Variant

Variant ID Consequence Effect Gene AC AN AF NS NHOM maxEAF
17-76183413-A-G c.-39A>G 5_prime_UTR_premature_start_codon_gain AFMID 1 81944 1.22035E-5 40972 0 1.65101E-5
17-76183455-A-G p.Met2Val missense AFMID 1 82956 1.20546E-5 41478 0 NA
17-76183465-CTGGTGTGGGTTTCCCAA-C p.Gly6fs frameshift AFMID 1 83012 1.20465E-5 41506 0 3.20369E-5
17-76183467-G-C p.Gly6Arg missense AFMID 1 83028 1.20441E-5 41514 0 NA
17-76183475-T-A p.Gly8Gly synonymous AFMID 1 82936 1.20575E-5 41468 0 NA
17-76183476-T-G p.Phe9Val missense AFMID 1 83004 1.20476E-5 41502 0 1.59079E-5
17-76183481-A-G p.Pro10Pro synonymous AFMID 3 82986 3.61507E-5 41493 0 3.29745E-5
17-76183481-A-C p.Pro10Pro synonymous AFMID 4 82986 4.82009E-5 41493 0 5.03525E-4
17-76183487-G-A p.Lys12Lys synonymous AFMID 2 82984 2.4101E-5 41492 0 NA
17-76183488-G-A p.Val13Ile missense AFMID 2 82976 2.41034E-5 41488 0 NA
17-76183489-T-C p.Val13Ala missense AFMID 2 82948 2.41115E-5 41474 0 NA
17-76183490-T-C p.Val13Val synonymous AFMID 1 82940 1.20569E-5 41470 0 NA
17-76183492-C-T p.Pro14Leu missense AFMID 1 82946 1.2056E-5 41473 0 3.19816E-5
17-76183492-C-G p.Pro14Arg missense AFMID 1 82946 1.2056E-5 41473 0 5.1703E-5
17-76183495-GGAA-G p.Met1del start_lost AFMID 16 82914 1.92971E-4 41457 0 6.59544E-5
17-76183498-A-G p.Lys16Arg missense AFMID 1 82898 1.2063E-5 41449 0 NA
17-76187072-C-G p.Pro29Ala missense AFMID 1 83064 1.20389E-5 41532 0 NA
17-76187076-G-T p.Ser30Ile missense AFMID 1 83092 1.20349E-5 41546 0 3.98238E-6
17-76187078-C-T p.Arg31* stop_gained AFMID 1 83112 1.2032E-5 41556 0 3.18674E-5
17-76187079-G-A p.Arg31Gln missense AFMID 3 83144 3.6082E-5 41572 0 3.18593E-5
17-76187081-T-C p.Trp32Arg missense AFMID 2 83146 2.40541E-5 41573 0 1.68688E-5
17-76187090-C-T p.Arg35* stop_gained AFMID 4 83152 4.81047E-5 41576 0 0.00100806
17-76187091-G-A p.Arg35Gln missense AFMID 16 83158 1.92405E-4 41579 0 2.23001E-4
17-76187096-G-C p.Gly37Arg missense AFMID 3 83188 3.60629E-5 41594 0 7.95963E-6
17-76187102-G-T p.Glu39* stop_gained AFMID 2 83168 2.40477E-5 41584 0 NA
17-76187108-G-C p.Ala41Pro missense AFMID 1602 83132 0.0192706 41566 60 0.0451039
17-76187109-C-A p.Ala41Asp missense AFMID 2 83152 2.40523E-5 41576 0 1.67704E-5
17-76187137-T-G p.Ile50Met missense AFMID 4 83012 4.81858E-5 41506 0 3.18857E-5
17-76188717-G-C c.155-1G>C splice_acceptor AFMID 2 51392 3.89166E-5 25696 0 3.18715E-5
17-76188730-G-C p.Trp56Ser missense AFMID 1 51404 1.94537E-5 25702 0 6.37227E-5
17-76188731-G-C p.Trp56Cys missense AFMID 1 51404 1.94537E-5 25702 0 NA
17-76188874-C-T c.*120+8C>T splice_region AFMID 6 49422 1.21403E-4 24711 0 6.3743E-5
17-76193207-TTAATC-T c.104-8_104-4delTAATC splice_region AFMID 2 77550 2.57898E-5 38775 0 1.7645E-4
17-76193208-T-C c.104-8T>C splice_region AFMID 3 77556 3.86817E-5 38778 0 NA
17-76193237-T-G p.Thr55Thr synonymous AFMID 3 77718 3.86011E-5 38859 0 1.33577E-5
17-76193641-C-T c.*415C>T splice_region AFMID 56 2044 0.0273973 1022 0 0.0509593
17-76198587-A-G p.Thr54Thr synonymous AFMID 7242 81780 0.0885547 40890 314 0.0826691
17-76198594-C-T p.Arg57Trp missense AFMID 1 82400 1.21359E-5 41200 0 1.19456E-5
17-76198594-C-CG p.Ala58fs frameshift AFMID 1 82400 1.21359E-5 41200 0 1.19456E-5
17-76198595-G-A p.Arg57Gln missense AFMID 243 82414 0.00294853 41207 0 0.004375
17-76198602-C-CA p.Arg60fs frameshift AFMID 2 82500 2.42424E-5 41250 0 0.00100705
17-76198602-C-A p.Thr59Thr synonymous AFMID 1 82500 1.21212E-5 41250 0 NA
17-76198605-G-A p.Arg60Arg synonymous AFMID 4 82534 4.84649E-5 41267 0 NA
17-76198607-A-G p.Lys61Arg missense AFMID 2 82538 2.42313E-5 41269 0 3.98048E-6
17-76198610-G-C p.Ser62Thr missense AFMID 1 82526 1.21174E-5 41263 0 NA
17-76198617-G-A p.Leu64Leu synonymous AFMID 6 82516 7.27132E-5 41258 0 9.55962E-5
17-76198619-A-G p.His65Arg missense AFMID 1 82508 1.212E-5 41254 0 3.98016E-6
17-76198628-A-G p.Tyr68Cys missense AFMID 7 82424 8.49267E-5 41212 0 3.18634E-5
17-76198635-C-T p.Asp70Asp synonymous AFMID 1 82246 1.21586E-5 41123 0 1.1949E-5
17-76198635-C-G p.Asp70Glu missense AFMID 2 82246 2.43173E-5 41123 0 NA
17-76198636-G-A p.Gly71Ser missense AFMID 47 82232 5.71554E-4 41116 0 0.00125
17-76198638-C-T p.Gly71Gly synonymous AFMID 9 82152 1.09553E-4 41076 0 7.5696E-5
17-76198639-G-A p.Glu72Lys missense AFMID 28 82184 3.40699E-4 41092 0 0.00120522
17-76198657-A-G p.Ile78Val missense AFMID 2 81772 2.44582E-5 40886 0 3.98788E-6
17-76198668-C-A p.Pro81Pro synonymous AFMID 2 81042 2.46786E-5 40521 0 NA
17-76198668-C-T p.Pro81Pro synonymous AFMID 2 81042 2.46786E-5 40521 0 1.19973E-5
17-76198669-G-A p.Asp82Asn missense AFMID 2 80964 2.47023E-5 40482 0 8.40647E-6
17-76198671-C-T p.Asp82Asp synonymous AFMID 1 80818 1.23735E-5 40409 0 1.0808E-4
17-76198672-G-A p.Glu83Lys missense AFMID 31 80712 3.84082E-4 40356 0 0.00151057
17-76198677-G-A p.Ser84Ser synonymous AFMID 132 80390 0.001642 40195 1 0.004375
17-76198682-AAGGTTGTCGGTGAAGGGGCTGGGGGTCCCGGGGCTTGGGGGTCCAGTGGCAGAGCTCAGCAGGGCGGGCCTTGCTCACACGCCCTGTGCTTGGTTTTGC-A p.Glu86fs frameshift AFMID 7 80228 8.72513E-5 40114 0 NA
17-76198690-C-T c.259+6C>T splice_region AFMID 1 79778 1.25348E-5 39889 0 3.61788E-5
17-76198691-G-A c.259+7G>A splice_region AFMID 4 79788 5.01329E-5 39894 0 4.57022E-5
17-76198794-C-T p.Phe90Phe synonymous AFMID 1 81568 1.22597E-5 40784 0 NA
17-76198809-C-T p.His95His synonymous AFMID 2 81436 2.45592E-5 40718 0 7.78275E-5
17-76198810-G-A p.Gly96Arg missense AFMID 112 81424 0.00137552 40712 0 0.00203926
17-76198816-T-C p.Tyr98His missense AFMID 1 81376 1.22886E-5 40688 0 1.19895E-5
17-76198821-G-A p.Trp99* stop_gained AFMID 1 81296 1.23007E-5 40648 0 NA
17-76198828-G-A p.Gly102Arg missense AFMID 4 81132 4.93024E-5 40566 0 0.0015448
17-76198832-G-A p.Ser103Asn missense+splice_region AFMID 5 81064 6.16797E-5 40532 0 6.12295E-6
17-76198839-C-A c.308+7C>A splice_region AFMID 2 80864 2.47329E-5 40432 0 NA
17-76198839-C-T c.308+7C>T splice_region AFMID 1 80866 1.23661E-5 40433 0 8.96459E-5
17-76198840-G-A c.308+8G>A splice_region AFMID 3 80818 3.71204E-5 40409 0 1.35184E-4
17-76200735-A-C c.309-2A>C splice_acceptor AFMID 1 83076 1.20372E-5 41538 0 4.96516E-5
17-76200737-T-G p.Ser103Arg missense+splice_region AFMID 3 83086 3.61072E-5 41543 0 3.9782E-6
17-76200738-A-C p.Lys104Gln missense+splice_region AFMID 1 83108 1.20325E-5 41554 0 NA
17-76200742-A-G p.Asp105Gly missense AFMID 2 83142 2.40552E-5 41571 0 1.65322E-5
17-76200766-C-T p.Pro113Leu missense AFMID 1 83278 1.2008E-5 41639 0 1.65052E-5
17-76200767-G-A p.Pro113Pro synonymous AFMID 2 83282 2.40148E-5 41641 0 8.74932E-5
17-76200772-C-T p.Thr115Met missense AFMID 10 83290 1.20062E-4 41645 0 6.37024E-5
17-76200773-G-A p.Thr115Thr synonymous AFMID 6 83290 7.20375E-5 41645 0 8.24851E-5
17-76200788-C-T p.Ala120Ala synonymous AFMID 2 83298 2.40102E-5 41649 0 9.5584E-5
17-76200796-T-C p.Ile123Thr missense AFMID 4 83286 4.80273E-5 41643 0 2.4737E-5
17-76200804-T-C p.Tyr126His missense AFMID 1 83286 1.20068E-5 41643 0 NA
17-76200805-A-G p.Tyr126Cys missense AFMID 4 83262 4.80411E-5 41631 0 3.58012E-5
17-76200806-C-T p.Tyr126Tyr synonymous AFMID 1 83254 1.20114E-5 41627 0 0.00125
17-76200807-G-A p.Gly127Ser missense AFMID 18 83266 2.16175E-4 41633 0 0.00302115
17-76200807-G-C p.Gly127Arg missense AFMID 2 83266 2.40194E-5 41633 0 1.59098E-5
17-76200809-C-T p.Gly127Gly synonymous AFMID 2 83260 2.40211E-5 41630 0 NA
17-76200812-C-T p.Ile128Ile synonymous AFMID 3 83248 3.60369E-5 41624 0 5.77291E-5
17-76200829-G-C c.394+7G>C splice_region AFMID 1 83260 1.20106E-5 41630 0 NA
17-76200907-A-G c.395-2A>G splice_acceptor AFMID 139 83332 0.00166803 41666 0 0.00184725
17-76200921-A-G p.His136Arg missense AFMID 1 83314 1.20028E-5 41657 0 6.36983E-5
17-76200939-C-T p.Thr142Ile missense AFMID 2 83312 2.40061E-5 41656 0 NA
17-76200940-C-T p.Pro114Ser missense AFMID 1 83316 1.20025E-5 41658 0 NA
17-76200941-C-T p.Arg143Cys missense AFMID 4 83314 4.80111E-5 41657 0 6.37267E-5
17-76200942-G-A p.Arg143His missense AFMID 2 83314 2.40056E-5 41657 0 3.97684E-5
17-76200946-C-T p.Arg116Cys missense AFMID 3 83304 3.60127E-5 41652 0 5.76977E-5
17-76200947-G-A p.Val145Ile missense AFMID 1 83318 1.20022E-5 41659 0 3.97671E-6
17-76200952-G-A p.Val118Ile missense AFMID 3 83322 3.60049E-5 41661 0 6.37024E-5
17-76200965-C-T p.Arg151Trp missense AFMID 6764 83162 0.0813352 41581 320 0.070625
17-76200966-G-A p.Arg151Gln missense AFMID 3 83306 3.60118E-5 41653 0 0.00151057
17-76200967-G-T p.Val123Leu missense AFMID 1 83304 1.20042E-5 41652 0 8.2526E-6
17-76200976-C-T p.Gln126* stop_gained AFMID 1 83298 1.20051E-5 41649 0 NA
17-76201014-G-C p.Trp138Cys missense AFMID 1 83160 1.2025E-5 41580 0 NA
17-76201018-T-A p.Ser140Thr missense AFMID 3 83136 3.60855E-5 41568 0 9.1503E-6
17-76201032-G-T p.Arg144Ser missense AFMID 1 83068 1.20383E-5 41534 0 3.18613E-5
17-76201040-A-G p.Gln147Arg missense AFMID 1 82970 1.20525E-5 41485 0 NA
17-76201041-A-C p.Gln147His missense AFMID 2 82962 2.41074E-5 41481 0 1.08008E-5
17-76201058-A-G p.Gln153Arg missense AFMID 1 82734 1.20869E-5 41367 0 1.22645E-5
17-76201071-C-G p.Pro186Arg missense AFMID 2 82600 2.42131E-5 41300 0 NA
17-76201071-CT-C p.Ser158fs frameshift AFMID 1 82600 1.21065E-5 41300 0 NA
17-76201083-G-C p.Trp161Cys missense AFMID 2 82510 2.42395E-5 41255 0 NA
17-76201097-T-C p.Ile166Thr missense AFMID 2 82462 2.42536E-5 41231 0 9.60421E-6
17-76201098-T-G p.Ile166Met missense AFMID 2 82474 2.42501E-5 41237 0 NA
17-76201108-C-T p.Arg170* stop_gained AFMID 1 82440 1.213E-5 41220 0 3.55252E-5
17-76201109-G-A p.Arg170Gln missense AFMID 15 82448 1.81933E-4 41224 0 1.94856E-4
17-76201113-G-C p.Arg171Ser missense AFMID 2 82468 2.42518E-5 41234 0 3.56582E-5
17-76201114-G-A p.Gly172Arg missense AFMID 1 82484 1.21236E-5 41242 0 1.77892E-5
17-76201118-C-G p.Pro173Arg missense AFMID 1 82480 1.21242E-5 41240 0 3.5699E-5
17-76201125-T-G p.Leu204Trp missense AFMID 1 82498 1.21215E-5 41249 0 4.80118E-6
17-76201126-G-A p.Val176Met missense AFMID 1 82516 1.21189E-5 41258 0 1.78082E-5
17-76201133-A-G p.Lys178Arg missense AFMID 1 82594 1.21074E-5 41297 0 NA
17-76201134-A-G p.Lys178Lys synonymous AFMID 15 82620 1.81554E-4 41310 0 7.02272E-5
17-76201135-C-T p.Leu179Leu synonymous AFMID 1 82624 1.2103E-5 41312 0 6.25E-4
17-76201136-T-TGC p.Ala181fs frameshift AFMID 1 82622 1.21033E-5 41311 0 4.69554E-6
17-76201138-C-T p.Arg180Cys missense AFMID 1 82602 1.21062E-5 41301 0 5.24916E-5
17-76201156-T-G p.Cys186Gly missense AFMID 1 82708 1.20907E-5 41354 0 1.57719E-5
17-76201161-T-C p.Ser187Ser splice_region+synonymous AFMID 1 82706 1.2091E-5 41353 0 4.25931E-6
17-76201182-A-G p.Tyr159Cys missense AFMID 524 82706 0.0063357 41353 3 0.0125343
17-76201184-C-G p.Leu160Val missense AFMID 2 82748 2.41698E-5 41374 0 NA
17-76201197-C-A p.Ser164* stop_gained AFMID 1 82716 1.20896E-5 41358 0 NA
17-76201201-C-T p.Ala165Ala synonymous AFMID 2 82708 2.41815E-5 41354 0 6.37105E-5
17-76201202-G-A p.Gly166Arg missense AFMID 2 82716 2.41791E-5 41358 0 9.55718E-5
17-76201204-G-T p.Gly166Gly synonymous AFMID 1 82706 1.2091E-5 41353 0 NA
17-76201206-C-T p.Ala167Val missense AFMID 1 82698 1.20922E-5 41349 0 NA
17-76201210-C-G p.His168Gln missense AFMID 10 82718 1.20893E-4 41359 0 0.00151057
17-76201211-C-G p.Leu169Val missense AFMID 1 82702 1.20916E-5 41351 0 NA
17-76201214-G-T p.Ala170Ser missense AFMID 1 82712 1.20901E-5 41356 0 NA
17-76201226-C-T p.Leu174Phe missense AFMID 17 82706 2.05547E-4 41353 0 4.45973E-4
17-76201235-G-A p.Asp177Asn missense AFMID 8 82682 9.67562E-5 41341 0 8.09422E-5
17-76201237-C-A p.Asp177Glu missense AFMID 1 82688 1.20937E-5 41344 0 NA
17-76201242-C-T p.Thr179Ile missense AFMID 1 82684 1.20942E-5 41342 0 NA
17-76201246-G-T p.Lys180Asn missense AFMID 1 82680 1.20948E-5 41340 0 1.21678E-5
17-76201248-A-G p.His181Arg missense AFMID 1 82678 1.20951E-5 41339 0 4.06108E-6
17-76201257-C-G p.Thr184Arg missense AFMID 2 82646 2.41996E-5 41323 0 NA
17-76201257-C-T p.Thr184Met missense AFMID 1 82646 1.20998E-5 41323 0 8.18753E-6
17-76201258-G-A p.Thr184Thr synonymous AFMID 6 82628 7.26146E-5 41314 0 3.51513E-4
17-76201259-C-T p.Pro185Ser missense AFMID 1 82640 1.21007E-5 41320 0 1.06589E-5
17-76201264-C-T p.Asn186Asn synonymous AFMID 2 82634 2.42031E-5 41317 0 3.24401E-5
17-76201529-C-T p.Pro106Leu missense AFMID 33 83042 3.97389E-4 41521 0 5.03525E-4
17-76201532-G-C p.Val193Leu missense AFMID 6 83054 7.22422E-5 41527 0 5.03525E-4
17-76201558-C-T p.Pro201Pro synonymous AFMID 1 83060 1.20395E-5 41530 0 8.2371E-6
17-76201561-C-T p.Ile202Ile synonymous AFMID 2 83064 2.40778E-5 41532 0 6.58968E-5
17-76201562-G-A p.Val203Met missense AFMID 9 83060 1.08355E-4 41530 0 5.03525E-4
17-76201568-A-G p.Thr205Ala missense AFMID 2 83104 2.40662E-5 41552 0 3.19163E-5
17-76201573-A-G p.Ser206Ser synonymous AFMID 2 83084 2.4072E-5 41542 0 9.58589E-5
17-76201574-C-A p.Gln207Lys missense AFMID 1 83080 1.20366E-5 41540 0 NA
17-76201575-A-C p.Gln207Pro missense AFMID 2 83092 2.40697E-5 41546 0 NA
17-76201579-C-T p.Asn208Asn synonymous AFMID 2 83064 2.40778E-5 41532 0 1.27608E-4
17-76201580-G-A p.Val209Ile missense AFMID 1 83040 1.20424E-5 41520 0 1.64745E-5
17-76201598-C-T p.Leu215Leu splice_region+synonymous AFMID 7 83020 8.4317E-5 41510 0 1.07393E-4
17-76201599-TGTGAGTTACTTGGCCACCACCTCCCCTGGCTCACCAGGAGCCTGGCTCCTCTCTGTCCTGACCCCTGTCCACTCCCCACCCCAG-T c.644+1_645-1delGTGAGTTACTTGGCCACCACCTCCCCTGGCTCACCAGGAGCCTGGCTCCTCTCTGTCCTGACCCCTGTCCACTCCCCACCCCAG splice_acceptor AFMID 2 83018 2.40912E-5 41509 0 NA
17-76201690-C-T p.Asp217Asp synonymous AFMID 2 82848 2.41406E-5 41424 0 7.97226E-6
17-76201699-G-A p.Arg220Arg synonymous AFMID 1 82882 1.20653E-5 41441 0 2.47733E-5
17-76201702-T-C p.Asn221Asn synonymous AFMID 2 82914 2.41214E-5 41457 0 6.25E-4
17-76201705-C-A p.Ser222Arg missense AFMID 3 82908 3.61847E-5 41454 0 1.65199E-5
17-76201714-G-A p.Leu225Leu synonymous AFMID 1 82948 1.20557E-5 41474 0 NA
17-76201734-C-T p.Pro232Leu missense AFMID 8 82992 9.63948E-5 41496 0 1.59551E-4
17-76201734-C-G p.Pro232Arg missense AFMID 1 82992 1.20494E-5 41496 0 NA
17-76201740-A-G p.Asp234Gly missense AFMID 1 82982 1.20508E-5 41491 0 3.19101E-5
17-76201751-C-T p.Arg238Cys missense AFMID 62 83082 7.46251E-4 41541 0 4.18881E-4
17-76201751-C-G p.Arg238Gly missense AFMID 1 83084 1.2036E-5 41542 0 3.98934E-6
17-76201753-T-A p.Arg238Arg synonymous AFMID 1 83100 1.20337E-5 41550 0 3.98912E-6
17-76201766-G-A p.Val243Met missense AFMID 10 83160 1.2025E-4 41580 0 2.79931E-5
17-76201777-C-T p.Phe246Phe synonymous AFMID 5 83220 6.00817E-5 41610 0 9.57304E-5
17-76201778-G-A p.Asp247Asn missense AFMID 1 83224 1.20158E-5 41612 0 3.31038E-5
17-76201779-A-T p.Asp247Val missense AFMID 2 83230 2.40298E-5 41615 0 3.31005E-5
17-76201785-C-G p.Pro249Arg missense AFMID 1 83258 1.20109E-5 41629 0 NA
17-76201786-C-G p.Pro249Pro synonymous AFMID 1 83258 1.20109E-5 41629 0 8.27856E-6
17-76201786-C-T p.Pro249Pro synonymous AFMID 2 83258 2.40217E-5 41629 0 8.27856E-6
17-76201787-G-A p.Glu250Lys missense AFMID 2 83254 2.40229E-5 41627 0 6.37552E-5
17-76201788-A-C p.Glu250Ala missense AFMID 1 83272 1.20088E-5 41636 0 4.01852E-6
17-76201796-C-T p.Arg253* stop_gained AFMID 5 83270 6.00456E-5 41635 0 3.18735E-5
17-76201803-C-A p.Ser255Tyr missense AFMID 1 83270 1.20091E-5 41635 0 4.03249E-6
17-76201823-C-T p.Leu262Phe missense AFMID 1 83304 1.20042E-5 41652 0 NA
17-76201831-G-A p.Val264Val synonymous AFMID 1 83302 1.20045E-5 41651 0 1.16215E-4
17-76202019-C-T c.796-8C>T splice_region AFMID 1 83052 1.20406E-5 41526 0 8.41723E-6
17-76202021-G-A c.796-6G>A splice_region AFMID 351 83030 0.00422739 41515 5 0.00375
17-76202028-C-T p.Thr266Ile missense+splice_region AFMID 1 83118 1.20311E-5 41559 0 8.35715E-6
17-76202040-G-C p.Gly270Ala missense AFMID 1 83192 1.20204E-5 41596 0 NA
17-76202043-A-C p.Glu271Ala missense AFMID 1 83180 1.20221E-5 41590 0 NA
17-76202052-C-T p.Ala274Val missense AFMID 1 83224 1.20158E-5 41612 0 NA
17-76202060-G-A p.Glu277Lys missense AFMID 1 83244 1.20129E-5 41622 0 3.18878E-5
17-76202071-C-T p.Thr83Met missense AFMID 4 83222 4.80642E-5 41611 0 6.37999E-5
17-76202072-G-C p.Asp281His missense AFMID 1 83228 1.20152E-5 41614 0 8.27732E-6
17-76202072-G-A p.Asp281Asn missense AFMID 1 83226 1.20155E-5 41613 0 3.19183E-5
17-76202081-C-T p.His284Tyr missense AFMID 9 83242 1.08118E-4 41621 0 5.96569E-5
17-76202107-C-T p.Thr292Thr synonymous AFMID 2 83130 2.40587E-5 41565 0 1.19337E-5
17-76202116-C-T p.Asp295Asp synonymous AFMID 5 83064 6.01946E-5 41532 0 9.15781E-5
17-76202120-G-A p.Val297Met missense AFMID 2 82996 2.40975E-5 41498 0 1.00018E-4
17-76202125-C-T p.Leu298Leu synonymous AFMID 8 82930 9.64669E-5 41465 0 4.18018E-5
17-76202126-A-C p.Thr299Pro missense AFMID 2 82904 2.41243E-5 41452 0 NA
17-76202131-G-GATTATCTTGAAAACAATCTTCCAGTAGTTCTGACGATACTT c.900_900+1insATTATCTTGAAAACAATCTTCCAGTAGTTCTGACGATACTT splice_donor AFMID 3 82786 3.6238E-5 41393 1 NA
17-76202138-C-T c.900+7C>T splice_region AFMID 2 82582 2.42184E-5 41291 0 5.91276E-5
17-76202139-C-G c.900+8C>G splice_region AFMID 1 82574 1.21103E-5 41287 0 NA
17-76202995-A-G p.Ile302Val missense AFMID 1 82944 1.20563E-5 41472 0 6.58989E-5
17-76203007-A-G p.Ile306Val missense AFMID 1 83024 1.20447E-5 41512 0 3.18512E-5
17-76203012-C-G p.Phe307Leu missense AFMID 1 83048 1.20412E-5 41524 0 3.98118E-6
17-76203014-A-AGT p.Ter309fs frameshift AFMID 1 83050 1.20409E-5 41525 0 NA
17-76203026-G-A p.Thr63Thr synonymous AFMID 1 82986 1.20502E-5 41493 0 3.97896E-6
17-76203029-A-C p.Ile64Ile synonymous AFMID 4 82976 4.82067E-5 41488 0 7.41424E-5
17-76203031-T-C p.Leu65Pro missense AFMID 2 82978 2.41028E-5 41489 0 6.36943E-5
17-76203037-C-T p.Ala67Val missense AFMID 70 82932 8.44065E-4 41466 0 0.004375
17-76203046-C-T p.Thr70Met missense AFMID 3 82864 3.62039E-5 41432 0 9.89201E-5
17-76203047-G-A p.Thr70Thr synonymous AFMID 37 82864 4.46515E-4 41432 0 2.58606E-4
17-76203053-C-G p.Ile72Met missense AFMID 1 82802 1.2077E-5 41401 0 3.30033E-5
17-76203058-C-T p.Pro74Leu missense AFMID 1 82738 1.20863E-5 41369 0 3.18492E-5
17-76203060-T-C p.Trp75Arg missense AFMID 1 82728 1.20878E-5 41364 0 NA
17-76203060-T-G p.Trp75Gly missense AFMID 2 82728 2.41756E-5 41364 0 2.48402E-5
17-76203070-C-T p.Ser78Phe missense AFMID 2 82526 2.42348E-5 41263 0 8.31794E-6
17-76203073-C-G p.Pro79Arg missense AFMID 4 82482 4.84954E-5 41241 0 3.33084E-5
17-76203073-C-T p.Pro79Leu missense AFMID 2 82484 2.42471E-5 41242 0 NA
17-76203081-T-A p.Phe82Ile missense AFMID 1 82260 1.21566E-5 41130 0 NA
17-76203082-T-C p.Phe82Ser missense AFMID 1 82230 1.2161E-5 41115 0 7.97289E-6
17-76203084-C-T p.Arg83Trp missense AFMID 6 82110 7.30727E-5 41055 0 1.27445E-4
17-76203085-G-A p.Arg83Gln missense AFMID 18 81968 2.19598E-4 40984 0 3.50475E-4
17-76203267-C-T c.*432C>T splice_region AFMID 1 40954 2.44176E-5 20477 0 NA