Variant

Variant ID Consequence Effect Gene AC AN AF NS NHOM maxEAF
5-132216756-A-G p.Ser1163Pro missense AFF4 1 83356 1.19967E-5 41678 0 3.29962E-5
5-132216763-C-T p.Lys1160Lys synonymous AFF4 1 83348 1.19979E-5 41674 0 NA
5-132216797-C-T p.Arg1149Gln missense AFF4 2 83312 2.40061E-5 41656 0 NA
5-132216802-A-G p.Tyr1147Tyr synonymous AFF4 2 83282 2.40148E-5 41641 0 1.64856E-5
5-132216806-C-T p.Arg1146His missense AFF4 1 83286 1.20068E-5 41643 0 8.24402E-6
5-132216811-T-A p.Leu1144Leu synonymous AFF4 11 83304 1.32046E-4 41652 0 6.36699E-5
5-132216825-T-C p.Ile1140Val missense AFF4 1 83296 1.20054E-5 41648 0 NA
5-132216832-A-G p.Asn1137Asn synonymous AFF4 2 83268 2.40188E-5 41634 0 NA
5-132216843-G-C p.Leu1134Val missense AFF4 1 83272 1.20088E-5 41636 0 NA
5-132216868-A-G p.Ala1125Ala synonymous AFF4 1 83218 1.20166E-5 41609 0 NA
5-132219025-T-G c.3364+7A>C splice_region AFF4 1 82558 1.21127E-5 41279 0 3.1835E-5
5-132219038-G-C p.Gln1120Glu missense AFF4 1 82766 1.20823E-5 41383 0 NA
5-132219072-T-G p.Glu1108Asp missense AFF4 1 83012 1.20465E-5 41506 0 NA
5-132219074-C-T p.Glu1108Lys missense AFF4 1 83012 1.20465E-5 41506 0 NA
5-132219075-G-A p.Thr1107Thr synonymous AFF4 2 83024 2.40894E-5 41512 0 1.91119E-4
5-132219077-T-C p.Thr1107Ala missense AFF4 207 83048 0.00249253 41524 2 0.00238791
5-132219084-G-A p.Leu1104Leu synonymous AFF4 4 83088 4.81417E-5 41544 0 6.36699E-5
5-132219084-G-C p.Leu1104Leu synonymous AFF4 17 83088 2.04602E-4 41544 0 0.00302115
5-132219087-G-C p.Phe1103Leu missense AFF4 1 83082 1.20363E-5 41541 0 3.1839E-5
5-132219091-T-C p.Asn1102Ser missense AFF4 1 83094 1.20346E-5 41547 0 3.97966E-6
5-132219094-G-A p.Ser1101Phe missense AFF4 1 83096 1.20343E-5 41548 0 NA
5-132219129-G-A p.Ile1089Ile synonymous AFF4 7 83134 8.42014E-5 41567 0 2.38747E-5
5-132219135-C-T p.Gln1087Gln synonymous AFF4 6 83138 7.21692E-5 41569 0 9.55414E-5
5-132219140-G-C p.Pro1086Ala missense AFF4 1 83138 1.20282E-5 41569 0 NA
5-132219147-C-G p.Val1083Val synonymous AFF4 1 83124 1.20302E-5 41562 0 3.97956E-6
5-132219161-T-C p.Ser1079Gly missense AFF4 1 83132 1.20291E-5 41566 0 NA
5-132219166-G-A p.Ser1077Phe missense AFF4 1 83132 1.20291E-5 41566 0 NA
5-132219180-C-T p.Gly1072Gly synonymous AFF4 66 83068 7.9453E-4 41534 0 0.00125
5-132219186-T-C p.Ser1070Ser synonymous AFF4 3 83036 3.61289E-5 41518 0 NA
5-132219200-A-T p.Ser1066Thr missense AFF4 1 82954 1.20549E-5 41477 0 NA
5-132219211-G-A p.Ser1062Leu missense AFF4 2 82852 2.41394E-5 41426 1 NA
5-132220760-T-G c.3143+8A>C splice_region AFF4 1 81122 1.23271E-5 40561 0 NA
5-132220782-C-T p.Ser1043Ser synonymous AFF4 1 81488 1.22717E-5 40744 0 2.75953E-5
5-132220783-G-A p.Ser1043Leu missense AFF4 6 81574 7.35528E-5 40787 0 2.09289E-5
5-132220785-T-C p.Pro1042Pro synonymous AFF4 1 81574 1.22588E-5 40787 0 4.17251E-6
5-132220788-T-A p.Ala1041Ala synonymous AFF4 1 81558 1.22612E-5 40779 0 NA
5-132220796-AATT-A p.Asn1038del conservative_inframe_deletion AFF4 2 81540 2.45278E-5 40770 0 9.17802E-6
5-132220801-T-C p.Asn1037Ser missense AFF4 1 81490 1.22714E-5 40745 0 NA
5-132220803-A-G p.Tyr1036Tyr synonymous AFF4 2 81456 2.45531E-5 40728 0 9.19997E-6
5-132220804-T-A p.Tyr1036Phe missense AFF4 1 81492 1.22711E-5 40746 0 6.37592E-5
5-132222008-G-A p.His1031His synonymous AFF4 1 83132 1.20291E-5 41566 0 3.31483E-5
5-132222014-T-G p.Thr1029Thr synonymous AFF4 2 83188 2.40419E-5 41594 0 1.65308E-5
5-132222016-T-C p.Thr1029Ala missense AFF4 1 83190 1.20207E-5 41595 0 NA
5-132222047-C-T p.Lys1018Lys synonymous AFF4 11 83222 1.32177E-4 41611 0 1.19371E-4
5-132222080-A-G p.Ser1007Ser synonymous AFF4 2 83104 2.40662E-5 41552 0 4.94943E-5
5-132223218-T-C p.Val1000Val synonymous AFF4 87 82628 0.00105291 41314 1 0.00251762
5-132223223-T-C p.Thr999Ala missense AFF4 2 82678 2.41902E-5 41339 0 6.25E-4
5-132223228-C-T p.Arg997Gln missense AFF4 2 82696 2.4185E-5 41348 0 8.24688E-6
5-132223231-T-C p.Lys996Arg missense AFF4 1 82746 1.20852E-5 41373 0 NA
5-132223573-T-C p.Pro966Pro synonymous AFF4 6 82466 7.27573E-5 41233 0 3.18532E-5
5-132223579-T-C p.Lys964Lys synonymous AFF4 500 82516 0.00605943 41258 5 0.00855992
5-132223594-A-G p.Asn959Asn synonymous AFF4 1 82644 1.21001E-5 41322 0 NA
5-132223619-T-G p.Glu951Ala missense AFF4 1 82746 1.20852E-5 41373 0 NA
5-132223649-T-C p.Tyr941Cys missense AFF4 1 82824 1.20738E-5 41412 0 3.98794E-6
5-132223673-G-A p.Ser933Phe missense+splice_region AFF4 1 82816 1.2075E-5 41408 0 NA
5-132223674-ACTGAAGAAAGGAGAATGCAAGTAATGAGTAATGATCTACTATGGCTACAAACATCAGAAGATTACTTAAGTTAATTTGATTAAATACGTAAGTGTAAGGAGAATATCTACATAC-A c.2796+1_2797-1del splice_acceptor AFF4 5 82814 6.03763E-5 41407 0 NA
5-132223681-A-C c.2797-7T>G splice_region AFF4 5 82824 6.0369E-5 41412 0 3.30568E-5
5-132223777-ATATC-A c.2796+8_2796+11delGATA splice_region AFF4 1 82642 1.21004E-5 41321 0 1.69535E-5
5-132223791-A-G p.Leu932Leu splice_region+synonymous AFF4 2 82608 2.42107E-5 41304 0 3.18512E-5
5-132223794-C-A p.Ala931Ser missense AFF4 2 82604 2.42119E-5 41302 0 NA
5-132223802-T-C p.Asn928Ser missense AFF4 2 82618 2.42078E-5 41309 0 NA
5-132223813-C-T p.Lys924Lys synonymous AFF4 3 82540 3.6346E-5 41270 0 NA
5-132223840-T-C p.Ala915Ala synonymous AFF4 1 82310 1.21492E-5 41155 0 8.05211E-6
5-132223859-G-C c.2733-7C>G splice_region AFF4 4 81790 4.89057E-5 40895 0 1.59561E-4
5-132223860-A-G c.2733-8T>C splice_region AFF4 1 81756 1.22315E-5 40878 0 NA
5-132224765-T-C c.2732+6A>G splice_region AFF4 2 82866 2.41354E-5 41433 0 NA
5-132224779-A-G p.Phe908Phe synonymous AFF4 4 83030 4.81754E-5 41515 0 8.24389E-6
5-132224782-G-T p.Val907Val synonymous AFF4 1 83056 1.20401E-5 41528 0 1.15409E-4
5-132224784-C-T p.Val907Ile missense AFF4 3 83060 3.61185E-5 41530 0 8.2428E-6
5-132224799-G-A p.Arg902Trp missense AFF4 6 83098 7.22039E-5 41549 0 1.59109E-5
5-132224802-G-T p.Pro901Thr missense AFF4 1 83116 1.20314E-5 41558 0 NA
5-132224825-G-A p.Ala893Val missense AFF4 1 83154 1.20259E-5 41577 0 NA
5-132224831-G-A p.Pro891Leu missense AFF4 1 83148 1.20267E-5 41574 0 NA
5-132224834-G-A p.Pro890Leu missense AFF4 19 83122 2.2858E-4 41561 0 2.47231E-4
5-132224842-A-G p.Ser887Ser synonymous AFF4 1 83102 1.20334E-5 41551 0 8.24239E-6
5-132224847-A-T p.Ser886Thr missense AFF4 3 83086 3.61072E-5 41543 0 6.25E-4
5-132224859-C-G p.Ala882Pro missense AFF4 2 82994 2.40981E-5 41497 0 3.30235E-5
5-132224867-T-TTAACCTCCTTG c.2638-3_2638-2insCAAGGAGGTTA splice_region AFF4 2 82826 2.4147E-5 41413 0 NA
5-132224869-A-AGCTACTGGAAGTCTTC c.2638-5_2638-4insGAAGACTTCCAGTAGC splice_region AFF4 1 82784 1.20796E-5 41392 0 NA
5-132224870-C-T c.2638-5G>A splice_region AFF4 1 82750 1.20846E-5 41375 0 NA
5-132224871-CA-C c.2638-7delT splice_region AFF4 1 82712 1.20901E-5 41356 0 8.28116E-6
5-132227506-TTTA-T c.*281_*283delTAA splice_region AFF4 1 1924 5.19751E-4 962 0 NA
5-132227507-TTA-T c.*281_*282delTA splice_region AFF4 1 1870 5.34759E-4 935 0 6.69523E-5
5-132227509-A-T c.*281T>A splice_region AFF4 5 1388 0.00360231 694 0 0.00610363
5-132227511-A-T c.*279T>A splice_region AFF4 1 1876 5.33049E-4 938 0 0.00106326
5-132227782-GCACAGTGT-G p.Ter901fs frameshift AFF4 2 83198 2.4039E-5 41599 0 4.01407E-6
5-132227792-A-C p.Ter901Glyext*? stop_lost AFF4 2 83244 2.40258E-5 41622 0 NA
5-132227797-G-A p.Pro899Leu missense AFF4 12 83268 1.44113E-4 41634 0 5.7387E-4
5-132227807-C-T p.Val896Met missense AFF4 1 83296 1.20054E-5 41648 0 3.98842E-6
5-132227809-T-G p.His895Pro missense AFF4 2 83300 2.40096E-5 41650 0 1.6575E-5
5-132227816-T-C p.Thr893Ala missense AFF4 7 83308 8.40255E-5 41654 0 9.95897E-5
5-132227824-T-C p.Asn890Ser missense AFF4 80 83310 9.60269E-4 41655 2 0.004375
5-132227826-T-G p.Glu889Asp missense AFF4 2 83312 2.40061E-5 41656 0 8.26515E-6
5-132227840-G-GCC p.Pro885fs frameshift AFF4 1 83328 1.20008E-5 41664 0 NA
5-132227847-A-T p.Cys882* stop_gained AFF4 2 83342 2.39975E-5 41671 0 NA
5-132227864-C-T p.Glu877Lys missense AFF4 1 83362 1.19959E-5 41681 0 NA
5-132227875-C-T p.Ser873Asn missense AFF4 2 83374 2.39883E-5 41687 0 7.95399E-6
5-132227887-C-T p.Gly869Glu missense AFF4 3 83374 3.59824E-5 41687 0 1.19312E-5
5-132227892-G-A p.Thr867Thr synonymous AFF4 1 83368 1.1995E-5 41684 0 4.11896E-5
5-132227892-G-C p.Thr867Thr synonymous AFF4 1 83368 1.1995E-5 41684 0 NA
5-132227893-GTCT-G p.Lys866del disruptive_inframe_deletion AFF4 2 83372 2.39889E-5 41686 0 4.11889E-5
5-132227898-C-G p.Lys865Asn missense AFF4 2 83378 2.39871E-5 41689 0 8.23791E-6
5-132227903-G-C p.Gln864Glu missense AFF4 1 83378 1.19936E-5 41689 0 NA
5-132227904-C-T p.Lys863Lys synonymous AFF4 4 83378 4.79743E-5 41689 0 NA
5-132227909-A-AAATTATTGTAACATCTCAGTAAATATATAGGCC p.Thr861_Ser862insGlyLeuTyrIleTyrTerAspValThrIleIle stop_gained AFF4 1 83376 1.19939E-5 41688 0 NA
5-132227921-T-G p.Ser858Arg missense AFF4 1 83364 1.19956E-5 41682 0 1.64742E-5
5-132227932-C-T p.Ser854Asn missense AFF4 2 83350 2.39952E-5 41675 0 6.58935E-5
5-132227933-T-C p.Ser854Gly missense AFF4 1 83346 1.19982E-5 41673 0 NA
5-132227940-C-T p.Thr851Thr synonymous AFF4 4 83344 4.79939E-5 41672 0 3.18593E-5
5-132227941-G-A p.Thr851Met missense AFF4 3 83334 3.59997E-5 41667 0 6.3743E-5
5-132227964-T-C p.Ser843Ser synonymous AFF4 1 83302 1.20045E-5 41651 0 2.54956E-4
5-132227967-C-A p.Lys842Asn missense AFF4 1 83296 1.20054E-5 41648 0 NA
5-132227970-T-A p.Leu841Phe missense AFF4 5 83292 6.00298E-5 41646 0 3.18674E-5
5-132227974-G-A p.Ser840Phe missense AFF4 1 83266 1.20097E-5 41633 0 3.18695E-5
5-132227986-C-T p.Ser836Asn missense AFF4 2 83230 2.40298E-5 41615 0 8.23655E-6
5-132227990-T-C p.Ile835Val missense AFF4 1 83218 1.20166E-5 41609 0 1.19368E-5
5-132228001-C-T p.Arg831Gln missense AFF4 1 83154 1.20259E-5 41577 0 1.98986E-5
5-132228002-G-A p.Arg831Trp missense AFF4 3 83146 3.60811E-5 41573 0 1.98989E-5
5-132228008-C-G p.Gly829Arg missense AFF4 8 83130 9.62348E-5 41565 0 NA
5-132228022-G-A p.Pro824Leu missense AFF4 1 83032 1.20435E-5 41516 0 NA
5-132228023-G-A p.Pro824Ser missense AFF4 9 83006 1.08426E-4 41503 0 2.94609E-4
5-132228039-A-G p.Pro818Pro synonymous AFF4 1 82852 1.20697E-5 41426 0 NA
5-132228042-C-T p.Gly817Gly synonymous AFF4 1 82796 1.20779E-5 41398 0 NA
5-132228047-C-T p.Ala816Thr missense AFF4 6 82770 7.249E-5 41385 0 8.3686E-5
5-132228048-G-A p.Pro815Pro synonymous AFF4 28 82750 3.38369E-4 41375 0 0.003125
5-132228714-G-A c.2396+8C>T splice_region AFF4 1 83228 1.20152E-5 41614 0 3.97947E-6
5-132228743-T-C p.His792Arg missense AFF4 1 83308 1.20036E-5 41654 0 5.03525E-4
5-132228766-C-T p.Thr784Thr synonymous AFF4 6 83330 7.20029E-5 41665 0 2.78408E-5
5-132228767-G-A p.Thr784Met missense AFF4 5 83322 6.00082E-5 41661 0 5.76559E-5
5-132228769-T-C p.Lys783Lys synonymous AFF4 1 83324 1.20013E-5 41662 0 NA
5-132228787-A-G p.Ser777Ser synonymous AFF4 2 83296 2.40108E-5 41648 0 NA
5-132228794-C-T p.Arg775Gln missense AFF4 3 83270 3.60274E-5 41635 0 6.37105E-5
5-132228794-C-G p.Arg775Pro missense AFF4 1 83270 1.20091E-5 41635 0 6.58968E-5
5-132228814-G-C c.2308-4C>G splice_region AFF4 2 83180 2.40442E-5 41590 0 8.23764E-6
5-132228816-T-C c.2308-6A>G splice_region AFF4 1 83170 1.20236E-5 41585 0 4.11896E-5
5-132232019-T-C p.His768Arg missense AFF4 2 82938 2.41144E-5 41469 0 1.75596E-5
5-132232035-T-G p.Lys763Gln missense AFF4 3 83122 3.60915E-5 41561 0 5.97739E-5
5-132232037-T-C p.Asn762Ser missense AFF4 3 83140 3.60837E-5 41570 0 3.40594E-5
5-132232039-G-A p.Ser761Ser synonymous AFF4 1 83152 1.20262E-5 41576 0 NA
5-132232043-A-G p.Val760Ala missense AFF4 1 83174 1.2023E-5 41587 0 NA
5-132232045-T-G p.Lys759Asn missense AFF4 2 83194 2.40402E-5 41597 0 1.27836E-5
5-132232048-T-C p.Glu758Glu synonymous AFF4 2 83202 2.40379E-5 41601 0 4.25329E-5
5-132232062-T-C p.Lys754Glu missense AFF4 1 83260 1.20106E-5 41630 0 8.30151E-6
5-132232065-G-C p.Gln753Glu missense AFF4 1 83270 1.20091E-5 41635 0 1.65673E-5
5-132232069-C-T p.Glu751Glu synonymous AFF4 1 83278 1.2008E-5 41639 0 NA
5-132232075-C-T p.Thr749Thr synonymous AFF4 1 83280 1.20077E-5 41640 0 2.47746E-5
5-132232076-G-A p.Thr749Met missense AFF4 2 83278 2.40159E-5 41639 0 3.18451E-5
5-132232082-T-C p.Lys747Arg missense AFF4 4 83284 4.80284E-5 41642 0 4.94805E-5
5-132232098-T-C p.Lys742Glu missense AFF4 1 83322 1.20016E-5 41661 0 3.1835E-5
5-132232113-G-A p.Pro737Ser missense AFF4 3 83328 3.60023E-5 41664 0 1.64826E-5
5-132232114-C-T p.Pro736Pro synonymous AFF4 3 83330 3.60014E-5 41665 0 2.3873E-5
5-132232115-G-A p.Pro736Leu missense AFF4 2 83326 2.40021E-5 41663 0 0.00125
5-132232115-G-T p.Pro736Gln missense AFF4 1 83326 1.20011E-5 41663 0 3.18593E-5
5-132232148-C-G p.Arg725Thr missense AFF4 11 83324 1.32015E-4 41662 0 4.4586E-4
5-132232148-C-T p.Arg725Lys missense AFF4 1 83322 1.20016E-5 41661 0 3.97893E-6
5-132232161-T-C p.Asn721Asp missense AFF4 1 83312 1.20031E-5 41656 0 NA
5-132232172-T-C p.Lys717Arg missense AFF4 2 83308 2.40073E-5 41654 0 3.97763E-6
5-132232183-T-A p.Pro713Pro synonymous AFF4 1 83290 1.20062E-5 41645 0 NA
5-132232199-G-A p.Pro708Leu missense AFF4 1 83272 1.20088E-5 41636 0 3.18512E-5
5-132232210-G-A p.Pro704Pro synonymous AFF4 1 83252 1.20117E-5 41626 0 3.18552E-5
5-132232211-G-A p.Pro704Leu missense AFF4 4 83246 4.80504E-5 41623 0 1.64742E-5
5-132232226-T-G p.Lys699Thr missense AFF4 1 83238 1.20137E-5 41619 0 NA
5-132232229-T-C p.Glu698Gly missense AFF4 1 83232 1.20146E-5 41616 0 NA
5-132232232-T-A p.Glu697Val missense AFF4 1 83232 1.20146E-5 41616 0 8.23696E-6
5-132232236-T-A p.Met696Leu missense AFF4 1 83212 1.20175E-5 41606 0 NA
5-132232236-T-C p.Met696Val missense AFF4 2 83212 2.4035E-5 41606 0 1.64739E-5
5-132232246-C-A p.Met692Ile missense AFF4 1 83194 1.20201E-5 41597 0 3.97902E-6
5-132232247-A-G p.Met692Thr missense AFF4 1 83204 1.20187E-5 41602 0 NA
5-132232250-C-T p.Arg691Gln missense AFF4 2 83196 2.40396E-5 41598 0 1.19376E-5
5-132232256-C-T p.Arg689Gln missense AFF4 1 83200 1.20192E-5 41600 0 8.23683E-6
5-132232289-G-A p.Pro678Leu missense AFF4 4 83256 4.80446E-5 41628 0 5.57107E-5
5-132232295-A-C p.Val676Gly missense AFF4 5 83270 6.00456E-5 41635 0 3.18532E-5
5-132232296-C-G p.Val676Leu missense AFF4 1 83274 1.20085E-5 41637 0 3.18492E-5
5-132232296-CAGG-C p.Pro675del conservative_inframe_deletion AFF4 1 83274 1.20085E-5 41637 0 4.11896E-5
5-132232306-A-G p.Asn672Asn synonymous AFF4 4 83270 4.80365E-5 41635 0 4.11963E-5
5-132232308-T-C p.Asn672Asp missense AFF4 1 83270 1.20091E-5 41635 0 NA
5-132232310-C-T p.Ser671Asn missense AFF4 1 83256 1.20111E-5 41628 0 NA
5-132232314-C-T p.Glu670Lys missense AFF4 1 83254 1.20114E-5 41627 0 3.98004E-6
5-132232315-G-A p.Pro669Pro synonymous AFF4 11015 83098 0.132554 41549 812 0.23875
5-132232315-G-C p.Pro669Pro synonymous AFF4 7 83254 8.408E-5 41627 0 1.89553E-4
5-132232316-G-T p.Pro669His missense AFF4 1 83258 1.20109E-5 41629 0 NA
5-132232317-G-A p.Pro669Ser missense AFF4 1 83254 1.20114E-5 41627 0 8.24226E-6
5-132232323-T-C p.Lys667Glu missense AFF4 1 83250 1.2012E-5 41625 0 NA
5-132232326-G-T p.Pro666Thr missense AFF4 2 83246 2.40252E-5 41623 0 8.24348E-6
5-132232326-G-A p.Pro666Ser missense AFF4 2 83246 2.40252E-5 41623 0 NA
5-132232340-G-C p.Pro661Arg missense AFF4 1 83230 1.20149E-5 41615 0 3.58275E-5
5-132232341-G-C p.Pro661Ala missense AFF4 1 83224 1.20158E-5 41612 0 NA
5-132232341-G-A p.Pro661Ser missense AFF4 1 83224 1.20158E-5 41612 0 NA
5-132232347-G-A p.Leu659Phe missense AFF4 1 83208 1.20181E-5 41604 0 8.24661E-6
5-132232375-T-A p.Ser649Ser synonymous AFF4 2 83044 2.40836E-5 41522 0 NA
5-132232376-G-A p.Ser649Leu missense AFF4 1 83036 1.2043E-5 41518 0 NA
5-132232395-T-C p.Ile643Val missense AFF4 18 82924 2.17066E-4 41462 0 5.09489E-4
5-132232405-T-C p.Lys639Lys synonymous AFF4 1 82860 1.20685E-5 41430 0 NA
5-132232408-C-G p.Gln638His missense AFF4 1 82840 1.20715E-5 41420 0 NA
5-132232429-C-T p.Lys631Lys synonymous AFF4 1 82794 1.20782E-5 41397 0 NA
5-132232433-T-C p.Tyr630Cys missense AFF4 5 82816 6.03748E-5 41408 0 6.37024E-5
5-132232476-CCTT-C p.Lys615del conservative_inframe_deletion AFF4 3 82484 3.63707E-5 41242 0 1.19669E-5
5-132232483-T-C p.Ile613Met missense AFF4 2 82468 2.42518E-5 41234 0 2.47423E-5
5-132232487-T-C p.Asn612Ser missense AFF4 8 82460 9.70167E-5 41230 0 7.42256E-5
5-132232556-G-T p.Pro589His missense AFF4 1 82488 1.2123E-5 41244 0 3.29799E-5
5-132232559-GT-G p.Thr588fs frameshift AFF4 1 82462 1.21268E-5 41231 0 NA
5-132232582-T-C p.Gly580Gly synonymous AFF4 1 82488 1.2123E-5 41244 0 NA
5-132232587-G-T p.Arg579Ser missense AFF4 2 82494 2.42442E-5 41247 0 NA
5-132232599-C-A p.Ala575Ser missense AFF4 1 82484 1.21236E-5 41242 0 6.25E-4
5-132232606-C-A p.Lys572Asn missense AFF4 1 82534 1.21162E-5 41267 0 NA
5-132232614-C-A p.Ala570Ser missense AFF4 2 82554 2.42266E-5 41277 0 1.59476E-5
5-132232640-GTTC-G p.Arg560del disruptive_inframe_deletion AFF4 2 82850 2.414E-5 41425 0 1.19531E-5
5-132232640-G-T p.Thr561Asn missense AFF4 2 82850 2.414E-5 41425 0 3.98438E-6
5-132232649-T-G p.Gln558Pro missense AFF4 3 82986 3.61507E-5 41493 0 9.55353E-5
5-132232670-G-A p.Ala551Val missense AFF4 1 83110 1.20322E-5 41555 0 3.98086E-6
5-132232671-C-T p.Ala551Thr missense AFF4 1 83120 1.20308E-5 41560 0 8.23778E-6
5-132232676-G-C p.Ser549Cys missense AFF4 1 83142 1.20276E-5 41571 0 3.98073E-6
5-132232676-G-T p.Ser549Tyr missense AFF4 1 83142 1.20276E-5 41571 0 1.19422E-5
5-132232715-A-G p.Ile536Thr missense AFF4 4 83292 4.80238E-5 41646 0 9.58405E-5
5-132232715-A-T p.Ile536Asn missense AFF4 1 83292 1.2006E-5 41646 0 NA
5-132232717-G-C p.Thr535Thr synonymous AFF4 1 83294 1.20057E-5 41647 0 8.23642E-5
5-132232723-G-A p.Ser533Ser synonymous AFF4 1 83300 1.20048E-5 41650 0 3.18695E-5
5-132232730-C-T p.Arg531Gln missense AFF4 1 83302 1.20045E-5 41651 0 4.11828E-5
5-132232733-C-A p.Gly530Val missense AFF4 4 83312 4.80123E-5 41656 0 1.59144E-5
5-132232735-C-T p.Pro529Pro synonymous AFF4 5 83310 6.00168E-5 41655 0 3.18552E-5
5-132232736-G-A p.Pro529Leu missense AFF4 13 83312 1.5604E-4 41656 0 2.02912E-4
5-132232743-C-T p.Ala527Thr missense AFF4 1 83314 1.20028E-5 41657 0 6.25E-4
5-132232744-G-A p.Ser526Ser synonymous AFF4 3 83314 3.60084E-5 41657 0 1.59113E-5
5-132232760-G-C p.Pro521Arg missense AFF4 1 83332 1.20002E-5 41666 0 3.18634E-5
5-132232763-C-A p.Gly520Val missense AFF4 2 83338 2.39987E-5 41669 0 3.97757E-6
5-132232766-C-T p.Ser519Asn missense AFF4 1 83336 1.19996E-5 41668 0 3.97712E-6
5-132232767-T-C p.Ser519Gly missense AFF4 1 83340 1.1999E-5 41670 0 NA
5-132232782-T-TAGC p.Asn513_Ser514insAla conservative_inframe_insertion AFF4 1 83344 1.19985E-5 41672 0 NA
5-132232792-G-A p.Gly510Gly synonymous AFF4 35 83338 4.19976E-4 41669 0 0.00101943
5-132232803-G-T p.Arg507Arg synonymous AFF4 1 83322 1.20016E-5 41661 0 8.23642E-6
5-132232834-G-A p.Ile496Ile synonymous AFF4 2 83262 2.40206E-5 41631 0 5.03525E-4
5-132232849-T-C p.Ser491Ser synonymous AFF4 1 83234 1.20143E-5 41617 0 3.1841E-5
5-132232855-G-A p.Ala489Ala synonymous AFF4 2 83216 2.40338E-5 41608 0 9.55536E-5
5-132232857-C-T p.Ala489Thr missense AFF4 1 83204 1.20187E-5 41602 0 1.64758E-5
5-132232858-G-A p.Pro488Pro synonymous AFF4 1 83206 1.20184E-5 41603 0 3.18573E-5
5-132232918-T-C p.Pro468Pro synonymous AFF4 2 83120 2.40616E-5 41560 0 7.46702E-5
5-132232921-C-T p.Pro467Pro synonymous AFF4 5 83100 6.01685E-5 41550 0 1.8284E-4
5-132232921-C-A p.Pro467Pro synonymous AFF4 3 83100 3.61011E-5 41550 0 8.31089E-6
5-132232935-G-GA c.1390-4_1390-3insT splice_region AFF4 2 82990 2.40993E-5 41495 1 NA
5-132233925-G-A p.Pro462Pro synonymous AFF4 3 83246 3.60378E-5 41623 0 3.2987E-5
5-132233927-G-A p.Pro462Ser missense AFF4 1 83240 1.20135E-5 41620 0 NA
5-132233934-A-C p.Ser459Arg missense AFF4 1 83254 1.20114E-5 41627 0 3.18817E-5
5-132233935-C-G p.Ser459Thr missense AFF4 2 83260 2.40211E-5 41630 0 NA
5-132233936-T-G p.Ser459Arg missense AFF4 2 83254 2.40229E-5 41627 0 3.18613E-5
5-132233940-G-C p.Ser457Ser synonymous AFF4 1 83262 1.20103E-5 41631 0 8.24171E-6
5-132233964-A-G p.Ser449Ser synonymous AFF4 1 83272 1.20088E-5 41636 0 NA
5-132233982-C-T p.Glu443Glu synonymous AFF4 1 83260 1.20106E-5 41630 0 NA
5-132233993-A-T p.Ser440Thr missense AFF4 1 83262 1.20103E-5 41631 0 3.18654E-5
5-132234026-T-C p.Ser429Gly missense AFF4 2 83264 2.402E-5 41632 0 1.64742E-5
5-132234027-A-G p.Ser428Ser synonymous AFF4 1 83272 1.20088E-5 41636 0 NA
5-132234036-C-T p.Arg425Arg synonymous AFF4 1 83258 1.20109E-5 41629 0 3.18512E-5
5-132234038-T-G p.Arg425Arg synonymous AFF4 2 83254 2.40229E-5 41627 0 3.97795E-6
5-132234045-A-G p.Asp422Asp synonymous AFF4 1 83252 1.20117E-5 41626 0 NA
5-132234054-T-C p.Glu419Glu synonymous AFF4 3 83254 3.60343E-5 41627 0 3.2962E-5
5-132234070-G-A p.Ser414Leu missense AFF4 1 83214 1.20172E-5 41607 0 NA
5-132234074-G-T p.Pro413Thr missense AFF4 6 83194 7.21206E-5 41597 0 3.19714E-5
5-132234792-C-T c.1226+4G>A splice_region AFF4 1 82554 1.21133E-5 41277 0 NA
5-132234808-C-A p.Ser405Ile missense AFF4 2 82680 2.41896E-5 41340 0 NA
5-132234813-C-T p.Pro403Pro synonymous AFF4 3 82616 3.63126E-5 41308 0 9.55718E-5
5-132234814-G-A p.Pro403Leu missense AFF4 1 82600 1.21065E-5 41300 0 7.96242E-6
5-132234818-T-C p.Met402Val missense AFF4 3 82652 3.62968E-5 41326 0 5.97158E-5
5-132234826-T-C p.Asp399Gly missense AFF4 2 82674 2.41914E-5 41337 0 NA
5-132234827-C-T p.Asp399Asn missense AFF4 1 82668 1.20966E-5 41334 0 NA
5-132235285-C-T p.Gly394Gly synonymous AFF4 1 82716 1.20896E-5 41358 0 1.64834E-5
5-132235291-A-G p.Ser392Ser synonymous AFF4 1 82720 1.2089E-5 41360 0 NA
5-132235313-T-C p.Lys385Arg missense AFF4 3 82714 3.62696E-5 41357 0 2.71936E-4
5-132235332-T-C p.Met379Val missense+splice_region AFF4 6 82628 7.26146E-5 41314 0 9.55475E-5
5-132235333-A-AGATTTAGACTGGTGCCCATTTGAAGTTTTAGAAGGATTATATCTTTTTTGTTCTC c.1134-1_1134insGAGAACAAAAAAGATATAATCCTTCTAAAACTTCAAATGGGCACCAGTCTAAATC splice_acceptor AFF4 1 82644 1.21001E-5 41322 0 NA
5-132236558-C-T n.211+6G>A splice_region AFF4 2 24220 8.25764E-5 12110 0 NA
5-132236562-A-G n.211+2T>C splice_donor AFF4 5 24230 2.06356E-4 12115 0 NA
5-132238126-A-C c.1133+8T>G splice_region AFF4 2 82462 2.42536E-5 41231 0 NA
5-132238131-T-C c.1133+3A>G splice_region AFF4 1 82520 1.21183E-5 41260 0 NA
5-132238153-T-C p.Asn372Asp missense AFF4 1 82722 1.20887E-5 41361 0 3.18471E-5
5-132238158-G-A p.Thr370Ile missense AFF4 4 82698 4.83688E-5 41349 0 NA
5-132238163-A-G p.Ser368Ser synonymous AFF4 2 82740 2.41721E-5 41370 0 3.1837E-5
5-132239876-GAGATCGAGGCTGCAGTGAGCTACGACCACACCACTACACTCC-G n.1348-46_1348-5delGGAGTGTAGTGGTGTGGTCGTAGCTCACTGCAGCCTCGATCT splice_region AFF4 2861 53792 0.0531863 26896 63 0.225947
5-132239877-AG-A n.1348-6delC splice_region AFF4 1 56972 1.75525E-5 28486 0 3.35503E-5
5-132239878-GATCGAGGCTGCAGTGAGCTACGACCACACCACTACACTCCAGA-G n.1348-49_1348-7delTCTGGAGTGTAGTGGTGTGGTCGTAGCTCACTGCAGCCTCGAT splice_region AFF4 13 56970 2.2819E-4 28485 0 0.0253049
5-132239878-G-A n.1348-6C>T splice_region AFF4 16 57108 2.80171E-4 28554 0 9.14634E-4
5-132239878-GATCGAGGCTGCAGTGAGCTACGACCACACCACTACACTCCAGAAA-G n.1348-51_1348-7delTTTCTGGAGTGTAGTGGTGTGGTCGTAGCTCACTGCAGCCTCGAT splice_region AFF4 1 57110 1.75101E-5 28555 0 2.51458E-5
5-132239878-GATCGAGGCTGCAGTGAGCTACGACCACACCACTACACTCCAGAA-G n.1348-50_1348-7delTTCTGGAGTGTAGTGGTGTGGTCGTAGCTCACTGCAGCCTCGAT splice_region AFF4 1 57106 1.75113E-5 28553 0 6.09756E-4
5-132239879-ATCGAGGCTGCAGTGAGCTACGACCACACCACTACACTCCAG-A n.1348-48_1348-8delCTGGAGTGTAGTGGTGTGGTCGTAGCTCACTGCAGCCTCGA splice_region AFF4 93 55952 0.00166214 27976 0 0.0513824
5-132239879-ATCG-A n.1348-10_1348-8delCGA splice_region AFF4 7 56934 1.22949E-4 28467 0 5.32495E-4
5-132239879-ATCGAGGCTGCAGTGAGCTACGACCACACCACTACACTCC-A n.1348-46_1348-8delGGAGTGTAGTGGTGTGGTCGTAGCTCACTGCAGCCTCGA splice_region AFF4 3 57000 5.26316E-5 28500 0 2.66247E-4
5-132240061-T-C p.Gln362Gln splice_region+synonymous AFF4 1 82722 1.20887E-5 41361 0 NA
5-132240080-T-C p.Asn356Ser missense AFF4 10 82784 1.20796E-4 41392 0 6.25E-4
5-132240093-A-T p.Ser352Thr missense AFF4 2 82718 2.41785E-5 41359 0 8.52893E-6
5-132240098-TAAGA-T c.1051-6_1051-3delTCTT splice_region AFF4 1 82682 1.20945E-5 41341 0 4.11526E-6
5-132262392-CTTTT-C n.1726_1729delAAAA splice_region AFF4 1 200 0.005 100 0 0.0195853
5-132262818-T-C p.Thr349Ala missense AFF4 3 83058 3.61193E-5 41529 0 NA
5-132262820-G-A p.Pro348Leu missense AFF4 1 83056 1.20401E-5 41528 0 8.29132E-6
5-132262872-G-C p.Leu331Val missense AFF4 1 83194 1.20201E-5 41597 0 NA
5-132262876-G-A p.Pro329Pro synonymous AFF4 1 83194 1.20201E-5 41597 0 5.05051E-4
5-132262878-G-A p.Pro329Ser missense AFF4 1 83182 1.20218E-5 41591 0 8.26761E-6
5-132262891-C-T p.Thr324Thr synonymous AFF4 1 83154 1.20259E-5 41577 0 NA
5-132262892-G-A p.Thr324Met missense AFF4 1 83142 1.20276E-5 41571 0 6.36983E-5
5-132267870-T-C p.Lys321Lys splice_region+synonymous AFF4 1 81880 1.2213E-5 40940 0 NA
5-132267876-G-T p.Ile319Ile synonymous AFF4 3 82176 3.6507E-5 41088 0 4.22076E-6
5-132267889-C-T p.Cys315Tyr missense AFF4 3 82530 3.63504E-5 41265 0 NA
5-132267895-A-C p.Val313Gly missense AFF4 1 82604 1.2106E-5 41302 0 4.07508E-6
5-132267914-C-T p.Ala307Thr missense+splice_region AFF4 1 82596 1.21071E-5 41298 0 NA
5-132267918-G-C c.919-4C>G splice_region AFF4 2 82590 2.4216E-5 41295 0 6.38692E-5
5-132267921-A-C c.919-7T>G splice_region AFF4 29 82576 3.51192E-4 41288 0 1.59246E-4
5-132269839-A-G p.Asp306Asp splice_region+synonymous AFF4 31 83274 3.72265E-4 41637 0 7.32344E-4
5-132269848-T-C p.Gln303Gln synonymous AFF4 8 83308 9.60292E-5 41654 0 1.27429E-4
5-132269869-G-A p.Thr296Thr synonymous AFF4 2 83364 2.39912E-5 41682 0 9.55597E-5
5-132269879-G-A p.Ala293Val missense AFF4 1 83386 1.19924E-5 41693 0 NA
5-132269900-T-A p.Glu286Val missense AFF4 1 83376 1.19939E-5 41688 0 3.18532E-5
5-132269912-T-C p.Asn282Ser missense AFF4 4 83388 4.79685E-5 41694 0 3.1837E-5
5-132269913-T-G p.Asn282His missense AFF4 2 83388 2.39843E-5 41694 0 7.95361E-5
5-132269927-C-G p.Ser277Thr missense AFF4 67 83384 8.03511E-4 41692 0 0.00151057
5-132269932-G-A p.Tyr275Tyr synonymous AFF4 2 83390 2.39837E-5 41695 0 8.23886E-6
5-132269938-C-T p.Glu273Glu synonymous AFF4 208 83382 0.00249454 41691 2 0.00388634
5-132269942-G-C p.Ser272Cys missense AFF4 1 83394 1.19913E-5 41697 0 NA
5-132269947-C-T p.Leu270Leu synonymous AFF4 346 83394 0.00414898 41697 4 0.00805886
5-132269953-T-C p.Pro268Pro synonymous AFF4 1 83388 1.19921E-5 41694 0 3.97633E-6
5-132269974-G-A p.Asp261Asp synonymous AFF4 6 83402 7.19407E-5 41701 0 5.03525E-4
5-132269980-G-A p.Pro259Pro synonymous AFF4 3 83400 3.59712E-5 41700 0 8.23669E-5
5-132270011-A-G p.Met249Thr missense AFF4 2 83398 2.39814E-5 41699 0 3.18593E-5
5-132270012-T-C p.Met249Val missense AFF4 4 83400 4.79616E-5 41700 0 1.19291E-5
5-132270017-T-C p.Asn247Ser missense AFF4 2 83402 2.39802E-5 41701 0 6.37024E-5
5-132270020-G-T p.Ser246Tyr missense AFF4 1 83394 1.19913E-5 41697 0 3.97643E-6
5-132270033-A-G p.Leu242Leu synonymous AFF4 3 83402 3.59704E-5 41701 0 6.37064E-5
5-132270058-G-A p.His233His synonymous AFF4 1 83406 1.19895E-5 41703 0 NA
5-132270077-G-T p.Pro227His missense AFF4 9 83396 1.07919E-4 41698 0 1.27429E-4
5-132270080-A-G p.Val226Ala missense AFF4 5 83398 5.99535E-5 41699 0 1.64728E-5
5-132270084-G-C p.Arg225Gly missense AFF4 22 83398 2.63795E-4 41699 0 3.57881E-4
5-132270084-G-A p.Arg225Cys missense AFF4 13 83398 1.55879E-4 41699 0 7.4129E-5
5-132270117-G-C p.Arg214Gly missense AFF4 1 83408 1.19893E-5 41704 0 3.97643E-6
5-132270123-A-G p.Ser212Pro missense AFF4 1 83414 1.19884E-5 41707 0 3.18735E-5
5-132270125-T-C p.Lys211Arg missense AFF4 1 83418 1.19878E-5 41709 0 3.18695E-5
5-132270133-T-C p.Gln208Gln synonymous AFF4 7 83416 8.39168E-5 41708 0 0.00125
5-132270156-C-G p.Asp201His missense AFF4 3 83416 3.59643E-5 41708 0 NA
5-132270158-T-C p.Asn200Ser missense AFF4 1 83410 1.1989E-5 41705 0 8.23642E-6
5-132270170-C-T p.Arg196Lys missense AFF4 3 83406 3.59686E-5 41703 0 4.11821E-5
5-132270176-T-C p.His194Arg missense AFF4 1 83406 1.19895E-5 41703 0 8.23642E-6
5-132270182-G-C p.Ser192Cys missense AFF4 1 83408 1.19893E-5 41704 0 NA
5-132270190-T-C p.Ser189Ser synonymous AFF4 2 83406 2.39791E-5 41703 0 6.37227E-5
5-132270194-G-A p.Ser188Phe missense AFF4 2 83400 2.39808E-5 41700 0 7.95273E-6
5-132270203-T-A p.Gln185Leu missense AFF4 210 83404 0.00251786 41702 4 0.00611177
5-132270207-G-A p.Pro184Ser missense AFF4 2 83406 2.39791E-5 41703 0 8.23642E-6
5-132270209-T-C p.Lys183Arg missense AFF4 2 83404 2.39797E-5 41702 0 NA
5-132270228-G-A p.Arg177Cys missense AFF4 6 83394 7.19476E-5 41697 0 9.8837E-5
5-132270232-T-C p.Lys175Lys synonymous AFF4 1 83396 1.1991E-5 41698 0 NA
5-132270236-G-C p.Ser174Cys missense AFF4 9 83396 1.07919E-4 41698 0 2.23029E-4
5-132270238-G-GTGT p.Glu172_His173insGln disruptive_inframe_insertion AFF4 8 83396 9.59279E-5 41698 1 0.00151057
5-132270258-C-CT p.Gly167fs frameshift AFF4 2 83404 2.39797E-5 41702 1 NA
5-132270259-T-C p.Lys166Lys synonymous AFF4 6 83404 7.1939E-5 41702 0 NA
5-132270275-C-A p.Ser161Ile missense AFF4 1 83402 1.19901E-5 41701 0 NA
5-132270285-T-G p.Asn158His missense AFF4 9 83406 1.07906E-4 41703 0 2.71811E-4
5-132270288-T-C p.Asn157Asp missense AFF4 2 83408 2.39785E-5 41704 0 NA
5-132270290-T-C p.Tyr156Cys missense AFF4 1 83406 1.19895E-5 41703 0 3.18532E-5
5-132270299-C-T p.Arg153His missense AFF4 7 83398 8.39349E-5 41699 0 6.37389E-5
5-132270300-G-A p.Arg153Cys missense AFF4 1 83402 1.19901E-5 41701 0 NA
5-132270302-T-C p.Asp152Gly missense AFF4 1 83400 1.19904E-5 41700 0 NA
5-132270304-G-A p.His151His synonymous AFF4 1 83398 1.19907E-5 41699 0 6.76014E-5
5-132270314-C-A p.Gly148Val missense+splice_region AFF4 1 83392 1.19916E-5 41696 0 8.23683E-6
5-132270320-C-G p.Ser146Thr missense AFF4 1 83398 1.19907E-5 41699 0 8.23669E-6
5-132270330-C-T p.Gly143Ser missense AFF4 11 83394 1.31904E-4 41697 0 8.60092E-4
5-132270346-G-A p.Ser137Ser synonymous AFF4 2 83382 2.3986E-5 41691 0 6.37227E-5
5-132270349-G-A p.Thr136Thr synonymous AFF4 1 83386 1.19924E-5 41693 0 1.64745E-5
5-132270351-T-G p.Thr136Pro missense AFF4 453 83386 0.00543257 41693 7 0.00981329
5-132270353-C-T p.Arg135Gln missense AFF4 2 83388 2.39843E-5 41694 0 1.64745E-5
5-132270357-G-GGCT p.Ser133dup conservative_inframe_insertion AFF4 1 83384 1.19927E-5 41692 0 NA
5-132270384-A-G p.Ser125Pro missense AFF4 1 83402 1.19901E-5 41701 0 NA
5-132270390-G-A p.Arg123Trp missense AFF4 2 83394 2.39825E-5 41697 0 3.18512E-5
5-132270410-C-T p.Ser116Asn missense AFF4 1 83396 1.1991E-5 41698 0 NA
5-132270414-G-A p.Pro115Ser missense AFF4 1 83400 1.19904E-5 41700 0 NA
5-132270414-G-T p.Pro115Thr missense AFF4 1 83400 1.19904E-5 41700 0 NA
5-132270417-C-T p.Ala114Thr missense AFF4 6 83398 7.19442E-5 41699 0 3.18674E-5
5-132270417-C-A p.Ala114Ser missense AFF4 1 83398 1.19907E-5 41699 0 NA
5-132270418-G-A p.Pro113Pro synonymous AFF4 47 83396 5.63576E-4 41698 1 4.49419E-4
5-132270428-G-A p.Pro110Leu missense AFF4 1 83394 1.19913E-5 41697 0 1.64747E-5
5-132270472-A-G p.Phe95Phe synonymous AFF4 2 83378 2.39871E-5 41689 0 NA
5-132270481-T-G p.Pro92Pro synonymous AFF4 1 83364 1.19956E-5 41682 0 3.97668E-6
5-132270490-T-C p.Lys89Lys synonymous AFF4 2 83362 2.39917E-5 41681 0 NA
5-132270514-T-C p.Thr81Thr synonymous AFF4 1 83356 1.19967E-5 41678 0 5.03525E-4
5-132270528-T-C p.Ile77Val missense AFF4 1 83356 1.19967E-5 41678 0 8.23845E-6
5-132270556-T-C p.Gly67Gly synonymous AFF4 1 83348 1.19979E-5 41674 0 7.95976E-6
5-132270575-T-C p.Glu61Gly missense AFF4 1 83344 1.19985E-5 41672 0 NA
5-132270577-A-G p.Asp60Asp synonymous AFF4 1 83342 1.19988E-5 41671 0 1.19633E-5
5-132270580-G-A p.Tyr59Tyr synonymous AFF4 13 83346 1.55976E-4 41673 0 0.00151057
5-132270583-G-A p.Asn58Asn synonymous AFF4 1 83344 1.19985E-5 41672 0 NA
5-132270586-T-G p.Gly57Gly synonymous AFF4 1 83336 1.19996E-5 41668 0 NA
5-132270596-C-T p.Ser54Asn missense AFF4 1 83340 1.1999E-5 41670 0 8.31103E-6
5-132270609-T-C p.Ser50Gly missense AFF4 1 83134 1.20288E-5 41567 0 8.35911E-6
5-132270624-CTTT-C p.Lys44del conservative_inframe_deletion AFF4 2 82818 2.41493E-5 41409 0 NA
5-132270625-T-C p.Lys44Lys synonymous AFF4 1 82556 1.2113E-5 41278 0 NA
5-132270637-C-CA c.124-5_124-4insT splice_region AFF4 1 81894 1.22109E-5 40947 0 1.77085E-5
5-132270640-AAAAAT-A c.124-12_124-8delATTTT splice_region AFF4 8 81790 9.78115E-5 40895 0 8.08146E-5
5-132272787-G-A p.Ser32Phe missense AFF4 1 83360 1.19962E-5 41680 0 NA
5-132272797-G-A p.Pro29Ser missense AFF4 1 83372 1.19944E-5 41686 0 3.97716E-6
5-132272798-G-T p.Phe28Leu missense AFF4 1 83374 1.19941E-5 41687 0 3.97716E-6
5-132272801-G-A p.Ala27Ala synonymous AFF4 5 83372 5.99722E-5 41686 0 3.18177E-5
5-132272809-C-T p.Glu25Lys missense AFF4 4 83390 4.79674E-5 41695 0 6.36659E-5
5-132272835-C-T p.Arg16Lys missense AFF4 1 83390 1.19918E-5 41695 0 NA
5-132272841-C-T p.Arg14Gln missense AFF4 2 83390 2.39837E-5 41695 0 3.1841E-5
5-132272843-T-A p.Glu13Asp missense AFF4 2 83394 2.39825E-5 41697 0 NA
5-132272851-T-C p.Met11Val missense AFF4 1 83398 1.19907E-5 41699 0 7.95988E-6
5-132272866-G-A p.Arg6Trp missense AFF4 1 83386 1.19924E-5 41693 0 3.18471E-5
5-132272874-C-T p.Arg3His missense AFF4 3 83368 3.5985E-5 41684 0 4.01252E-6