250 0 5.0009E-5
2-236579349-G-C p.Gln202His missense AGAP1 1 37400 2.6738E-5 18700 0 9.98363E-6
2-236579361-G-A p.Glu206Glu synonymous AGAP1 1 41466 2.41161E-5 20733 0 NA
2-236579385-C-T p.Gly214Gly synonymous AGAP1 1 47132 2.1217E-5 23566 0 9.35104E-5
2-236579389-G-C p.Val216Leu missense AGAP1 1 48616 2.05694E-5 24308 0 NA
2-236579403-C-T p.Asn220Asn synonymous AGAP1 39 50674 7.69625E-4 25337 0 0.00121246
2-236579408-C-A p.Ala222Glu missense AGAP1 3 50838 5.9011E-5 25419 0 1.96425E-4
2-236579410-C-T p.Leu223Phe missense AGAP1 2 51356 3.89438E-5 25678 0 NA
2-236579415-G-A p.Ser224Ser synonymous AGAP1 1 51630 1.93686E-5 25815 0 1.08705E-5
2-236579418-C-G p.Asp225Glu missense AGAP1 1 51702 1.93416E-5 25851 0 NA
2-236579427-T-C p.Arg228Arg synonymous AGAP1 1 51652 1.93603E-5 25826 0 1.13209E-5
2-236579433-A-G p.Glu230Glu synonymous AGAP1 2 51448 3.88742E-5 25724 0 NA
2-236579434-C-T p.Arg231Cys missense AGAP1 1 51366 1.94681E-5 25683 0 3.26264E-5
2-236579440-A-T p.Lys233* stop_gained AGAP1 1 51008 1.96048E-5 25504 0 NA
2-236579464-A-T p.Asn241Tyr missense AGAP1 1 47170 2.11999E-5 23585 0 NA
2-236579467-A-G p.Ser242Gly missense AGAP1 1 46518 2.14971E-5 23259 0 NA
2-236579472-C-T p.Asp243Asp synonymous AGAP1 2 45406 4.4047E-5 22703 0 6.25E-4
2-236579473-C-T p.Leu244Leu synonymous AGAP1 4 45232 8.8433E-5 22616 0 2.81777E-5
2-236579479-C-T p.Arg246Trp missense AGAP1 2 43496 4.59812E-5 21748 0 1.55783E-5
2-236579490-C-G p.Arg249Arg synonymous AGAP1 1 41204 2.42695E-5 20602 0 NA
2-236579497-G-A p.Ala252Thr missense AGAP1 1 40604 2.46281E-5 20302 0 1.25E-4
2-236579504-C-T p.Ala254Val missense AGAP1 2 39852 5.01857E-5 19926 0 NA
2-236579508-G-A p.Gly255Gly synonymous AGAP1 1 39590 2.52589E-5 19795 0 NA
2-236579511-C-T p.Ala256Ala synonymous AGAP1 1 39168 2.5531E-5 19584 0 4.04694E-4
2-236579522-C-T p.Ser260Leu missense AGAP1 2 38240 5.23013E-5 19120 0 NA
2-236579527-C-T p.His262Tyr missense AGAP1 3 38146 7.86452E-5 19073 0 NA
2-236579530-C-T p.Arg263Trp missense AGAP1 2 38146 5.24301E-5 19073 0 4.56663E-5
2-236579531-G-C p.Arg263Pro missense AGAP1 1 38194 2.61821E-5 19097 0 3.26477E-5
2-236579539-C-A p.Arg266Ser missense AGAP1 2 37322 5.35877E-5 18661 0 NA
2-236579539-C-G p.Arg266Gly missense AGAP1 1 37322 2.67938E-5 18661 0 NA
2-236579540-G-C p.Arg266Pro missense AGAP1 1 37262 2.6837E-5 18631 0 NA
2-236579552-G-A p.Gly270Asp missense AGAP1 2 36668 5.45435E-5 18334 0 NA
2-236579553-C-T p.Gly270Gly synonymous AGAP1 1 36474 2.74168E-5 18237 0 NA
2-236579557-T-G p.Phe272Val missense AGAP1 1 36330 2.75255E-5 18165 0 NA
2-236579559-C-T p.Phe272Phe synonymous AGAP1 1 36262 2.75771E-5 18131 0 NA
2-236579572-G-C p.Gly277Arg missense AGAP1 1 35812 2.79236E-5 17906 0 NA
2-236579576-G-A p.Gly278Asp missense AGAP1 1 35698 2.80128E-5 17849 0 NA
2-236579577-C-T p.Gly278Gly synonymous AGAP1 1 35524 2.815E-5 17762 0 NA
2-236579580-G-C p.Pro279Pro synonymous AGAP1 1 34842 2.8701E-5 17421 0 0.0010661
2-236579580-G-GGGC p.Gly282dup disruptive_inframe_insertion AGAP1 2 34842 5.7402E-5 17421 0 NA
2-236579604-C-T p.Ser287Ser synonymous AGAP1 2 35104 5.69736E-5 17552 0 NA
2-236579612-C-G p.Ser290Trp missense AGAP1 12 34728 3.45543E-4 17364 0 0.00197889
2-236579623-G-A p.Gly294Ser missense AGAP1 1 34794 2.87406E-5 17397 0 NA
2-236579625-C-T p.Gly294Gly synonymous AGAP1 2 34782 5.7501E-5 17391 0 NA
2-236579636-T-G p.Leu298Arg missense AGAP1 1 34808 2.8729E-5 17404 0 NA
2-236579636-T-TGCGGCGG p.Pro302fs frameshift AGAP1 1 34808 2.8729E-5 17404 0 NA
2-236579639-G-A p.Arg299Gln missense AGAP1 2 34752 5.75506E-5 17376 0 6.5189E-4
2-236579647-C-T p.Pro302Ser missense AGAP1 2 34506 5.79609E-5 17253 0 NA
2-236579665-T-C p.Ser308Pro missense AGAP1 1 34302 2.91528E-5 17151 0 NA
2-236579671-G-T p.Ala310Ser missense AGAP1 1 34010 2.94031E-5 17005 0 3.25542E-5
2-236579694-G-A p.Pro317Pro synonymous AGAP1 1 32648 3.06297E-5 16324 0 NA
2-236579696-G-A p.Arg318His missense AGAP1 3 32634 9.19287E-5 16317 0 1.60865E-4
2-236579709-G-A c.958+8G>A splice_region AGAP1 10 32360 3.09023E-4 16180 0 NA
2-236617817-T-C c.164-6T>C splice_region AGAP1 1 83208 1.20181E-5 41604 0 2.47105E-5
2-236617820-C-T c.164-3C>T splice_region AGAP1 7 83222 8.41124E-5 41611 0 1.64734E-5
2-236617824-T-C p.Asp55Asp splice_region+synonymous AGAP1 1 83232 1.20146E-5 41616 0 3.18634E-5
2-236617830-C-T p.Phe57Phe synonymous AGAP1 32 83256 3.84357E-4 41628 0 0.00100705
2-236617850-C-T p.Thr64Met missense AGAP1 5 83282 6.0037E-5 41641 0 5.76559E-5
2-236617850-C-G p.Thr64Arg missense AGAP1 1 83282 1.20074E-5 41641 0 7.95317E-6
2-236617851-G-C p.Thr64Thr synonymous AGAP1 1 83276 1.20083E-5 41638 0 NA
2-236617858-C-T p.Arg67* stop_gained AGAP1 4 83272 4.80354E-5 41636 0 3.97665E-6
2-236617859-G-T p.Arg67Leu missense AGAP1 2 83270 2.40183E-5 41635 0 NA
2-236617862-C-T p.Ser68Phe missense AGAP1 1 83272 1.20088E-5 41636 0 4.94185E-5
2-236617868-C-T p.Pro70Leu missense AGAP1 23 83262 2.76236E-4 41631 0 0.00151057
2-236617869-G-A p.Pro70Pro synonymous AGAP1 2755 83200 0.033113 41600 231 0.0700434
2-236617888-G-C c.222+7G>C splice_region AGAP1 1 83192 1.20204E-5 41596 0 NA
2-236626209-G-A p.Val77Val synonymous AGAP1 1 83274 1.20085E-5 41637 0 1.64851E-4
2-236626224-C-T p.Ser82Ser synonymous AGAP1 1 83288 1.20065E-5 41644 0 1.2651E-5
2-236626225-G-A p.Gly83Ser missense AGAP1 120 83286 0.00144082 41643 0 0.00453172
2-236626236-C-T p.Ala86Ala synonymous AGAP1 1 83296 1.20054E-5 41648 0 NA
2-236626237-C-G p.Leu87Val missense AGAP1 1 83300 1.20048E-5 41650 0 9.55231E-5
2-236626242-G-A p.Val88Val synonymous AGAP1 4 83292 4.80238E-5 41646 0 2.47231E-5
2-236626257-G-A p.Thr93Thr synonymous AGAP1 1 83270 1.20091E-5 41635 0 1.24677E-5
2-236626261-A-G p.Thr95Ala missense AGAP1 1 83274 1.20085E-5 41637 0 8.31193E-6
2-236626263-A-G p.Thr95Thr synonymous AGAP1 3 83270 3.60274E-5 41635 0 4.14883E-6
2-236626278-G-C p.Glu100Asp missense AGAP1 2 83184 2.40431E-5 41592 0 1.2747E-5
2-236626283-C-T p.Pro102Leu missense AGAP1 1 83136 1.20285E-5 41568 0 4.24373E-6
2-236626284-G-T p.Pro102Pro synonymous AGAP1 1 83132 1.20291E-5 41566 0 8.25887E-6
2-236626284-G-A p.Pro102Pro synonymous AGAP1 1 83132 1.20291E-5 41566 0 5.78121E-5
2-236626292-T-C c.310+4T>C splice_region AGAP1 1 83094 1.20346E-5 41547 0 2.48069E-5
2-236626295-T-A c.310+7T>A splice_region AGAP1 1 83072 1.20378E-5 41536 0 NA
2-236649604-C-T c.311-3C>T splice_region AGAP1 2 83258 2.40217E-5 41629 0 NA
2-236649611-C-T p.Gly105Gly synonymous AGAP1 1 83258 1.20109E-5 41629 0 3.97665E-6
2-236649628-T-C p.Ile111Thr missense AGAP1 1 83318 1.20022E-5 41659 0 9.55414E-5
2-236649631-T-C p.Val112Ala missense AGAP1 3 83318 3.60066E-5 41659 0 5.16964E-5
2-236649633-G-A p.Val113Ile missense AGAP1 4 83306 4.80158E-5 41653 0 1.64791E-5
2-236649637-A-T p.Asp114Val missense AGAP1 9 83306 1.08035E-4 41653 0 6.25E-4
2-236649649-A-C p.Tyr118Ser missense AGAP1 1 83292 1.2006E-5 41646 0 3.18471E-5
2-236649659-G-A p.Leu121Leu synonymous AGAP1 1 83290 1.20062E-5 41645 0 NA
2-236649664-G-T p.Arg123Ile missense AGAP1 1 83282 1.20074E-5 41641 0 3.97681E-6
2-236649668-T-C p.Asp124Asp synonymous AGAP1 1 83272 1.20088E-5 41636 0 1.59205E-4
2-236649671-A-G p.Glu125Glu synonymous AGAP1 64 83272 7.68566E-4 41636 0 0.00187886
2-236649679-C-A p.Pro128His missense AGAP1 1 83260 1.20106E-5 41630 0 3.97788E-6
2-236649679-C-T p.Pro128Leu missense AGAP1 1 83260 1.20106E-5 41630 0 NA
2-236649683-G-T p.Pro129Pro synonymous AGAP1 1 83230 1.20149E-5 41615 0 8.2661E-6
2-236649686-G-A p.Glu130Glu synonymous AGAP1 2 83198 2.4039E-5 41599 0 NA
2-236649689-G-T p.Ala131Ala synonymous AGAP1 53 83156 6.37356E-4 41578 0 0.00156011
2-236649689-G-A p.Ala131Ala synonymous AGAP1 1 83160 1.2025E-5 41580 0 9.55171E-5
2-236649695-G-C c.396+3G>C splice_region AGAP1 1 83126 1.20299E-5 41563 0 NA
2-236649696-A-G c.396+4A>G splice_region AGAP1 3 83096 3.61028E-5 41548 0 4.15849E-5
2-236649697-G-A c.396+5G>A splice_region AGAP1 3 83092 3.61046E-5 41546 0 NA
2-236653336-C-G c.397-6C>G splice_region AGAP1 1 83360 1.19962E-5 41680 0 NA
2-236653350-G-A p.Met135Ile missense AGAP1 2 83390 2.39837E-5 41695 0 8.23845E-6
2-236653359-C-T p.Asp138Asp synonymous AGAP1 2 83406 2.39791E-5 41703 0 4.94242E-5
2-236653367-T-C p.Ile141Thr missense AGAP1 5 83416 5.99405E-5 41708 0 8.35056E-5
2-236653369-T-G p.Phe142Val missense AGAP1 1 83414 1.19884E-5 41707 0 1.64734E-5
2-236653381-T-C p.Leu146Leu synonymous AGAP1 1 83428 1.19864E-5 41714 0 7.95254E-6
2-236653393-A-G p.Ile150Val missense AGAP1 2 83432 2.39716E-5 41716 0 NA
2-236653407-C-G p.Thr154Thr synonymous AGAP1 2 83432 2.39716E-5 41716 0 NA
2-236653408-G-A p.Val155Ile missense AGAP1 2 83434 2.3971E-5 41717 0 9.55779E-5
2-236653414-C-T p.His157Tyr missense AGAP1 4 83436 4.79409E-5 41718 0 3.9764E-5
2-236653420-T-C p.Tyr159His missense AGAP1 1 83430 1.19861E-5 41715 0 8.23669E-6
2-236653432-G-A p.Ala163Thr missense AGAP1 1 83434 1.19855E-5 41717 0 3.97636E-6
2-236653441-C-T p.Arg166Trp missense AGAP1 1 83432 1.19858E-5 41716 0 3.18552E-5
2-236653448-C-T p.Thr168Met missense AGAP1 1 83430 1.19861E-5 41715 0 3.9764E-6
2-236653449-G-A p.Thr168Thr synonymous AGAP1 155 83430 0.00185784 41715 0 0.00264365
2-236653451-G-A p.Ser169Asn missense AGAP1 1 83428 1.19864E-5 41714 0 1.64742E-5
2-236653452-C-T p.Ser169Ser synonymous AGAP1 3 83426 3.596E-5 41713 0 3.18512E-5
2-236653465-G-C p.Val174Leu missense AGAP1 1 83414 1.19884E-5 41707 0 NA
2-236653468-C-T p.Leu175Leu synonymous AGAP1 3 83410 3.59669E-5 41705 0 3.97659E-6
2-236653473-G-T p.Val176Val synonymous AGAP1 1 83410 1.1989E-5 41705 0 3.18471E-5
2-236653479-C-T p.Thr178Thr synonymous AGAP1 1 83404 1.19898E-5 41702 0 NA
2-236653487-A-G c.538+4A>G splice_region AGAP1 8 83400 9.59233E-5 41700 0 5.77025E-5
2-236659003-A-G p.Ile182Val missense AGAP1 3 83416 3.59643E-5 41708 0 1.64742E-5
2-236659008-T-C p.Ser183Ser synonymous AGAP1 1 83420 1.19875E-5 41710 0 NA
2-236659020-G-A p.Pro187Pro synonymous AGAP1 2 83420 2.39751E-5 41710 0 5.03525E-4
2-236659024-G-T p.Val189Phe missense AGAP1 1 83422 1.19872E-5 41711 0 NA
2-236659026-C-G p.Val189Val synonymous AGAP1 1 83420 1.19875E-5 41710 0 NA
2-236659029-C-T p.Ile190Ile synonymous AGAP1 5 83424 5.99348E-5 41712 0 1.81201E-4
2-236659030-G-A p.Asp191Asn missense AGAP1 11 83424 1.31857E-4 41712 0 6.36821E-5
2-236659030-G-C p.Asp191His missense AGAP1 1 83424 1.1987E-5 41712 0 7.9526E-6
2-236659033-G-A p.Asp192Asn missense AGAP1 6 83424 7.19217E-5 41712 0 0.001875
2-236659035-C-T p.Asp192Asp synonymous AGAP1 35 83422 4.19554E-4 41711 0 0.00302115
2-236659036-G-A p.Ala193Thr missense AGAP1 1 83422 1.19872E-5 41711 0 7.9526E-6
2-236659037-C-T p.Ala193Val missense AGAP1 1 83422 1.19872E-5 41711 0 NA
2-236659043-C-T p.Ala195Val missense AGAP1 2 83426 2.39733E-5 41713 0 NA
2-236659044-G-A p.Ala195Ala synonymous AGAP1 8 83422 9.5898E-5 41711 0 5.18903E-4
2-236659044-G-C p.Ala195Ala synonymous AGAP1 1 83422 1.19872E-5 41711 0 6.36943E-5
2-236659058-A-G p.Asn200Ser missense AGAP1 4 83432 4.79432E-5 41716 0 4.11821E-5
2-236659059-C-T p.Asn200Asn synonymous AGAP1 13 83432 1.55816E-4 41716 0 2.5481E-4
2-236659060-G-A p.Asp201Asn missense AGAP1 5 83434 5.99276E-5 41717 0 4.94193E-5
2-236659076-C-T p.Thr206Met missense AGAP1 1 83436 1.19852E-5 41718 0 6.3674E-5
2-236659083-C-T p.Tyr208Tyr synonymous AGAP1 2 83438 2.39699E-5 41719 0 5.03525E-4
2-236659089-G-A p.Thr210Thr synonymous AGAP1 47 83440 5.63279E-4 41720 0 0.00125
2-236659089-G-T p.Thr210Thr synonymous AGAP1 2 83442 2.39687E-5 41721 0 9.55171E-5
2-236659094-C-G p.Ala212Gly missense AGAP1 1 83442 1.19844E-5 41721 0 NA
2-236659101-C-T p.Tyr214Tyr synonymous AGAP1 2 83438 2.39699E-5 41719 0 3.29462E-5
2-236659110-T-C p.Asn217Asn synonymous AGAP1 990 83418 0.0118679 41709 25 0.0220715
2-236659131-C-T p.Asp224Asp splice_region+synonymous AGAP1 3 83394 3.59738E-5 41697 0 8.2371E-6
2-236659132-G-GTTGCCCAGAAGATTGTTGCCACAAGGAAGAAGCA c.673_673+1insTTGCCCAGAAGATTGTTGCCACAAGGAAGAAGCA splice_donor AGAP1 2 83390 2.39837E-5 41695 1 NA
2-236659132-G-GTTGCCCAGAAGATT c.673_673+1insTTGCCCAGAAGATT splice_donor AGAP1 3 83390 3.59755E-5 41695 1 NA
2-236659139-G-A c.673+7G>A splice_region AGAP1 2 83372 2.39889E-5 41686 0 3.29495E-5
2-236706446-C-T p.Ser239Ser synonymous AGAP1 4 83392 4.79662E-5 41696 0 9.56023E-5
2-236706448-T-C p.Ile240Thr missense AGAP1 2 83394 2.39825E-5 41697 0 3.29462E-5
2-236706449-A-G p.Ile240Met missense AGAP1 4 83394 4.79651E-5 41697 0 6.58924E-5
2-236706467-A-G p.Leu246Leu synonymous AGAP1 15 83382 1.79895E-4 41691 0 0.00124857
2-236706482-C-T p.Ser251Ser synonymous AGAP1 3 83392 3.59747E-5 41696 0 5.03525E-4
2-236706491-C-T p.Ser254Ser synonymous AGAP1 5 83396 5.99549E-5 41698 0 6.25E-4
2-236706492-G-A p.Val255Ile missense AGAP1 2 83394 2.39825E-5 41697 0 6.37349E-5
2-236706494-C-T p.Val255Val synonymous AGAP1 1 83392 1.19916E-5 41696 0 NA
2-236706500-C-T p.Ser257Ser synonymous AGAP1 2 83390 2.39837E-5 41695 0 6.37146E-5
2-236706502-C-T p.Ala258Val missense AGAP1 2 83390 2.39837E-5 41695 0 3.97665E-6
2-236706515-C-T p.Ala262Ala synonymous AGAP1 4 83390 4.79674E-5 41695 0 0.00100705
2-236706516-G-A p.Val263Met missense AGAP1 1 83390 1.19918E-5 41695 0 3.18654E-5
2-236706518-G-A p.Val263Val synonymous AGAP1 23 83388 2.75819E-4 41694 0 0.001875
2-236706519-C-T p.His264Tyr missense AGAP1 5 83394 5.99564E-5 41697 0 3.10233E-4
2-236706534-C-T c.801+4C>T splice_region AGAP1 3 83374 3.59824E-5 41687 0 8.24103E-6
2-236706535-G-A c.801+5G>A splice_region AGAP1 4 83374 4.79766E-5 41687 0 8.24103E-6
2-236708004-A-T c.802-7A>T splice_region AGAP1 24 83162 2.88593E-4 41581 1 1.27372E-4
2-236708013-A-G p.Thr268Thr splice_region+synonymous AGAP1 4 83224 4.80631E-5 41612 0 8.76131E-5
2-236708024-G-T p.Gly272Val missense AGAP1 1 83278 1.2008E-5 41639 0 3.18451E-5
2-236708026-G-A p.Gly273Arg missense AGAP1 1 83284 1.20071E-5 41642 0 NA
2-236708034-A-G p.Leu275Leu synonymous AGAP1 1 83320 1.20019E-5 41660 0 8.26187E-6
2-236708042-A-G p.Tyr278Cys missense AGAP1 4 83324 4.80054E-5 41662 0 2.47476E-5
2-236708049-C-A p.Ser280Ser synonymous AGAP1 2 83350 2.39952E-5 41675 0 1.19304E-5
2-236708049-C-T p.Ser280Ser synonymous AGAP1 1 83350 1.19976E-5 41675 0 3.97681E-6
2-236708052-C-T p.Ser281Ser synonymous AGAP1 2 83358 2.39929E-5 41679 0 3.18512E-5
2-236708053-G-A p.Val282Ile missense AGAP1 1 83364 1.19956E-5 41682 0 1.64856E-5
2-236708058-A-G p.Pro283Pro synonymous AGAP1 21 83374 2.51877E-4 41687 1 0.0013926
2-236708069-G-A p.Ser287Asn missense AGAP1 2 83366 2.39906E-5 41683 0 NA
2-236708089-C-A p.Arg294Arg synonymous AGAP1 329 83378 0.00394589 41689 5 0.00713512
2-236708117-C-T p.Thr303Met missense AGAP1 3 83368 3.5985E-5 41684 0 2.47154E-5
2-236708118-G-A p.Thr303Thr synonymous AGAP1 1 83366 1.19953E-5 41683 0 8.23859E-6
2-236708118-G-T p.Thr303Thr synonymous AGAP1 1 83366 1.19953E-5 41683 0 1.64772E-5
2-236708123-C-T p.Thr305Met missense AGAP1 1 83366 1.19953E-5 41683 0 7.95317E-6
2-236708131-C-T p.Arg308Cys missense AGAP1 1 83366 1.19953E-5 41683 0 0.00100705
2-236708138-A-G p.Gln310Arg missense AGAP1 13 83354 1.55961E-4 41677 0 9.55414E-5
2-236708138-A-C p.Gln310Pro missense AGAP1 1 83354 1.1997E-5 41677 0 3.18471E-5
2-236708149-C-A p.Arg314Arg synonymous AGAP1 1 83352 1.19973E-5 41676 0 NA
2-236708156-A-G p.Asn316Ser missense AGAP1 1 83342 1.19988E-5 41671 0 NA
2-236708166-C-T p.Thr319Thr splice_region+synonymous AGAP1 20853 82664 0.252262 41332 2853 0.286817
2-236715883-T-C p.Ser320Pro missense+splice_region AGAP1 39 83230 4.68581E-4 41615 0 4.13598E-4
2-236715898-G-A p.Asp325Asn missense AGAP1 1 83292 1.2006E-5 41646 0 NA
2-236715907-A-C p.Lys328Gln missense AGAP1 85 83314 0.00102024 41657 0 0.00352467
2-236715918-A-G p.Lys331Lys synonymous AGAP1 4 83310 4.80134E-5 41655 0 1.65363E-5
2-236715922-C-CTGG p.Leu333_Glu334insVal disruptive_inframe_insertion AGAP1 1 83304 1.20042E-5 41652 0 6.36862E-5
2-236715927-G-A p.Glu334Glu synonymous AGAP1 1 83306 1.20039E-5 41653 0 NA
2-236715931-C-A p.Arg336Ser missense AGAP1 1 83300 1.20048E-5 41650 0 NA
2-236715932-G-A p.Arg336His missense AGAP1 1 83284 1.20071E-5 41642 0 4.13319E-5
2-236715935-C-T p.Ala337Val missense AGAP1 1 83290 1.20062E-5 41645 0 8.29986E-6
2-236715944-T-C p.Ile340Thr missense AGAP1 5 83248 6.00615E-5 41624 0 2.94182E-5
2-236715951-C-T p.Ser342Ser synonymous AGAP1 28 83220 3.36458E-4 41610 0 7.00726E-4
2-236715952-G-A p.Gly343Ser missense AGAP1 1 83214 1.20172E-5 41607 0 8.26843E-6
2-236715960-C-T p.Ala345Ala synonymous AGAP1 1 83184 1.20215E-5 41592 0 8.26856E-6
2-236715967-A-G p.Ile348Val missense AGAP1 2 83166 2.40483E-5 41583 0 3.18492E-5
2-236715976-G-GGCATGCTGTTGAAGCGAAGTGGCAAATCGT c.1050+1_1050+2insGCATGCTGTTGAAGCGAAGTGGCAAATCGT splice_donor AGAP1 2 83082 2.40726E-5 41541 1 NA
2-236715978-G-A c.1050+3G>A splice_region AGAP1 1 83086 1.20357E-5 41543 0 8.27842E-6
2-236761324-C-A c.1051-6C>A splice_region AGAP1 1 76456 1.30794E-5 38228 0 NA
2-236761328-A-T c.1051-2A>T splice_acceptor AGAP1 67 76604 8.74628E-4 38302 0 0.00124259
2-236761334-T-C p.Leu352Pro missense AGAP1 1 76838 1.30144E-5 38419 0 NA
2-236761341-C-T p.Phe354Phe synonymous AGAP1 1 76978 1.29907E-5 38489 0 NA
2-236761344-T-C p.Phe355Phe synonymous AGAP1 1 76980 1.29904E-5 38490 0 NA
2-236761345-G-T p.Val356Phe missense AGAP1 4 77112 5.18726E-5 38556 0 7.11238E-4
2-236761359-A-C p.Thr360Thr synonymous AGAP1 2 77242 2.58926E-5 38621 0 NA
2-236761366-A-G p.Thr363Ala missense AGAP1 1 77306 1.29356E-5 38653 0 NA
2-236761370-A-G p.Tyr364Cys missense AGAP1 160 77338 0.00206884 38669 0 0.00280469
2-236761372-C-A p.Leu365Ile missense AGAP1 1 77380 1.29232E-5 38690 0 7.20731E-6
2-236761374-C-G p.Leu365Leu synonymous AGAP1 1 77374 1.29242E-5 38687 0 1.59357E-4
2-236761381-G-A p.Ala368Thr missense AGAP1 1 77382 1.29229E-5 38691 0 NA
2-236761385-G-A p.Gly369Glu missense AGAP1 1 77368 1.29252E-5 38684 0 NA
2-236761390-C-G p.Arg371Gly missense AGAP1 1 77346 1.29289E-5 38673 0 NA
2-236761390-C-T p.Arg371Cys missense AGAP1 1 77346 1.29289E-5 38673 0 7.24092E-6
2-236761391-G-A p.Arg371His missense AGAP1 9 77352 1.16351E-4 38676 0 4.0464E-4
2-236761393-G-T p.Ala372Ser missense AGAP1 20 77352 2.58558E-4 38676 0 1.51956E-4
2-236761395-C-T p.Ala372Ala synonymous AGAP1 2 77354 2.58552E-5 38677 0 7.24354E-6
2-236761396-C-T p.Arg373Cys missense AGAP1 39171 76594 0.511411 38297 10763 0.585625
2-236761396-CGTC-TATG p.ArgGln373TyrGlu missense AGAP1 1 77356 1.29272E-5 38678 0 NA
2-236761397-G-A p.Arg373His missense AGAP1 1 77352 1.29279E-5 38676 0 NA
2-236761400-A-G p.Gln374Arg missense AGAP1 2 77348 2.58572E-5 38674 0 3.23687E-5
2-236761408-C-G p.Pro377Ala missense AGAP1 5 77374 6.46212E-5 38687 0 3.62247E-4
2-236761410-CT-C p.Trp378fs frameshift AGAP1 2 77354 2.58552E-5 38677 0 NA
2-236761411-T-C p.Trp378Arg missense AGAP1 1 77338 1.29303E-5 38669 0 NA
2-236761414-C-CCAGG p.Pro381fs frameshift AGAP1 12278 77148 0.159149 38574 1106 0.208754
2-236761421-C-T p.Pro381Leu missense AGAP1 2 77230 2.58967E-5 38615 0 9.64735E-5
2-236761421-C-A p.Pro381Gln missense AGAP1 1 77230 1.29483E-5 38615 0 1.48421E-5
2-236761422-G-A p.Pro381Pro synonymous AGAP1 2 77228 2.58973E-5 38614 0 6.45782E-5
2-236761423-A-G p.Arg382Gly missense AGAP1 1 77232 1.2948E-5 38616 0 NA
2-236761424-G-T p.Arg382Met missense AGAP1 2 77244 2.5892E-5 38622 0 NA
2-236761426-G-A p.Gly383Ser missense AGAP1 2 77246 2.58913E-5 38623 0 NA
2-236761434-G-C p.Gln385His missense AGAP1 3 77172 3.88742E-5 38586 0 7.26617E-6
2-236761442-C-T p.Pro388Leu missense AGAP1 8 77166 1.03673E-4 38583 0 7.38662E-5
2-236761443-G-A p.Pro388Pro synonymous AGAP1 5 77128 6.48273E-5 38564 0 2.26149E-5
2-236761443-GCATTGTGCTGAAGGCCCA-G p.His389_Pro394del disruptive_inframe_deletion AGAP1 1 77128 1.29655E-5 38564 0 NA
2-236761445-A-G p.His389Arg missense AGAP1 2 77136 2.59282E-5 38568 0 1.48732E-5
2-236761450-G-A p.Ala391Thr missense AGAP1 1 77096 1.29708E-5 38548 0 NA
2-236761461-A-G p.Pro394Pro synonymous AGAP1 1 76926 1.29995E-5 38463 0 NA
2-236761469-CCCAGCTGTCCGGGGCCATGATGAA-C p.Gln398_Asn405del disruptive_inframe_deletion AGAP1 1 76820 1.30174E-5 38410 0 NA
2-236761471-C-T p.Gln398* stop_gained AGAP1 1 76870 1.3009E-5 38435 0 3.1841E-5
2-236761472-A-G p.Gln398Arg missense AGAP1 1 76874 1.30083E-5 38437 0 NA
2-236761479-C-T p.Ser400Ser synonymous AGAP1 1 76580 1.30582E-5 38290 0 9.59859E-6
2-236761480-G-A p.Gly401Arg missense AGAP1 18 76562 2.35104E-4 38281 0 2.54777E-4
2-236761481-G-A p.Gly401Glu missense AGAP1 1 76544 1.30644E-5 38272 0 NA
2-236761485-C-G p.Ala402Ala synonymous AGAP1 1 76356 1.30965E-5 38178 0 NA
2-236761486-A-G p.Met403Val missense AGAP1 2 76280 2.62192E-5 38140 0 NA
2-236791985-G-A c.1051-4G>A splice_region AGAP1 1 83204 1.20187E-5 41602 0 NA
2-236791996-T-C p.Leu353Pro missense AGAP1 1 83260 1.20106E-5 41630 0 NA
2-236792005-G-A p.Arg356Gln missense AGAP1 4 83274 4.80342E-5 41637 0 4.37553E-5
2-236792012-C-T p.Gly358Gly synonymous AGAP1 2 83290 2.40125E-5 41645 0 NA
2-236792015-A-G p.Lys359Lys synonymous AGAP1 1 83304 1.20042E-5 41652 0 0.00100705
2-236792030-G-A p.Glu364Glu synonymous AGAP1 3 83328 3.60023E-5 41664 0 1.59076E-5
2-236792045-T-C p.Tyr369Tyr synonymous AGAP1 2 83334 2.39998E-5 41667 0 3.97681E-6
2-236792066-C-T p.Gly376Gly synonymous AGAP1 3 83308 3.60109E-5 41654 0 6.25E-4
2-236792067-G-A p.Val377Met missense AGAP1 8 83306 9.60315E-5 41653 0 4.94226E-5
2-236792067-G-T p.Val377Leu missense AGAP1 1 83306 1.20039E-5 41653 0 NA
2-236792077-A-G p.Tyr380Cys missense AGAP1 1 83284 1.20071E-5 41642 0 3.18451E-5
2-236792083-C-G p.Pro382Arg missense AGAP1 1 83266 1.20097E-5 41633 0 NA
2-236792100-A-G c.1155+7A>G splice_region AGAP1 1 83160 1.2025E-5 41580 0 7.97563E-6
2-236817397-G-C p.Val391Leu missense AGAP1 1 83334 1.19999E-5 41667 0 3.21792E-5
2-236817402-T-C p.His392His synonymous AGAP1 3 83340 3.59971E-5 41670 0 0.00125
2-236817408-G-A p.Lys394Lys synonymous AGAP1 2 83346 2.39964E-5 41673 0 1.31475E-4
2-236817413-T-C p.Ile396Thr missense AGAP1 3 83356 3.59902E-5 41678 0 2.788E-5
2-236817429-C-G p.Thr401Thr synonymous AGAP1 2 83352 2.39946E-5 41676 0 6.36669E-5
2-236817444-A-G p.Pro406Pro synonymous AGAP1 41 83354 4.91878E-4 41677 0 0.001595
2-236817456-A-G p.Pro410Pro synonymous AGAP1 1 83340 1.1999E-5 41670 0 NA
2-236817457-C-G p.Pro411Ala missense AGAP1 1 83348 1.19979E-5 41674 0 NA
2-236817461-G-A p.Arg412Gln missense AGAP1 1 83346 1.19982E-5 41673 0 8.25546E-6
2-236817467-C-T p.Thr414Met missense AGAP1 2 83358 2.39929E-5 41679 0 3.18674E-5
2-236817468-G-A p.Thr414Thr synonymous AGAP1 11 83362 1.31955E-4 41681 0 9.56389E-5
2-236817474-C-T p.Ala416Ala synonymous AGAP1 1 83360 1.19962E-5 41680 0 1.19302E-5
2-236817477-C-T p.Cys417Cys synonymous AGAP1 7 83362 8.39711E-5 41681 0 3.29554E-5
2-236817478-G-T p.Ala418Ser missense AGAP1 7 83364 8.39691E-5 41682 0 3.18756E-5
2-236817478-G-A p.Ala418Thr missense AGAP1 4 83364 4.79823E-5 41682 0 2.47166E-5
2-236817506-G-A p.Gly427Asp missense AGAP1 1 83368 1.1995E-5 41684 0 3.97693E-6
2-236817510-A-G p.Leu428Leu synonymous AGAP1 3 83360 3.59885E-5 41680 0 NA
2-236817513-C-T p.Ser429Ser synonymous AGAP1 4 83360 4.79846E-5 41680 0 3.97766E-6
2-236817522-G-A p.Met432Ile missense AGAP1 1 83362 1.19959E-5 41681 0 1.64875E-5
2-236817533-A-G p.His436Arg missense AGAP1 16 83350 1.91962E-4 41675 0 5.03525E-4
2-236817534-C-T p.His436His synonymous AGAP1 1 83354 1.1997E-5 41677 0 3.18695E-5
2-236839409-G-T p.Gly442Val missense+splice_region AGAP1 1 83082 1.20363E-5 41541 0 NA
2-236839441-G-A p.Ala453Thr missense AGAP1 17 83184 2.04366E-4 41592 0 0.00125
2-236839446-C-A p.Ser454Arg missense AGAP1 1 83186 1.20213E-5 41593 0 NA
2-236839455-C-G p.Ser457Arg missense AGAP1 1 83198 1.20195E-5 41599 0 NA
2-236839457-T-C p.Leu458Pro missense AGAP1 4 83196 4.80792E-5 41598 0 7.95703E-6
2-236839470-C-A p.Asn462Lys missense AGAP1 2 83186 2.40425E-5 41593 0 3.97867E-6
2-236839475-G-A p.Arg464Gln missense AGAP1 20 83164 2.40489E-4 41582 0 0.005
2-236839479-C-T p.Pro465Pro synonymous AGAP1 2 83166 2.40483E-5 41583 0 3.29946E-5
2-236839480-G-A p.Asp466Asn missense AGAP1 3 83160 3.6075E-5 41580 0 1.64967E-5
2-236839482-C-T p.Asp466Asp synonymous AGAP1 2 83142 2.40552E-5 41571 0 3.18613E-5
2-236839483-G-A p.Gly467Ser missense AGAP1 5 83136 6.01424E-5 41568 0 0.00100705
2-236839484-G-A p.Gly467Asp missense AGAP1 1 83132 1.20291E-5 41566 0 NA
2-236839496-G-A p.Arg471His missense AGAP1 3 83100 3.61011E-5 41550 0 8.25151E-6
2-236839502-A-G p.Tyr473Cys missense AGAP1 2 83106 2.40657E-5 41553 1 NA
2-236839505-C-T p.Ser474Leu missense AGAP1 1 83104 1.20331E-5 41552 0 NA
2-236839506-A-G p.Ser474Ser synonymous AGAP1 25 83098 3.0085E-4 41549 0 0.00100705
2-236839517-C-T p.Ala478Val missense AGAP1 2 83026 2.40888E-5 41513 0 NA
2-236839519-G-A p.Asp479Asn missense AGAP1 2 83020 2.40906E-5 41510 0 2.39011E-5
2-236839526-G-A p.Trp481* stop_gained AGAP1 1 82976 1.20517E-5 41488 0 NA
2-236839538-C-T p.Thr485Met missense AGAP1 1 82796 1.20779E-5 41398 0 3.1841E-5
2-236839539-G-A p.Thr485Thr synonymous AGAP1 6 82760 7.24988E-5 41380 0 3.18451E-5
2-236839540-G-T p.Val486Phe missense AGAP1 3 82736 3.62599E-5 41368 0 6.25E-4
2-236839546-G-C p.Ala488Pro missense AGAP1 12 82622 1.4524E-4 41311 0 5.03525E-4
2-236839554-G-A p.Ser490Ser synonymous AGAP1 2 82406 2.42701E-5 41203 0 3.18532E-5
2-236839557-C-T p.Ala491Ala synonymous AGAP1 1 82324 1.21471E-5 41162 0 NA
2-236839559-T-C p.Ile492Thr missense AGAP1 2 82246 2.43173E-5 41123 0 NA
2-236839574-G-C c.1483+7G>C splice_region AGAP1 1 81728 1.22357E-5 40864 0 NA
2-236877099-A-G c.1484-7A>G splice_region AGAP1 6 82382 7.28314E-5 41191 0 9.95685E-5
2-236877125-C-T p.Ser501Ser synonymous AGAP1 1 82784 1.20796E-5 41392 0 3.24781E-5
2-236877126-G-A p.Val502Ile missense AGAP1 5 82790 6.03938E-5 41395 0 0.00201613
2-236877134-C-T p.Ser504Ser synonymous AGAP1 1 82956 1.20546E-5 41478 0 NA
2-236877146-C-A p.Ile508Ile synonymous AGAP1 1 83054 1.20404E-5 41527 0 NA
2-236877158-C-T p.Thr512Thr synonymous AGAP1 1 83080 1.20366E-5 41540 0 NA
2-236877170-C-A p.Leu516Leu synonymous AGAP1 7 82448 8.4902E-5 41224 0 1.44368E-4
2-236877170-C-CGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG p.Asp517fs frameshift AGAP1 1 82456 1.21277E-5 41228 0 NA
2-236877171-G-A p.Asp517Asn missense AGAP1 2 81868 2.44296E-5 40934 0 1.93945E-5
2-236877171-G-C p.Asp517His missense AGAP1 1 81854 1.22169E-5 40927 0 0.0589718
2-236877175-C-T p.Pro518Leu missense AGAP1 9 81414 1.10546E-4 40707 0 1.51504E-4
2-236877175-C-G p.Pro518Arg missense AGAP1 1 81414 1.22829E-5 40707 0 8.33556E-6
2-236877176-G-T p.Pro518Pro synonymous AGAP1 1 81220 1.23122E-5 40610 0 NA
2-236877177-C-T p.Pro519Ser missense AGAP1 1 81534 1.22648E-5 40767 0 8.32002E-6
2-236877180-C-G p.Pro520Ala missense AGAP1 10 81696 1.22405E-4 40848 0 7.10707E-5
2-236877181-C-G p.Pro520Arg missense AGAP1 21 81740 2.56912E-4 40870 0 0.00352467
2-236877187-C-T p.Pro522Leu missense AGAP1 1 82084 1.21826E-5 41042 0 NA
2-236877191-C-T p.His523His synonymous AGAP1 2 82026 2.43825E-5 41013 0 2.40361E-4
2-236877193-C-G p.Ala524Gly missense AGAP1 1 82158 1.21717E-5 41079 0 NA
2-236877200-A-G p.Arg526Arg synonymous AGAP1 1 82496 1.21218E-5 41248 0 NA
2-236877209-C-T p.His529His synonymous AGAP1 1 82650 1.20992E-5 41325 0 8.26815E-6
2-236877230-C-T p.Ser536Ser synonymous AGAP1 1 82956 1.20546E-5 41478 0 NA
2-236877237-A-G p.Lys539Glu missense AGAP1 3 82950 3.61664E-5 41475 0 1.65514E-5
2-236877245-C-T p.Asp541Asp synonymous AGAP1 1 82904 1.20621E-5 41452 0 3.23185E-5
2-236877246-G-A p.Gly542Ser missense AGAP1 20 82912 2.4122E-4 41456 0 2.13257E-4
2-236877250-T-C p.Leu543Pro missense AGAP1 2 82946 2.41121E-5 41473 0 NA
2-236877251-G-C p.Leu543Leu synonymous AGAP1 2 82950 2.41109E-5 41475 0 4.14539E-5
2-236877254-C-T p.Ser544Ser synonymous AGAP1 4 82938 4.82288E-5 41469 0 6.88661E-5
2-236877255-G-A p.Gly545Ser missense AGAP1 31 82966 3.73647E-4 41483 0 0.00151057
2-236877255-G-C p.Gly545Arg missense AGAP1 2 82966 2.41063E-5 41483 0 8.29476E-6
2-236923441-G-T c.227-8G>T splice_region AGAP1 1 52978 1.88758E-5 26489 0 7.74114E-6
2-236923455-G-A p.Arg78His missense AGAP1 11 53072 2.07266E-4 26536 0 2.61886E-4
2-236923460-G-A p.Ala80Thr missense AGAP1 1 53090 1.88359E-5 26545 0 NA
2-236923481-G-A p.Gly87Ser missense AGAP1 3 53018 5.65846E-5 26509 0 NA
2-236923483-T-C p.Gly87Gly synonymous AGAP1 1 53028 1.8858E-5 26514 0 NA
2-236923487-C-T p.Leu89Leu synonymous AGAP1 4 53014 7.54518E-5 26507 0 1.40272E-4
2-236923489-G-A p.Leu89Leu synonymous AGAP1 1 52988 1.88722E-5 26494 0 NA
2-236923491-G-A p.Arg90Gln missense AGAP1 1 52992 1.88708E-5 26496 0 NA
2-236923529-G-A c.301+6G>A splice_region AGAP1 1 52526 1.90382E-5 26263 0 NA
2-236945206-A-G p.Glu549Glu splice_region+synonymous AGAP1 1 82334 1.21457E-5 41167 0 3.18329E-5
2-236945208-A-C p.Gln550Pro missense AGAP1 1 82388 1.21377E-5 41194 0 NA
2-236945233-T-A p.Ile558Ile synonymous AGAP1 1 82852 1.20697E-5 41426 0 NA
2-236945246-G-A p.Gly563Ser missense AGAP1 1 83080 1.20366E-5 41540 0 3.18309E-5
2-236945248-C-G p.Gly563Gly synonymous AGAP1 1 83102 1.20334E-5 41551 0 NA
2-236945254-A-G p.Thr565Thr synonymous AGAP1 2 83166 2.40483E-5 41583 0 8.2371E-6
2-236945255-T-C p.Trp566Arg missense AGAP1 4 83164 4.80977E-5 41582 0 3.97649E-6
2-236945268-C-G p.Ala570Gly missense AGAP1 2 83250 2.4024E-5 41625 0 6.25E-4
2-236945271-C-T p.Thr571Met missense AGAP1 10 83248 1.20123E-4 41624 0 9.5511E-5
2-236945272-G-A p.Thr571Thr synonymous AGAP1 7 83258 8.4076E-5 41629 0 7.95305E-5
2-236945274-C-T p.Thr572Met missense AGAP1 11 83280 1.32085E-4 41640 0 6.25E-4
2-236945275-G-A p.Thr572Thr synonymous AGAP1 3 83282 3.60222E-5 41641 0 1.15317E-4
2-236945286-G-A p.Arg576Gln missense AGAP1 1 83304 1.20042E-5 41652 0 7.95305E-6
2-236945289-A-G p.Asp577Gly missense AGAP1 3 83318 3.60066E-5 41659 0 8.23832E-6
2-236945290-C-G p.Asp577Glu missense AGAP1 2 83316 2.4005E-5 41658 0 8.23845E-6
2-236945290-C-T p.Asp577Asp synonymous AGAP1 1 83316 1.20025E-5 41658 0 0.00125
2-236945291-G-A p.Ala578Thr missense AGAP1 1 83320 1.20019E-5 41660 0 8.23845E-6
2-236945302-A-G p.Gln581Gln synonymous AGAP1 5 83316 6.00125E-5 41658 0 6.3678E-5
2-236945306-A-C p.Ile583Leu missense AGAP1 1 83312 1.20031E-5 41656 0 NA
2-236945308-C-T p.Ile583Ile synonymous AGAP1 8 83302 9.60361E-5 41651 0 9.06544E-5
2-236945309-G-A p.Glu584Lys missense AGAP1 3 83308 3.60109E-5 41654 0 6.3678E-5
2-236945313-G-A p.Ser585Asn missense AGAP1 1 83310 1.20034E-5 41655 0 NA
2-236945336-T-G p.Ser593Ala missense AGAP1 2 83232 2.40292E-5 41616 0 3.18613E-5
2-236945338-G-A p.Ser593Ser synonymous AGAP1 5 83222 6.00803E-5 41611 0 2.22816E-4
2-236945341-C-T p.Cys252Cys splice_region+synonymous AGAP1 6 83198 7.21171E-5 41599 0 1.59256E-4
2-236949387-G-A c.1801-8G>A splice_region AGAP1 1 82598 1.21068E-5 41299 0 3.18388E-5
2-236949388-T-C c.1801-7T>C splice_region AGAP1 1 82630 1.21021E-5 41315 0 1.56913E-4
2-236949398-C-T p.Arg602Trp missense AGAP1 2 82708 2.41815E-5 41354 0 8.25042E-6
2-236949405-C-T p.Thr604Met missense AGAP1 1 82796 1.20779E-5 41398 0 3.18654E-5
2-236949406-G-A p.Thr604Thr synonymous AGAP1 1 82812 1.20755E-5 41406 0 3.18593E-5
2-236949408-G-A p.Ser605Asn missense AGAP1 2 82852 2.41394E-5 41426 0 NA
2-236949414-G-A p.Ser607Asn missense AGAP1 1 82916 1.20604E-5 41458 0 3.977E-6
2-236949415-C-T p.Ser607Ser synonymous AGAP1 4 82922 4.82381E-5 41461 0 1.27453E-4
2-236949436-G-C p.Ser614Ser synonymous AGAP1 2 83186 2.40425E-5 41593 0 NA
2-236949449-C-T p.Arg619Cys missense AGAP1 2 83266 2.40194E-5 41633 0 5.04032E-4
2-236949450-G-A p.Arg619His missense AGAP1 4 83268 4.80377E-5 41634 0 6.37064E-5
2-236949451-C-T p.Arg619Arg synonymous AGAP1 2 83268 2.40188E-5 41634 0 6.59141E-5
2-236949475-C-T p.Cys627Cys synonymous AGAP1 4 83298 4.80204E-5 41649 0 5.03525E-4
2-236949476-G-A p.Glu628Lys missense AGAP1 4 83304 4.80169E-5 41652 0 6.36943E-5
2-236949492-G-A c.1891+7G>A splice_region AGAP1 3 83278 3.60239E-5 41639 0 3.98181E-5
2-236954592-C-T p.Ser4Leu missense AGAP1 2 51844 3.85773E-5 25922 0 1.74277E-4
2-236954593-G-A p.Ser4Ser synonymous AGAP1 2 51834 3.85847E-5 25917 0 3.30837E-5
2-236954597-T-C p.Ser6Pro missense AGAP1 2 51832 3.85862E-5 25916 0 NA
2-236954599-C-T p.Ser6Ser synonymous AGAP1 1 51864 1.92812E-5 25932 0 1.27429E-4
2-236954601-G-A p.Gly7Asp missense AGAP1 3 51854 5.78547E-5 25927 0 5.75374E-5
2-236954615-C-T p.Pro12Ser missense AGAP1 2 51888 3.85446E-5 25944 0 9.55597E-5
2-236954619-C-T p.Thr13Met missense AGAP1 2 51900 3.85356E-5 25950 0 3.96558E-5
2-236954622-A-G p.His14Arg missense AGAP1 2 51880 3.85505E-5 25940 0 6.60877E-6
2-236954630-C-T p.Arg17Cys missense AGAP1 2 51722 3.86683E-5 25861 0 3.30574E-5
2-236954631-G-A p.Arg17His missense AGAP1 5 51676 9.67567E-5 25838 0 3.30552E-5
2-236954647-C-T p.Asp22Asp synonymous AGAP1 1 51540 1.94024E-5 25770 0 NA
2-236954663-C-T p.Leu28Leu synonymous AGAP1 438 51022 0.00858453 25511 3 0.008125
2-236954667-T-TG p.Asp32fs frameshift AGAP1 1 50834 1.96719E-5 25417 0 3.18817E-5
2-236954668-G-T p.Leu29Leu synonymous AGAP1 1 50828 1.96742E-5 25414 0 NA
2-236954668-G-A p.Leu29Leu synonymous AGAP1 2 50828 3.93484E-5 25414 0 3.18654E-5
2-236954669-G-A p.Gly30Arg missense AGAP1 1 50826 1.9675E-5 25413 0 NA
2-236954671-G-A p.Gly30Gly synonymous AGAP1 3 50742 5.91226E-5 25371 0 3.18613E-5
2-236954675-G-T p.Asp32Tyr missense+splice_region AGAP1 4 50554 7.91233E-5 25277 0 1.32917E-5
2-236954680-G-A c.94+5G>A splice_region AGAP1 1 50380 1.98491E-5 25190 0 6.64602E-6
2-236957698-C-T c.1892-5C>T splice_region AGAP1 5 83350 5.9988E-5 41675 0 1.27348E-4
2-236957699-G-A c.1892-4G>A splice_region AGAP1 4 83352 4.79893E-5 41676 0 9.23449E-4
2-236957710-C-G p.Asn633Lys missense AGAP1 3 83388 3.59764E-5 41694 0 3.18329E-5
2-236957710-C-A p.Asn633Lys missense AGAP1 1 83388 1.19921E-5 41694 0 1.19404E-5
2-236957734-C-T p.Ala641Ala synonymous AGAP1 1 83402 1.19901E-5 41701 0 3.1837E-5
2-236957737-C-T p.Leu642Leu synonymous AGAP1 1 83402 1.19901E-5 41701 0 NA
2-236957742-G-A p.Cys644Tyr missense AGAP1 1 83398 1.19907E-5 41699 0 NA
2-236957746-C-T p.Ile645Ile synonymous AGAP1 7 83400 8.39329E-5 41700 0 4.12181E-5
2-236957747-G-A p.Glu646Lys missense AGAP1 7 83404 8.39288E-5 41702 0 2.78365E-5
2-236957788-C-T p.Ser659Ser synonymous AGAP1 1 83400 1.19904E-5 41700 0 1.59052E-5
2-236957795-C-A p.Arg662Arg synonymous AGAP1 7 83400 8.39329E-5 41700 0 0.003125
2-236957796-G-A p.Arg662Gln missense AGAP1 1 83402 1.19901E-5 41701 0 3.1841E-5
2-236957807-C-T p.Leu666Leu synonymous AGAP1 111 83400 0.00133094 41700 0 0.00302471
2-236957820-CAG-GAA p.ProVal670ArgIle missense AGAP1 1 83396 1.1991E-5 41698 0 NA
2-236957822-G-A p.Val671Ile missense AGAP1 47987 83188 0.57685 41594 14514 0.651352
2-236957822-GTC-ATT p.Val671Ile missense AGAP1 1 83396 1.1991E-5 41698 0 NA
2-236957824-C-T p.Val671Val synonymous AGAP1 5 83396 5.99549E-5 41698 0 6.36943E-5
2-236957828-C-G p.Leu673Val missense AGAP1 2 83392 2.39831E-5 41696 0 3.97624E-6
2-236957828-C-T p.Leu673Phe missense AGAP1 1 83392 1.19916E-5 41696 0 9.54297E-5
2-236957851-C-T p.Ile680Ile synonymous AGAP1 3 83384 3.59781E-5 41692 0 1.59276E-4
2-236957858-G-A p.Glu683Lys missense AGAP1 3 83382 3.5979E-5 41691 0 2.47113E-5
2-236957858-G-T p.Glu683* stop_gained AGAP1 1 83382 1.1993E-5 41691 0 NA
2-236957861-C-G p.Leu684Val missense AGAP1 1 83386 1.19924E-5 41693 0 3.97643E-6
2-236957873-G-A p.Val688Ile missense AGAP1 7 83388 8.39449E-5 41694 0 1.59226E-4
2-236957892-A-T p.Gln694Leu missense AGAP1 1 83362 1.19959E-5 41681 0 NA
2-236957897-C-T p.Arg696Trp missense AGAP1 6 83338 7.1996E-5 41669 0 1.59276E-4
2-236957902-G-A p.Thr697Thr synonymous AGAP1 1 83304 1.20042E-5 41652 0 1.98938E-5
2-236957910-C-T p.Ser700Leu missense AGAP1 4 83284 4.80284E-5 41642 0 3.18552E-5
2-236957911-G-A p.Ser700Ser synonymous AGAP1 1 83254 1.20114E-5 41627 0 3.98048E-6
2-236957920-C-T p.Ser703Ser synonymous AGAP1 2 83170 2.40471E-5 41585 0 3.18451E-5
2-236957921-A-G p.Thr704Ala missense AGAP1 1 83156 1.20256E-5 41578 0 NA
2-236957933-C-T c.2114+8C>T splice_region AGAP1 45 82934 5.426E-4 41467 0 0.00197427
2-237028837-G-A p.Glu706Lys missense+splice_region AGAP1 4 83110 4.8129E-5 41555 0 NA
2-237028849-C-T p.Arg710Trp missense AGAP1 18 83112 2.16575E-4 41556 0 5.73139E-4
2-237028850-G-A p.Arg710Gln missense AGAP1 5 83126 6.01497E-5 41563 0 1.6042E-5
2-237028858-C-T p.Arg713Cys missense AGAP1 1 83122 1.20305E-5 41561 0 NA
2-237028860-T-G p.Arg713Arg synonymous AGAP1 1 83128 1.20296E-5 41564 0 NA
2-237028869-C-T p.Tyr716Tyr synonymous AGAP1 6 83098 7.22039E-5 41549 0 1.27405E-4
2-237028870-G-A p.Glu717Lys missense AGAP1 1 83092 1.20349E-5 41546 0 NA
2-237028888-G-T p.Ala275Ser missense+splice_region AGAP1 2 82976 2.41034E-5 41488 0 NA
2-237028892-C-T p.Pro724Leu missense AGAP1 2 82962 2.41074E-5 41481 0 1.19918E-5
2-237028905-G-A p.Thr728Thr synonymous AGAP1 4 82864 4.82719E-5 41432 0 7.20156E-5
2-237028907-A-G p.Glu729Gly missense AGAP1 2 82838 2.41435E-5 41419 0 NA
2-237028911-G-A p.Leu730Leu synonymous AGAP1 1 82786 1.20793E-5 41393 0 8.00673E-6
2-237028922-A-G p.Gln734Arg missense AGAP1 1 82684 1.20942E-5 41342 0 1.68393E-5
2-237028927-C-T p.Leu736Leu synonymous AGAP1 2 82654 2.41973E-5 41327 0 1.69156E-5
2-237028934-G-A p.Arg738Gln missense AGAP1 1 82530 1.21168E-5 41265 0 1.70181E-5
2-237028941-C-T p.Thr740Thr synonymous AGAP1 6 82546 7.26867E-5 41273 0 2.01392E-5
2-237028942-G-A p.Ala741Thr missense AGAP1 6 82532 7.26991E-5 41266 0 3.18492E-5
2-237028944-C-T p.Ala741Ala synonymous AGAP1 1 82560 1.21124E-5 41280 0 3.18492E-5
2-237028945-G-A p.Asp742Asn missense AGAP1 13 82546 1.57488E-4 41273 0 3.18431E-5
2-237028947-C-T p.Asp742Asp synonymous AGAP1 2 82504 2.42412E-5 41252 0 2.56274E-5
2-237028948-G-A p.Glu743Lys missense AGAP1 1 82536 1.21159E-5 41268 0 6.36983E-5
2-237028957-C-T p.Arg746Trp missense AGAP1 3 82456 3.6383E-5 41228 0 5.09684E-4
2-237028958-G-A p.Arg746Gln missense AGAP1 1 82410 1.21345E-5 41205 0 5.10204E-4
2-237028972-C-T p.Leu751Leu synonymous AGAP1 1 82296 1.21513E-5 41148 0 1.21023E-5
2-237028983-C-T p.His754His synonymous AGAP1 229 82158 0.00278731 41079 1 0.00228502
2-237028990-C-T p.Arg757Trp missense AGAP1 1 82020 1.21921E-5 41010 0 NA
2-237028991-G-T p.Arg757Leu missense AGAP1 4 82026 4.8765E-5 41013 0 3.4369E-5
2-237028991-G-A p.Arg757Gln missense AGAP1 1 82026 1.21913E-5 41013 0 1.71845E-5
2-237028992-G-A p.Arg757Arg synonymous AGAP1 1 82030 1.21907E-5 41015 0 NA
2-237028995-C-T p.Asp758Asp synonymous AGAP1 118 81956 0.0014398 40978 0 0.00315367
2-237028995-C-G p.Asp758Glu missense AGAP1 1 81958 1.22014E-5 40979 0 4.04018E-6
2-237028996-G-A p.Glu759Lys missense AGAP1 1 81972 1.21993E-5 40986 0 8.59284E-6
2-237028998-G-A p.Glu759Glu synonymous AGAP1 3 81976 3.65961E-5 40988 0 4.03711E-6
2-237028999-G-T p.Val760Leu missense AGAP1 1 81916 1.22076E-5 40958 0 NA
2-237029004-C-T p.Asn761Asn synonymous AGAP1 1 81856 1.22166E-5 40928 0 7.68161E-5
2-237029005-G-A p.Glu762Lys missense AGAP1 7 81844 8.55286E-5 40922 0 3.18323E-4
2-237029013-C-T p.Cys764Cys synonymous AGAP1 4 81610 4.90136E-5 40805 0 8.61415E-6
2-237029013-C-G p.Cys764Trp missense AGAP1 1 81610 1.22534E-5 40805 0 4.04835E-6
2-237029014-G-A p.Gly765Arg missense AGAP1 2 81650 2.44948E-5 40825 0 9.71086E-5
2-237029019-G-T p.Glu766Asp missense AGAP1 1 81554 1.22618E-5 40777 0 NA
2-237029025-C-T p.Asp768Asp synonymous AGAP1 2 81268 2.46099E-5 40634 0 6.37471E-5
2-237029025-C-G p.Asp768Glu missense AGAP1 1 81268 1.2305E-5 40634 0 NA
2-237029026-G-A p.Gly769Ser missense AGAP1 3 81228 3.69331E-5 40614 0 9.56206E-5
2-237029029-C-T p.Arg770Cys missense AGAP1 28 81148 3.45049E-4 40574 0 3.18715E-4
2-237029030-G-C p.Arg770Pro missense AGAP1 1 81082 1.23332E-5 40541 0 8.64319E-6
2-237029030-G-A p.Arg770His missense AGAP1 1 81082 1.23332E-5 40541 0 6.37389E-5
2-237029030-G-T p.Arg770Leu missense AGAP1 1 81082 1.23332E-5 40541 0 NA
2-237029033-C-T p.Thr771Met missense AGAP1 2 81010 2.46883E-5 40505 0 1.21764E-5
2-237029034-G-A p.Thr771Thr synonymous AGAP1 108 80992 0.00133346 40496 2 0.00149748
2-237029034-G-C p.Thr771Thr synonymous AGAP1 2 80992 2.46938E-5 40496 0 8.63289E-6
2-237029036-C-T p.Ala772Val missense AGAP1 3 80930 3.70691E-5 40465 0 NA
2-237029037-G-A p.Ala772Ala synonymous AGAP1 21 80850 2.5974E-4 40425 0 1.13723E-4
2-237029043-T-C p.His774His synonymous AGAP1 1 80750 1.23839E-5 40375 0 NA
2-237029048-C-T p.Ala776Val missense AGAP1 2 80640 2.48016E-5 40320 0 8.63215E-6
2-237029053-C-T p.Arg778Cys missense AGAP1 2 80462 2.48565E-5 40231 0 2.02899E-5
2-237029070-C-T p.Val783Val synonymous AGAP1 1 79840 1.2525E-5 39920 0 NA
2-237029075-C-T p.Ala785Val missense AGAP1 1 79550 1.25707E-5 39775 0 6.37064E-5
2-237029076-G-A p.Ala785Ala synonymous AGAP1 8 79530 1.00591E-4 39765 0 0.00125
2-237029083-C-T p.Leu788Leu synonymous AGAP1 1 79324 1.26065E-5 39662 0 8.64887E-6
2-237032558-C-T c.2371-5C>T splice_region AGAP1 3 81436 3.68387E-5 40718 0 8.33542E-6
2-237032559-G-T c.2371-4G>T splice_region AGAP1 5 81440 6.13949E-5 40720 0 1.66672E-5
2-237032559-G-A c.2371-4G>A splice_region AGAP1 1 81440 1.2279E-5 40720 0 1.66672E-5
2-237032559-G-C c.2371-4G>C splice_region AGAP1 3 81440 3.68369E-5 40720 0 3.99096E-6
2-237032565-C-T p.Tyr791Tyr splice_region+synonymous AGAP1 2 81710 2.44768E-5 40855 0 2.79107E-5
2-237032566-G-A p.Gly792Arg missense AGAP1 5 81750 6.11621E-5 40875 0 0.003125
2-237032574-C-T p.Asp794Asp synonymous AGAP1 895 81938 0.0109229 40969 21 0.0330843
2-237032575-G-C p.Val795Leu missense AGAP1 8 82060 9.74896E-5 41030 0 8.30551E-6
2-237032575-G-A p.Val795Ile missense AGAP1 3 82060 3.65586E-5 41030 0 9.55718E-5
2-237032577-C-T p.Val795Val synonymous AGAP1 1 82124 1.21767E-5 41062 0 3.98327E-6
2-237032579-C-T p.Thr796Met missense AGAP1 32 82168 3.89446E-4 41084 0 0.0021322
2-237032580-G-A p.Thr796Thr synonymous AGAP1 2 82178 2.43374E-5 41089 0 5.33049E-4
2-237032583-C-T p.Ala797Ala synonymous AGAP1 7 82268 8.50878E-5 41134 0 1.59297E-4
2-237032584-C-G p.Arg798Gly missense AGAP1 2 82302 2.43007E-5 41151 0 8.29421E-6
2-237032585-G-A p.Arg798Gln missense AGAP1 46 82314 5.58836E-4 41157 0 3.58349E-4
2-237032593-C-T p.His801Tyr missense AGAP1 1 82492 1.21224E-5 41246 0 1.07712E-4
2-237032593-C-A p.His801Asn missense AGAP1 1 82492 1.21224E-5 41246 0 NA
2-237032595-C-T p.His801His synonymous AGAP1 1 82510 1.21197E-5 41255 0 4.14209E-5
2-237032596-G-A p.Gly802Arg missense AGAP1 1 82520 1.21183E-5 41260 0 3.31329E-5
2-237032607-T-G p.Ala805Ala synonymous AGAP1 23545 82096 0.286798 41048 3984 0.376176
2-237032607-T-A p.Ala805Ala synonymous AGAP1 1 82652 1.20989E-5 41326 0 8.26966E-6
2-237032616-C-T p.Tyr808Tyr synonymous AGAP1 4 82728 4.83512E-5 41364 0 5.17429E-5
2-237032617-G-T p.Ala809Ser missense AGAP1 9 82714 1.08809E-4 41357 0 6.37267E-5
2-237032620-C-T p.Arg810Trp missense AGAP1 1 82770 1.20817E-5 41385 0 8.26651E-6
2-237032620-C-G p.Arg810Gly missense AGAP1 1 82770 1.20817E-5 41385 0 NA
2-237032621-G-A p.Arg810Gln missense AGAP1 1 82794 1.20782E-5 41397 0 3.18695E-5
2-237032647-G-A p.Asp819Asn missense AGAP1 1 82986 1.20502E-5 41493 0 6.25E-4
2-237032650-G-A p.Val820Met missense AGAP1 1 83004 1.20476E-5 41502 0 3.30513E-5
2-237032655-G-A p.Leu821Leu synonymous AGAP1 1 83008 1.2047E-5 41504 0 3.18634E-5
2-237032661-G-A p.Gln823Gln synonymous AGAP1 1 83002 1.20479E-5 41501 0 8.26269E-6
2-237032664-C-T p.Tyr824Tyr synonymous AGAP1 3 82972 3.61568E-5 41486 0 3.98159E-5
2-237032665-G-A p.Gly825Ser missense AGAP1 4 82984 4.82021E-5 41492 0 8.26474E-6
2-237032667-C-T p.Gly825Gly synonymous AGAP1 1 83000 1.20482E-5 41500 0 3.18654E-5
2-237032670-C-T p.Cys826Cys synonymous AGAP1 72 82966 8.67825E-4 41483 3 0.00404866
2-237032671-C-T p.Pro827Ser missense AGAP1 35 82982 4.21778E-4 41491 0 0.00756811
2-237032673-C-T p.Pro827Pro synonymous AGAP1 1 82986 1.20502E-5 41493 0 8.26323E-6
2-237032674-G-A p.Asp828Asn missense AGAP1 3 82964 3.61603E-5 41482 0 5.05051E-4
2-237032676-C-T p.Asp828Asp synonymous AGAP1 1 82964 1.20534E-5 41482 0 8.26323E-6
2-237032677-G-T p.Glu829* stop_gained AGAP1 1 82960 1.2054E-5 41480 0 NA
2-237032679-G-A p.Glu829Glu synonymous AGAP1 138 82970 0.00166325 41485 0 0.00252525
2-237032680-C-G p.Arg830Gly missense AGAP1 1 82942 1.20566E-5 41471 0 NA
2-237032681-G-A p.Arg830His missense AGAP1 3 82932 3.61742E-5 41466 0 6.25E-4
2-237032686-G-A p.Val832Met missense AGAP1 8 82932 9.64646E-5 41466 0 7.35306E-4
2-237032691-C-T p.Leu833Leu synonymous AGAP1 1 82946 1.2056E-5 41473 0 NA
2-237032697-C-T p.Ala835Ala synonymous AGAP1 1 82906 1.20619E-5 41453 0 1.19362E-5
2-237032703-T-C p.Pro837Pro synonymous AGAP1 24386 82408 0.295918 41204 4364 0.395165
2-237032703-TAA-CAG p.ProAsn837ProSer missense AGAP1 2 82916 2.41208E-5 41458 0 NA
2-237032705-A-G p.Asn838Ser missense AGAP1 1 82900 1.20627E-5 41450 0 5.96815E-5
2-237032709-G-A p.Leu839Leu synonymous AGAP1 1 82884 1.20651E-5 41442 0 3.18573E-5
2-237032712-C-G p.Ser840Ser synonymous AGAP1 1 82878 1.20659E-5 41439 0 NA
2-237032723-A-G p.Asn844Ser missense AGAP1 1 82832 1.20726E-5 41416 0 2.23058E-4
2-237032728-C-T p.Arg846Trp missense AGAP1 4 82724 4.83536E-5 41362 0 6.37389E-5
2-237032729-G-A p.Arg846Gln missense AGAP1 1 82728 1.20878E-5 41364 0 3.18796E-5
2-237032734-A-G p.Asn848Asp missense AGAP1 2 82674 2.41914E-5 41337 0 3.98137E-6
2-237032739-C-T p.Ser849Ser synonymous AGAP1 1 82602 1.21062E-5 41301 0 3.18735E-5
2-237032752-C-A p.Pro854Thr missense AGAP1 13 82468 1.57637E-4 41234 0 8.44053E-5
2-237034124-A-G c.*1358A>G splice_region AGAP1 4 34502 1.15935E-4 17251 0 9.55292E-5