Variant

Variant ID Consequence Effect Gene AC AN AF NS NHOM maxEAF
4-87869645-T-C c.-36-5T>C splice_region AFF1 1 77706 1.2869E-5 38853 0 NA
4-87869691-A-C p.Ala2Ala synonymous AFF1 9 78212 1.15072E-4 39106 0 5.09359E-4
4-87869696-C-G p.Thr4Arg missense AFF1 2 78224 2.55676E-5 39112 0 NA
4-87869706-C-T p.Val7Val synonymous AFF1 1 78222 1.27841E-5 39111 0 NA
4-87928204-C-T c.-356C>T 5_prime_UTR_premature_start_codon_gain AFF1 18475 26244 0.70397 13122 6705 0.633484
4-87928282-C-G c.-278C>G 5_prime_UTR_premature_start_codon_gain AFF1 1 40798 2.4511E-5 20399 0 NA
4-87928298-C-T c.-262C>T 5_prime_UTR_premature_start_codon_gain AFF1 2 44410 4.50349E-5 22205 0 NA
4-87928320-C-G c.-240C>G 5_prime_UTR_premature_start_codon_gain AFF1 9 54854 1.64072E-4 27427 0 9.57182E-5
4-87928344-A-C c.-216A>C 5_prime_UTR_premature_start_codon_gain AFF1 1 64176 1.55821E-5 32088 0 NA
4-87928352-C-G c.-208C>G 5_prime_UTR_premature_start_codon_gain AFF1 3 66668 4.49991E-5 33334 0 1.91302E-4
4-87928373-C-T c.-187C>T 5_prime_UTR_premature_start_codon_gain AFF1 1 71208 1.40434E-5 35604 0 NA
4-87928378-C-T c.-182C>T 5_prime_UTR_premature_start_codon_gain AFF1 1 71880 1.39121E-5 35940 0 NA
4-87928412-C-G c.-148C>G 5_prime_UTR_premature_start_codon_gain AFF1 4 76108 5.25569E-5 38054 0 NA
4-87928437-G-T c.-123G>T 5_prime_UTR_premature_start_codon_gain AFF1 1 78094 1.28051E-5 39047 0 NA
4-87928444-C-T c.-116C>T 5_prime_UTR_premature_start_codon_gain AFF1 1437 77560 0.0185276 38780 27 0.0408717
4-87928449-C-T c.-111C>T 5_prime_UTR_premature_start_codon_gain AFF1 1 78080 1.28074E-5 39040 0 3.18898E-5
4-87928462-C-T c.-98C>T 5_prime_UTR_premature_start_codon_gain AFF1 14 78908 1.77422E-4 39454 0 4.46457E-4
4-87928481-G-C c.-79G>C 5_prime_UTR_premature_start_codon_gain AFF1 5 79976 6.25188E-5 39988 0 3.18695E-5
4-87928530-C-T c.-30C>T 5_prime_UTR_premature_start_codon_gain AFF1 2 81050 2.46761E-5 40525 0 1.59368E-4
4-87928553-C-T c.-7C>T 5_prime_UTR_premature_start_codon_gain AFF1 2 80930 2.47127E-5 40465 0 NA
4-87928558-TTA-CTG p.Met1? initiator_codon AFF1 2 80840 2.47402E-5 40420 0 NA
4-87928569-C-T p.Gln4* stop_gained AFF1 1 80384 1.24403E-5 40192 0 8.27239E-6
4-87928576-G-GTTT c.17_17+1insTTT splice_donor AFF1 1 80090 1.2486E-5 40045 0 NA
4-87967313-AAC-A c.18-4_18-3delAC splice_region AFF1 1 83288 1.20065E-5 41644 0 NA
4-87967323-A-G p.Tyr8Cys missense AFF1 3 83312 3.60092E-5 41656 0 4.80061E-5
4-87967323-A-T p.Tyr8Phe missense AFF1 1 83312 1.20031E-5 41656 0 6.3678E-5
4-87967326-A-G p.Asn9Ser missense AFF1 1 83312 1.20031E-5 41656 0 2.47231E-5
4-87967330-C-T c.-148C>T 5_prime_UTR_premature_start_codon_gain AFF1 29 83304 3.48123E-4 41652 0 4.83076E-4
4-87967331-G-A p.Asp11Asn missense AFF1 4 83306 4.80158E-5 41653 0 5.04032E-4
4-87967335-G-A p.Arg12Lys missense AFF1 1 83308 1.20036E-5 41654 0 8.23927E-6
4-87967339-C-T p.Asn13Asn synonymous AFF1 315 83300 0.00378151 41650 3 0.00375
4-87967340-C-G p.Leu14Val missense AFF1 1 83306 1.20039E-5 41653 0 NA
4-87967353-G-A p.Arg18Lys missense AFF1 1 83300 1.20048E-5 41650 0 3.1837E-5
4-87967354-A-G p.Arg18Arg synonymous AFF1 1 83302 1.20045E-5 41651 0 1.19402E-5
4-87967367-C-T p.Arg23Cys missense AFF1 2 83314 2.40056E-5 41657 0 4.94258E-5
4-87967372-C-T p.Asn24Asn synonymous AFF1 15 83304 1.80063E-4 41652 0 1.27437E-4
4-87967375-G-C p.Gln25His missense AFF1 1 83308 1.20036E-5 41654 0 3.97829E-6
4-87967380-C-A p.Ala27Asp missense AFF1 1 83304 1.20042E-5 41652 0 NA
4-87967390-G-GA p.Glu32fs frameshift AFF1 1 83306 1.20039E-5 41653 0 NA
4-87967396-G-A p.Glu32Glu synonymous AFF1 1 83300 1.20048E-5 41650 0 NA
4-87967399-A-G p.Ala33Ala synonymous AFF1 562 83300 0.0067467 41650 11 0.0139818
4-87967400-T-C p.Phe34Leu missense AFF1 1 83314 1.20028E-5 41657 0 6.37308E-5
4-87967402-T-C p.Phe34Phe synonymous AFF1 2 83310 2.40067E-5 41655 0 NA
4-87967435-C-CAAGACAGCAA p.Lys37fs frameshift AFF1 1 83284 1.20071E-5 41642 0 NA
4-87967438-G-GACAGCAAAAGGTGATGAGCTGTCTAGTCGAATACAGAACAT c.138_138+1insACAGCAAAAGGTGATGAGCTGTCTAGTCGAATACAGAACAT splice_donor AFF1 2 83282 2.40148E-5 41641 1 NA
4-87967438-G-GACAGCAAAAGGTGATGAGCTGTCTAGTCGAATACA c.138_138+1insACAGCAAAAGGTGATGAGCTGTCTAGTCGAATACA splice_donor AFF1 4 83282 4.80296E-5 41641 2 NA
4-87967438-G-GACAGCAAAAGGTGATGAGCTGTCTAGTCGAATACAGAACATGTT c.138_138+1insACAGCAAAAGGTGATGAGCTGTCTAGTCGAATACAGAACATGTT splice_donor AFF1 2 83282 2.40148E-5 41641 1 NA
4-87967848-C-T p.Thr47Ile missense+splice_region AFF1 3 83070 3.61141E-5 41535 0 1.2812E-5
4-87967860-A-G p.Asp51Gly missense AFF1 1 83190 1.20207E-5 41595 0 NA
4-87967900-C-T p.Tyr64Tyr synonymous AFF1 1 83314 1.20028E-5 41657 0 3.18654E-5
4-87967911-A-G p.Lys68Arg missense AFF1 3 83322 3.60049E-5 41661 0 3.18492E-5
4-87967918-C-T p.Phe70Phe synonymous AFF1 4 83348 4.79916E-5 41674 0 8.23791E-5
4-87967926-C-T p.Thr73Ile missense AFF1 2 83352 2.39946E-5 41676 0 6.37064E-5
4-87967926-C-G p.Thr73Ser missense AFF1 1 83352 1.19973E-5 41676 0 3.97668E-6
4-87967927-T-G p.Thr73Thr synonymous AFF1 42 83352 5.03887E-4 41676 0 0.00125
4-87967943-C-G p.Arg79Gly missense AFF1 1 83358 1.19964E-5 41679 0 3.29478E-5
4-87967944-G-A p.Arg79His missense AFF1 10 83352 1.19973E-4 41676 0 1.40028E-4
4-87967945-C-T p.Arg79Arg synonymous AFF1 4 83350 4.79904E-5 41675 1 NA
4-87967953-C-T p.Ala82Val missense AFF1 2 83358 2.39929E-5 41679 0 NA
4-87967977-C-T p.Pro90Leu missense AFF1 18 83336 2.15993E-4 41668 0 2.22958E-4
4-87967978-G-A p.Pro90Pro synonymous AFF1 8 83340 9.59923E-5 41670 0 1.97697E-4
4-87967989-T-C p.Leu94Ser missense AFF1 25 83326 3.00026E-4 41663 0 1.94848E-4
4-87967996-T-C p.Pro96Pro synonymous AFF1 21 83330 2.5201E-4 41665 0 0.00125
4-87968010-G-A p.Ser101Asn missense AFF1 5 83312 6.00154E-5 41656 0 2.47109E-5
4-87968017-A-G p.Pro103Pro synonymous AFF1 1 83310 1.20034E-5 41655 0 8.23696E-6
4-87968041-C-T p.Val52Val splice_region+synonymous AFF1 36 83266 4.32349E-4 41633 0 0.00168747
4-87968046-A-C p.His113Pro missense AFF1 1 83254 1.20114E-5 41627 0 NA
4-87968046-A-G p.His113Arg missense AFF1 1 83254 1.20114E-5 41627 0 3.97791E-6
4-87968061-C-T p.Thr118Ile missense AFF1 1 83210 1.20178E-5 41605 0 6.3674E-5
4-87968063-C-T p.Pro119Ser missense AFF1 2 83216 2.40338E-5 41608 0 8.23778E-6
4-87968067-C-T p.Ala120Val missense AFF1 10 83182 1.20218E-4 41591 0 0.00251762
4-87968068-G-A p.Ala120Ala synonymous AFF1 1 83174 1.2023E-5 41587 0 9.55353E-5
4-87968079-T-C p.Leu124Pro missense AFF1 1 83116 1.20314E-5 41558 0 NA
4-87968082-C-T p.Ser125Phe missense AFF1 1 83096 1.20343E-5 41548 0 NA
4-87968103-A-G p.Asn132Ser missense AFF1 1 83006 1.20473E-5 41503 0 8.23832E-6
4-87968108-A-T p.Lys134* stop_gained AFF1 1 83010 1.20467E-5 41505 0 NA
4-87968111-A-G p.Met135Val missense AFF1 1 82992 1.20494E-5 41496 0 8.23859E-6
4-87968114-G-A p.Ala136Thr missense AFF1 5 82954 6.02744E-5 41477 0 2.22973E-4
4-87968115-C-T p.Ala136Val missense AFF1 5 82956 6.02729E-5 41478 0 3.18512E-5
4-87968116-G-A p.Ala136Ala synonymous AFF1 1 82956 1.20546E-5 41478 0 1.99054E-5
4-87968125-A-T p.Arg139Ser missense AFF1 1 83012 1.20465E-5 41506 0 NA
4-87968137-G-A p.Met143Ile missense AFF1 1 83058 1.20398E-5 41529 0 8.23886E-6
4-87968161-C-T p.Cys151Cys synonymous AFF1 3 83116 3.60941E-5 41558 0 9.56084E-5
4-87968162-G-C p.Gly152Arg missense AFF1 1 83128 1.20296E-5 41564 0 1.07096E-4
4-87968162-G-A p.Gly152Ser missense AFF1 3 83128 3.60889E-5 41564 0 2.05955E-4
4-87968164-C-T p.Gly152Gly synonymous AFF1 1 83134 1.20288E-5 41567 0 NA
4-87968165-C-A p.Pro153Thr missense AFF1 49 83142 5.89353E-4 41571 0 0.00105163
4-87968166-C-T p.Pro153Leu missense AFF1 1 83144 1.20273E-5 41572 0 3.97852E-6
4-87968169-C-T p.Pro154Leu missense AFF1 1 83168 1.20239E-5 41584 0 5.76644E-5
4-87968170-G-A p.Pro154Pro synonymous AFF1 2 83192 2.40408E-5 41596 0 3.18674E-5
4-87968172-A-G p.Asp155Gly missense AFF1 1 83196 1.20198E-5 41598 0 NA
4-87968175-G-A p.Ser156Asn missense AFF1 1 83208 1.20181E-5 41604 0 NA
4-87968193-A-G p.Asp162Gly missense AFF1 2 83202 2.40379E-5 41601 0 8.23778E-6
4-87968195-C-T p.Arg163Cys missense AFF1 2 83212 2.4035E-5 41606 0 9.06111E-5
4-87968196-G-A p.Arg163His missense AFF1 1 83208 1.20181E-5 41604 0 8.23764E-6
4-87968201-G-T p.Gly165Cys missense AFF1 1 83214 1.20172E-5 41607 0 NA
4-87968212-G-A p.Gly168Gly synonymous AFF1 1 83232 1.20146E-5 41616 0 8.23655E-6
4-87968215-C-T p.Phe169Phe synonymous AFF1 30 83248 3.60369E-4 41624 0 4.46172E-4
4-87968216-G-A p.Gly170Ser missense AFF1 2 83248 2.40246E-5 41624 0 3.18674E-5
4-87968243-C-T p.Arg179* stop_gained AFF1 1 83338 1.19993E-5 41669 0 8.23655E-6
4-87968254-C-T p.Asp182Asp synonymous AFF1 5 83366 5.99765E-5 41683 0 1.59307E-4
4-87968258-G-GACC p.His185dup conservative_inframe_insertion AFF1 1 83372 1.19944E-5 41686 0 3.97665E-6
4-87968268-C-G p.Ala187Gly missense AFF1 1 83386 1.19924E-5 41693 0 NA
4-87968271-C-T p.Ser188Leu missense AFF1 2 83386 2.39848E-5 41693 0 0.00100705
4-87968275-G-T p.Val189Val synonymous AFF1 2 83396 2.3982E-5 41698 0 8.23642E-6
4-87968283-C-T p.Ser192Leu missense AFF1 2 83394 2.39825E-5 41697 0 3.18471E-5
4-87968284-G-C p.Ser192Ser synonymous AFF1 1 83398 1.19907E-5 41699 0 NA
4-87968295-G-C p.Arg196Thr missense AFF1 1 83404 1.19898E-5 41702 0 NA
4-87968302-T-G p.Leu198Leu synonymous AFF1 1 83416 1.19881E-5 41708 0 3.18654E-5
4-87968307-C-T p.Pro200Leu missense AFF1 1 83416 1.19881E-5 41708 0 3.97636E-6
4-87968325-C-G p.Ser206Cys missense AFF1 2 83414 2.39768E-5 41707 0 4.7716E-5
4-87968329-A-G p.Pro207Pro synonymous AFF1 2 83414 2.39768E-5 41707 0 3.5787E-5
4-87968330-G-T p.Val208Phe missense AFF1 1 83422 1.19872E-5 41711 0 8.23642E-6
4-87968333-C-G p.Pro209Ala missense AFF1 55 83420 6.59314E-4 41710 0 0.00130963
4-87968335-C-T p.Pro209Pro synonymous AFF1 1 83414 1.19884E-5 41707 0 3.97633E-6
4-87968348-A-G p.Ile214Val missense AFF1 4 83418 4.79513E-5 41709 0 3.18634E-5
4-87968350-A-G p.Ile214Met missense AFF1 94 83420 0.00112683 41710 0 0.00290068
4-87968372-C-A p.Pro222Thr missense AFF1 1 83416 1.19881E-5 41708 0 3.97665E-6
4-87968375-C-T p.Arg223Trp missense AFF1 12 83412 1.43864E-4 41706 0 2.86716E-4
4-87968376-G-A p.Arg223Gln missense AFF1 2 83416 2.39762E-5 41708 0 3.97674E-6
4-87968377-G-A p.Arg223Arg synonymous AFF1 1 83418 1.19878E-5 41709 0 8.23642E-6
4-87968379-C-T p.Thr224Met missense AFF1 6 83414 7.19304E-5 41707 0 6.05288E-4
4-87968380-G-A p.Thr224Thr synonymous AFF1 5 83416 5.99405E-5 41708 0 5.03525E-4
4-87968380-G-T p.Thr224Thr synonymous AFF1 1 83416 1.19881E-5 41708 0 8.23669E-6
4-87968387-A-G p.Ser227Gly missense AFF1 2 83416 2.39762E-5 41708 0 8.23642E-6
4-87968389-C-T p.Ser227Ser synonymous AFF1 1 83418 1.19878E-5 41709 0 NA
4-87968397-T-C p.Val230Ala missense AFF1 2 83418 2.39756E-5 41709 0 3.18735E-5
4-87968400-A-G p.His231Arg missense AFF1 1 83416 1.19881E-5 41708 0 8.23642E-6
4-87968401-T-C p.His231His synonymous AFF1 8 83414 9.59072E-5 41707 0 8.23655E-6
4-87968412-A-G p.Asn235Ser missense AFF1 1 83416 1.19881E-5 41708 0 NA
4-87968421-A-G p.Lys238Arg missense AFF1 1 83412 1.19887E-5 41706 0 8.23655E-6
4-87968427-A-G p.Tyr240Cys missense AFF1 4 83408 4.7957E-5 41704 0 0.00100705
4-87968432-C-T p.Pro242Ser missense AFF1 6 83404 7.1939E-5 41702 0 0.00151057
4-87968445-C-T p.Pro246Leu missense AFF1 3 83412 3.5966E-5 41706 0 3.97655E-6
4-87968446-C-T p.Pro246Pro synonymous AFF1 1 83410 1.1989E-5 41705 0 3.97662E-6
4-87968453-C-G p.Leu249Val missense AFF1 2 83410 2.39779E-5 41705 0 1.64734E-5
4-87968469-A-C p.His254Pro missense AFF1 1 83400 1.19904E-5 41700 0 3.18451E-5
4-87968495-TTGG-T p.Val264del disruptive_inframe_deletion AFF1 1 83370 1.19947E-5 41685 0 3.97741E-6
4-87968502-C-A p.Ala265Asp missense AFF1 2 83336 2.39992E-5 41668 0 2.47137E-5
4-87968503-C-T p.Ala265Ala synonymous AFF1 1 83336 1.19996E-5 41668 0 NA
4-87968505-C-T p.Pro266Leu missense AFF1 1 83326 1.20011E-5 41663 0 3.18552E-5
4-87968507-GC-TT p.Ala267Phe missense AFF1 1 83314 1.20028E-5 41657 0 NA
4-87968509-C-T p.Ala267Ala synonymous AFF1 157 83320 0.0018843 41660 0 0.00398292
4-87968512-G-C p.Gln268His missense AFF1 1 83306 1.20039E-5 41653 0 NA
4-87968514-C-T p.Pro269Leu missense AFF1 29 83304 3.48123E-4 41652 0 9.23743E-4
4-87968515-G-T p.Pro269Pro synonymous AFF1 282 83286 0.00338592 41643 1 0.00391944
4-87968515-G-A p.Pro269Pro synonymous AFF1 114 83286 0.00136878 41643 1 8.35555E-4
4-87968524-G-A p.Gln272Gln synonymous AFF1 4389 83252 0.0527195 41626 163 0.0931521
4-87968545-C-T p.Leu279Leu synonymous AFF1 1 83226 1.20155E-5 41613 0 NA
4-87968562-C-T p.Ala285Val missense AFF1 11 83222 1.32177E-4 41611 0 1.9118E-4
4-87968568-A-T p.Gln287Leu missense AFF1 5 83192 6.01019E-5 41596 0 9.5584E-5
4-87968591-C-A p.Arg295Arg synonymous AFF1 1 83128 1.20296E-5 41564 0 8.28226E-6
4-87968641-A-G p.Lys311Lys synonymous AFF1 2 82990 2.40993E-5 41495 0 NA
4-87968644-A-G p.Pro312Pro synonymous AFF1 1 82970 1.20525E-5 41485 0 8.33042E-6
4-87968645-C-T p.Leu313Leu synonymous AFF1 3 82982 3.61524E-5 41491 0 NA
4-87968649-C-T p.Pro314Leu missense AFF1 2 82966 2.41063E-5 41483 0 2.50083E-5
4-87968650-G-A p.Pro314Pro synonymous AFF1 1 82962 1.20537E-5 41481 0 7.96508E-6
4-87968660-C-G p.Arg318Gly missense AFF1 1 82944 1.20563E-5 41472 0 3.98343E-6
4-87968663-C-G p.Gln319Glu missense AFF1 2 82920 2.41196E-5 41460 0 NA
4-87968670-C-T p.Thr321Ile missense AFF1 1 82888 1.20645E-5 41444 0 8.36344E-6
4-87968674-T-C p.Phe322Phe synonymous AFF1 1 82872 1.20668E-5 41436 0 NA
4-87968677-A-G p.Glu323Glu synonymous AFF1 1 82852 1.20697E-5 41426 0 2.51256E-5
4-87968680-A-C p.Lys324Asn missense AFF1 1 82834 1.20723E-5 41417 0 8.38153E-6
4-87968695-G-A p.Val329Val synonymous AFF1 1 82568 1.21112E-5 41284 0 8.41935E-6
4-87968708-A-G p.Lys334Glu missense AFF1 2 82382 2.42771E-5 41191 0 1.27421E-4
4-87968709-A-G p.Lys334Arg missense AFF1 1 82364 1.21412E-5 41182 0 3.18512E-5
4-87968711-C-T p.Leu335Phe missense AFF1 1 82296 1.21513E-5 41148 0 NA
4-87968728-G-A p.Met340Ile missense AFF1 3 81934 3.66148E-5 40967 0 1.59246E-4
4-87968729-C-T p.Pro341Ser missense AFF1 3 81910 3.66256E-5 40955 0 6.37105E-5
4-87968729-C-G p.Pro341Ala missense AFF1 5 81910 6.10426E-5 40955 0 6.37105E-5
4-87968736-A-C p.Gln343Pro missense AFF1 27 81824 3.29977E-4 40912 0 0.0020141
4-87968738-T-A p.Ser344Thr missense AFF1 6 81780 7.33676E-5 40890 0 9.55718E-5
4-87970827-G-A p.Ala8Ala synonymous AFF1 1 10516 9.50932E-5 5258 0 5.74016E-4
4-87970864-A-G p.Arg21Gly missense AFF1 1 10516 9.50932E-5 5258 0 NA
4-87970870-C-T p.Arg23Trp missense AFF1 1 10518 9.50751E-5 5259 0 1.85736E-4
4-87970902-C-T p.Pro33Pro synonymous AFF1 1 10510 9.51475E-5 5255 0 3.11541E-5
4-88005276-C-T p.Thr354Ile missense+splice_region AFF1 2 83344 2.39969E-5 41672 0 NA
4-88005277-C-A p.Thr354Thr splice_region+synonymous AFF1 1 83338 1.19993E-5 41669 0 2.47113E-5
4-88005278-T-G p.Tyr349Asp missense AFF1 1 83338 1.19993E-5 41669 0 2.78412E-5
4-88005285-A-G p.Asn351Ser missense AFF1 1 83334 1.19999E-5 41667 0 4.94226E-5
4-88005322-T-C c.1083+6T>C splice_region AFF1 2 83300 2.40096E-5 41650 0 1.7299E-4
4-88011131-T-A c.1084-5T>A splice_region AFF1 1 83054 1.20404E-5 41527 0 NA
4-88011145-C-T p.His365Tyr missense AFF1 2 83110 2.40645E-5 41555 0 1.64921E-5
4-88011156-G-A p.Pro368Pro synonymous AFF1 79 83106 9.50593E-4 41553 0 0.00302115
4-88011161-C-T p.Pro370Leu missense AFF1 2 83130 2.40587E-5 41565 0 1.64815E-5
4-88011167-C-T p.Thr372Ile missense AFF1 1 83122 1.20305E-5 41561 0 NA
4-88011172-A-G p.Ile374Val missense AFF1 2 83124 2.40604E-5 41562 0 1.9906E-5
4-88011175-C-T p.His375Tyr missense AFF1 1 83122 1.20305E-5 41561 0 2.47207E-5
4-88011179-C-T p.Thr376Met missense AFF1 5 83104 6.01656E-5 41552 0 6.25E-4
4-88011183-T-C p.Pro377Pro synonymous AFF1 2 83112 2.40639E-5 41556 0 2.14242E-4
4-88011189-A-G p.Thr379Thr synonymous AFF1 106 83092 0.00127569 41546 0 0.00267465
4-88011202-A-C p.Lys384Gln missense AFF1 1 83040 1.20424E-5 41520 0 NA
4-88011203-A-G p.Lys384Arg missense AFF1 2 83040 2.40848E-5 41520 0 3.18471E-5
4-88011208-C-T p.Pro386Ser missense AFF1 2 83022 2.409E-5 41511 0 NA
4-88011210-T-C p.Pro386Pro synonymous AFF1 32 83016 3.85468E-4 41508 1 8.91379E-4
4-88011217-A-G p.Thr389Ala missense AFF1 2 82990 2.40993E-5 41495 0 NA
4-88011218-C-G p.Thr389Arg missense AFF1 2 82976 2.41034E-5 41488 0 NA
4-88011222-G-GGACTCTCAGCATGTCAGTTCT c.1170_1170+1insGACTCTCAGCATGTCAGTTCT splice_donor AFF1 3 82946 3.61681E-5 41473 1 NA
4-88011230-C-T c.1170+8C>T splice_region AFF1 577 82866 0.00696305 41433 2 0.00505489
4-88012945-G-A p.Asp391Asn missense+splice_region AFF1 3 82076 3.65515E-5 41038 0 6.25782E-4
4-88012950-T-C p.Ser392Ser synonymous AFF1 1 82178 1.21687E-5 41089 0 NA
4-88012952-A-G p.Gln393Arg missense AFF1 1 82226 1.21616E-5 41113 0 NA
4-88012963-TC-AT p.Ser397Ile missense AFF1 1 82382 1.21386E-5 41191 0 NA
4-88016080-A-G p.Thr407Thr synonymous AFF1 119 83174 0.00143074 41587 0 0.00242054
4-88016115-C-T p.Thr419Met missense AFF1 1 83122 1.20305E-5 41561 0 8.34028E-6
4-88016116-G-A p.Thr419Thr synonymous AFF1 30 83094 3.61037E-4 41547 0 0.0040282
4-88016121-C-CCATGCTCGAAGACGACCTTCAGCTCA c.1262_1262+1insCATGCTCGAAGACGACCTTCAGCTCA splice_donor AFF1 2 83082 2.40726E-5 41541 0 NA
4-88016121-C-CCATGCTCGAAGACGACCTTCAGCTCAGTGACAGTGAGGACA c.1262_1262+1insCATGCTCGAAGACGACCTTCAGCTCAGTGACAGTGAGGACA splice_donor AFF1 1 83084 1.2036E-5 41542 0 NA
4-88016121-C-T p.Ser421Phe missense+splice_region AFF1 2 83084 2.4072E-5 41542 0 1.99083E-5
4-88026786-C-T p.Leu423Leu synonymous AFF1 6 83330 7.20029E-5 41665 0 6.37024E-5
4-88026792-C-T p.Asp425Asp synonymous AFF1 3 83350 3.59928E-5 41675 0 4.37466E-5
4-88026800-A-T p.Gln428Leu missense AFF1 4 83360 4.79846E-5 41680 0 8.23723E-6
4-88026805-A-T p.Ser430Cys missense AFF1 1 83368 1.1995E-5 41684 0 NA
4-88026825-C-G p.Asp436Glu missense AFF1 3 83376 3.59816E-5 41688 0 0.00125
4-88026834-AGTAAGTGTTGCACAGCCTGTAATACCAGGAGTCCTTTTAAATACATCTAACAGATCTGAGCTGCTTGTTCTAACCTGTTTTTTGTTCTTTTCCTGGTCTTTCTTCCCCTTATTGTGAATGCCTAG-A c.1317+1_1318-1del splice_acceptor AFF1 4 83374 4.79766E-5 41687 0 NA
4-88026957-T-C c.1318-3T>C splice_region AFF1 1 83398 1.19907E-5 41699 0 NA
4-88026967-A-G p.Glu442Gly missense AFF1 1 83404 1.19898E-5 41702 0 5.16948E-5
4-88026981-T-A p.Ser447Thr missense AFF1 10 83406 1.19895E-4 41703 0 8.23655E-5
4-88026995-A-G p.Pro451Pro splice_region+synonymous AFF1 1 83392 1.19916E-5 41696 0 3.18552E-5
4-88027002-C-T c.1355+5C>T splice_region AFF1 2 48698 4.10694E-5 24349 0 8.2371E-6
4-88027003-G-A c.1355+6G>A splice_region AFF1 3 48700 6.16016E-5 24350 0 4.11848E-5
4-88029316-C-A p.Pro454Gln missense AFF1 2 83230 2.40298E-5 41615 0 5.03525E-4
4-88029341-A-G p.Ala462Ala synonymous AFF1 1 83304 1.20042E-5 41652 0 1.19352E-5
4-88029352-C-A p.Ser466Tyr missense AFF1 1 83318 1.20022E-5 41659 0 6.25E-4
4-88029353-C-A p.Ser466Ser synonymous AFF1 111 83308 0.00133241 41654 1 8.27386E-4
4-88029374-C-T p.Ser473Ser synonymous AFF1 3 83328 3.60023E-5 41664 0 3.18471E-5
4-88029376-C-T p.Thr474Ile missense AFF1 3 83324 3.6004E-5 41662 0 2.7845E-5
4-88029376-C-G p.Thr474Ser missense AFF1 1 83324 1.20013E-5 41662 0 3.1841E-5
4-88029382-ACTCAGACAGTTC-A p.Ser479_Asp482del conservative_inframe_deletion AFF1 1 83324 1.20013E-5 41662 0 8.24334E-6
4-88029391-G-A p.Ser479Asn missense AFF1 1 83334 1.19999E-5 41667 0 NA
4-88029394-C-A p.Ser480Tyr missense AFF1 1 83328 1.20008E-5 41664 0 NA
4-88029410-C-T p.Ser485Ser synonymous AFF1 1 83326 1.20011E-5 41663 0 7.95792E-6
4-88029427-A-G p.Asp491Gly missense AFF1 2 83322 2.40033E-5 41661 0 3.98156E-6
4-88029431-C-T p.Ser492Ser synonymous AFF1 4 83306 4.80158E-5 41653 0 1.91144E-4
4-88029440-T-A p.Asn495Lys missense AFF1 1 83300 1.20048E-5 41650 0 2.78654E-5
4-88029443-GCCC-G p.Pro497del disruptive_inframe_deletion AFF1 1 83288 1.20065E-5 41644 0 8.26802E-6
4-88029453-A-T p.Thr500Ser missense AFF1 4 83226 4.80619E-5 41613 0 8.77368E-5
4-88029463-C-T p.Pro194Leu missense+splice_region AFF1 6 83110 7.21935E-5 41555 0 5.04541E-4
4-88029464-G-A p.Pro194Pro splice_region+synonymous AFF1 7 83096 8.42399E-5 41548 0 9.97208E-5
4-88029470-A-G c.1512+3A>G splice_region AFF1 1 82980 1.20511E-5 41490 0 NA
4-88029472-C-T c.1512+5C>T splice_region AFF1 3 82918 3.61803E-5 41459 0 1.66948E-5
4-88029473-G-A c.1512+6G>A splice_region AFF1 3 82916 3.61812E-5 41458 0 4.17397E-5
4-88035536-A-C p.Thr510Thr synonymous AFF1 2 80602 2.48133E-5 40301 0 NA
4-88035541-A-G p.Lys512Arg missense AFF1 3 80536 3.72504E-5 40268 0 3.18837E-5
4-88035546-C-G p.Gln514Glu missense AFF1 1 80046 1.24928E-5 40023 0 4.34658E-6
4-88035565-C-G p.Thr520Ser missense AFF1 1 79764 1.2537E-5 39882 0 NA
4-88035573-AGCC-A p.Ser523_Gln524delinsLys disruptive_inframe_deletion AFF1 1 79654 1.25543E-5 39827 0 NA
4-88035586-C-T p.Ala527Val missense AFF1 74 80070 9.24191E-4 40035 0 0.00126873
4-88035587-G-A p.Ala527Ala synonymous AFF1 36 80144 4.49191E-4 40072 0 4.60738E-4
4-88035593-A-T p.Pro529Pro synonymous AFF1 8 81590 9.80512E-5 40795 0 1.2189E-5
4-88035595-A-C p.Glu530Ala missense AFF1 1 81678 1.22432E-5 40839 0 3.18796E-5
4-88035597-G-A p.Gly531Ser missense AFF1 1 81712 1.22381E-5 40856 0 3.24401E-5
4-88035615-C-T p.Pro537Ser missense AFF1 1 82034 1.21901E-5 41017 0 NA
4-88035616-C-T p.Pro537Leu missense AFF1 2 82050 2.43754E-5 41025 0 NA
4-88035619-C-T p.Pro538Leu missense AFF1 2 82122 2.4354E-5 41061 0 6.25782E-4
4-88035620-A-C p.Pro538Pro synonymous AFF1 1 82086 1.21823E-5 41043 0 NA
4-88035621-C-T p.Arg539Trp missense AFF1 12 82116 1.46135E-4 41058 0 2.23143E-4
4-88035624-C-T p.Arg540Trp missense AFF1 8 82112 9.74279E-5 41056 0 1.276E-4
4-88035625-G-A p.Arg540Gln missense AFF1 1 82118 1.21776E-5 41059 0 8.49054E-5
4-88035629-C-T p.His541His synonymous AFF1 1 82170 1.21699E-5 41085 0 9.56755E-5
4-88035635-G-A p.Glu543Glu synonymous AFF1 1 82262 1.21563E-5 41131 0 3.18918E-5
4-88035643-G-A p.Gly546Asp missense AFF1 2 82288 2.43049E-5 41144 0 NA
4-88035657-G-A p.Ala551Thr missense AFF1 1 82202 1.21652E-5 41101 0 2.69397E-5
4-88035662-G-A p.Thr552Thr synonymous AFF1 54 82166 6.57206E-4 41083 0 0.00151057
4-88035662-G-C p.Thr552Thr synonymous AFF1 1 82166 1.21705E-5 41083 0 NA
4-88035663-A-G p.Ser553Gly missense AFF1 3 82166 3.65115E-5 41083 0 NA
4-88035664-G-A p.Ser553Asn missense AFF1 25 82166 3.04262E-4 41083 0 6.25E-4
4-88035671-G-A p.Glu555Glu synonymous AFF1 1 82056 1.21868E-5 41028 0 NA
4-88035691-C-G p.Pro562Arg missense AFF1 1 81628 1.22507E-5 40814 0 NA
4-88035696-C-A p.Pro564Thr missense AFF1 4 81570 4.90376E-5 40785 0 2.49482E-5
4-88035696-C-T p.Pro564Ser missense AFF1 1 81570 1.22594E-5 40785 0 3.29983E-4
4-88035696-C-G p.Pro564Ala missense AFF1 1 81570 1.22594E-5 40785 0 1.79134E-4
4-88035697-C-G p.Pro564Arg missense AFF1 1 81590 1.22564E-5 40795 0 3.18878E-5
4-88035699-A-G p.Lys565Glu missense AFF1 5 81506 6.13452E-5 40753 0 NA
4-88035703-G-A p.Ser566Asn missense AFF1 1 81400 1.2285E-5 40700 0 1.25966E-5
4-88035714-G-GC p.Arg572fs frameshift AFF1 12 80886 1.48357E-4 40443 0 8.6166E-5
4-88035720-C-CG p.Ala573fs frameshift AFF1 5 80464 6.21396E-5 40232 0 3.21027E-5
4-88035720-C-T p.Arg572Trp missense AFF1 3 80616 3.72135E-5 40308 0 0.00202634
4-88035723-G-GC p.Pro575fs frameshift AFF1 5 80344 6.22324E-5 40172 0 8.94294E-6
4-88035728-A-C p.Pro574Pro synonymous AFF1 1 78930 1.26695E-5 39465 0 0.00607903
4-88035728-A-AC p.Glu576fs frameshift AFF1 4 80108 4.99326E-5 40054 0 NA
4-88035730-C-G p.Pro575Arg missense AFF1 1 80292 1.24545E-5 40146 0 NA
4-88035732-G-C p.Glu576Gln missense AFF1 1 78262 1.27776E-5 39131 0 7.06614E-4
4-88035734-A-G p.Glu576Glu synonymous AFF1 2 80450 2.48602E-5 40225 0 9.68679E-5
4-88035735-G-A p.Ala577Thr missense AFF1 1 79948 1.25081E-5 39974 0 1.73686E-4
4-88035736-C-G p.Ala577Gly missense AFF1 1 80246 1.24617E-5 40123 0 NA
4-88035746-C-T p.Pro580Pro synonymous AFF1 4 80830 4.94866E-5 40415 0 4.84712E-5
4-88035746-C-A p.Pro580Pro synonymous AFF1 1 80830 1.23716E-5 40415 0 1.24753E-5
4-88035747-G-A p.Gly581Arg missense AFF1 1 80434 1.24326E-5 40217 0 0.00151515
4-88035755-G-A p.Arg583Arg synonymous AFF1 299 81140 0.00368499 40570 1 0.00439147
4-88035760-G-C p.Cys585Ser missense AFF1 1 81406 1.22841E-5 40703 0 NA
4-88035772-C-T p.Pro589Leu missense AFF1 2 81864 2.44308E-5 40932 0 3.26499E-5
4-88035785-G-T p.Glu593Asp missense AFF1 2 82238 2.43197E-5 41119 0 NA
4-88035786-C-A p.Pro594Thr missense AFF1 4 82234 4.86417E-5 41117 0 4.4484E-5
4-88035791-A-G p.Pro595Pro synonymous AFF1 5 82376 6.06973E-5 41188 0 3.27397E-5
4-88035803-C-A p.Thr599Thr synonymous AFF1 1 82640 1.21007E-5 41320 0 4.0331E-6
4-88035803-C-T p.Thr599Thr synonymous AFF1 3 82640 3.6302E-5 41320 0 6.43501E-5
4-88035804-G-A p.Val600Ile missense AFF1 8 82652 9.67914E-5 41326 0 2.25806E-4
4-88035805-T-C p.Val600Ala missense AFF1 1 82662 1.20975E-5 41331 0 8.58502E-6
4-88035821-C-CA p.Pro608fs frameshift AFF1 1 82806 1.20764E-5 41403 0 NA
4-88035827-A-G p.Lys607Lys synonymous AFF1 1 82810 1.20758E-5 41405 0 NA
4-88035827-A-C p.Lys607Asn missense AFF1 8 82810 9.66067E-5 41405 0 0.0020141
4-88035840-T-C p.Ser612Pro missense AFF1 1 82864 1.2068E-5 41432 0 3.20328E-5
4-88035846-C-T p.Arg614Trp missense AFF1 4 82814 4.8301E-5 41407 0 6.39141E-5
4-88035846-C-G p.Arg614Gly missense AFF1 2 82814 2.41505E-5 41407 0 8.50022E-6
4-88035848-G-A p.Arg614Arg synonymous AFF1 1 82764 1.20825E-5 41382 0 NA
4-88035858-C-T p.Arg618Trp missense AFF1 4 82774 4.83244E-5 41387 0 3.19468E-5
4-88035859-G-A p.Arg618Gln missense AFF1 1 82792 1.20785E-5 41396 0 4.00657E-6
4-88035864-A-T p.Ser620Cys missense AFF1 35 82800 4.22705E-4 41400 1 9.25867E-4
4-88035865-G-T p.Ser620Ile missense AFF1 2 82796 2.41558E-5 41398 0 NA
4-88035875-G-C p.Gly623Gly synonymous AFF1 2 82772 2.41628E-5 41386 0 8.43384E-6
4-88035876-G-A p.Glu624Lys missense AFF1 2 82772 2.41628E-5 41386 1 1.20041E-5
4-88035881-G-A p.Arg625Arg synonymous AFF1 1 82740 1.20861E-5 41370 0 NA
4-88035888-G-C p.Gly628Arg missense AFF1 3 82722 3.6266E-5 41361 0 1.914E-4
4-88035899-C-G p.Pro631Pro synonymous AFF1 1 82696 1.20925E-5 41348 0 3.99888E-6
4-88035901-A-G p.Tyr632Cys missense AFF1 10 82678 1.20951E-4 41339 0 3.36219E-5
4-88035904-GC-TT p.Gly633Val missense AFF1 2 82628 2.42049E-5 41314 0 NA
4-88035907-C-T p.Ser634Phe missense AFF1 360 82632 0.00435667 41316 3 0.0120846
4-88035909-C-A p.Arg635Arg synonymous AFF1 2 82600 2.42131E-5 41300 0 NA
4-88035910-G-A p.Arg635Gln missense AFF1 4 82516 4.84754E-5 41258 0 5.03525E-4
4-88035917-G-A p.Gln637Gln synonymous AFF1 1 82610 1.21051E-5 41305 0 8.36106E-6
4-88035929-C-G p.Asp641Glu missense AFF1 1 82666 1.20969E-5 41333 0 NA
4-88035934-C-T p.Pro643Leu missense AFF1 1 82676 1.20954E-5 41338 0 3.99974E-6
4-88035941-G-GGGGATTGTTGAGCCC p.Val645_Lys646insGlyIleValGluPro conservative_inframe_insertion AFF1 1 82692 1.20931E-5 41346 0 NA
4-88035946-C-T p.Thr647Met missense AFF1 36 82686 4.35382E-4 41343 0 4.78835E-4
4-88035947-G-A p.Thr647Thr synonymous AFF1 2 82714 2.41797E-5 41357 0 4.00503E-6
4-88035954-C-T p.Arg650Trp missense AFF1 1 82746 1.20852E-5 41373 0 3.60513E-5
4-88035955-G-A p.Arg650Gln missense AFF1 2 82744 2.41709E-5 41372 0 1.20029E-5
4-88035960-C-T p.Arg652Trp missense AFF1 6 82802 7.2462E-5 41401 0 3.19305E-5
4-88035961-G-A p.Arg652Gln missense AFF1 3 82828 3.62196E-5 41414 0 0.00100705
4-88035965-C-G p.Ala653Ala synonymous AFF1 9 82860 1.08617E-4 41430 0 1.91473E-4
4-88035965-C-A p.Ala653Ala synonymous AFF1 6 82860 7.24113E-5 41430 0 3.19578E-5
4-88035965-C-T p.Ala653Ala synonymous AFF1 13 82860 1.56891E-4 41430 0 5.74419E-4
4-88035966-G-A p.Ala654Thr missense AFF1 4 82842 4.82847E-5 41421 0 1.59683E-5
4-88035966-G-T p.Ala654Ser missense AFF1 2 82842 2.41423E-5 41421 0 NA
4-88035977-C-T p.Asn657Asn synonymous AFF1 5 82978 6.02569E-5 41489 0 3.31186E-5
4-88035983-C-G p.Pro659Pro synonymous AFF1 1 83036 1.2043E-5 41518 0 NA
4-88035995-GC-G p.Ser666fs frameshift AFF1 1 83044 1.20418E-5 41522 0 NA
4-88035997-C-A p.Pro664His missense AFF1 1 83046 1.20415E-5 41523 0 NA
4-88035999-C-A p.Pro665Thr missense AFF1 6 83062 7.22352E-5 41531 0 3.19081E-5
4-88035999-C-T p.Pro665Ser missense AFF1 2 83062 2.40784E-5 41531 0 3.19081E-5
4-88036000-C-G p.Pro665Arg missense AFF1 26 83076 3.12966E-4 41538 0 6.25E-4
4-88036000-C-T p.Pro665Leu missense AFF1 1 83076 1.20372E-5 41538 0 1.6541E-5
4-88036000-C-A p.Pro665His missense AFF1 1 83076 1.20372E-5 41538 0 4.78145E-5
4-88036001-C-G p.Pro665Pro synonymous AFF1 24 83074 2.88899E-4 41537 3 0.00100705
4-88036001-C-T p.Pro665Pro synonymous AFF1 1 83076 1.20372E-5 41538 0 1.07514E-4
4-88036001-C-A p.Pro665Pro synonymous AFF1 2 83076 2.40743E-5 41538 0 6.25E-4
4-88036008-GAGA-G p.Lys671del conservative_inframe_deletion AFF1 5 83116 6.01569E-5 41558 0 3.18959E-5
4-88036015-A-T p.Lys670Met missense AFF1 12 83148 1.44321E-4 41574 0 4.14673E-4
4-88036017-A-C p.Lys671Gln missense AFF1 19 83168 2.28453E-4 41584 0 5.03525E-4
4-88036034-C-G p.Leu676Leu synonymous AFF1 3 83198 3.60586E-5 41599 0 3.18735E-5
4-88036036-C-T p.Pro677Leu missense AFF1 1 83194 1.20201E-5 41597 0 NA
4-88036041-C-T p.Pro679Ser missense AFF1 1 83194 1.20201E-5 41597 0 4.00876E-6
4-88036042-C-A p.Pro679His missense AFF1 7 83204 8.41306E-5 41602 0 1.65882E-5
4-88036043-C-T p.Pro679Pro synonymous AFF1 2 83200 2.40385E-5 41600 0 3.20716E-5
4-88036046-T-C p.Ser680Ser synonymous AFF1 1 83208 1.20181E-5 41604 0 0.00100705
4-88036047-A-G p.Lys681Glu missense AFF1 1 83222 1.20161E-5 41611 0 NA
4-88036070-CGCGAAGGACAAT-C p.Ala689_Asn692del disruptive_inframe_deletion AFF1 2 83244 2.40258E-5 41622 0 1.65983E-5
4-88036070-C-T p.Pro688Pro synonymous AFF1 1 83244 1.20129E-5 41622 0 3.31967E-5
4-88036071-G-A p.Ala689Thr missense AFF1 2 83254 2.40229E-5 41627 0 4.14896E-5
4-88036072-C-T p.Ala689Val missense AFF1 4 83256 4.80446E-5 41628 0 4.97967E-5
4-88036073-G-A p.Ala689Ala synonymous AFF1 105 83260 0.00126111 41630 0 0.00553877
4-88036075-A-G p.Lys690Arg missense AFF1 1 83274 1.20085E-5 41637 0 8.29669E-6
4-88036082-T-C p.Asn692Asn synonymous AFF1 1 83282 1.20074E-5 41641 0 8.29834E-6
4-88036084-T-C p.Val693Ala missense AFF1 1 83294 1.20057E-5 41647 0 8.29834E-6
4-88036086-G-C p.Glu694Gln missense AFF1 1 83294 1.20057E-5 41647 0 NA
4-88036098-C-T p.Pro698Ser missense AFF1 2 83286 2.40136E-5 41643 0 9.95603E-5
4-88036106-C-T p.His700His synonymous AFF1 1 83268 1.20094E-5 41634 0 NA
4-88036109-T-C p.Phe701Phe synonymous AFF1 2 83262 2.40206E-5 41631 0 0.00125
4-88036116-G-A p.Val704Ile missense AFF1 896 83218 0.0107669 41609 9 0.0292044
4-88036119-C-G p.Pro705Ala missense AFF1 3 83236 3.60421E-5 41618 0 3.18715E-5
4-88036121-C-G p.Pro705Pro synonymous AFF1 2 83236 2.40281E-5 41618 0 7.99674E-6
4-88036127-T-C p.Thr707Thr synonymous AFF1 2 83202 2.40379E-5 41601 0 1.19871E-5
4-88036137-G-A p.Gly711Ser missense AFF1 1 83122 1.20305E-5 41561 0 NA
4-88036143-C-T p.Pro713Ser missense AFF1 3 83082 3.61089E-5 41541 0 NA
4-88036144-C-T p.Pro713Leu missense AFF1 1 83060 1.20395E-5 41530 0 7.99073E-6
4-88036146-C-T p.His714Tyr missense AFF1 244 83046 0.00293813 41523 2 0.003125
4-88036147-A-G p.His714Arg missense AFF1 1 83022 1.2045E-5 41511 0 8.28748E-6
4-88036147-A-T p.His714Leu missense AFF1 1 83022 1.2045E-5 41511 0 NA
4-88036158-G-A p.Gly718Ser missense AFF1 5 82648 6.04975E-5 41324 0 3.18817E-5
4-88036166-G-A p.Arg720Arg synonymous AFF1 2 82058 2.4373E-5 41029 0 4.24939E-5
4-88036167-A-G p.Thr721Ala missense AFF1 1 81864 1.22154E-5 40932 0 3.18979E-5
4-88036169-T-C p.Thr721Thr synonymous AFF1 7 81802 8.55725E-5 40901 0 5.22803E-5
4-88036175-C-T p.Gly723Gly synonymous AFF1 1 81220 1.23122E-5 40610 0 9.02495E-6
4-88036179-C-T p.Arg725Cys missense AFF1 1 80768 1.23811E-5 40384 0 3.56773E-5
4-88036180-G-A p.Arg725His missense AFF1 6 80110 7.4897E-5 40055 0 0.0105954
4-88036180-G-C p.Arg725Pro missense AFF1 1 80112 1.24825E-5 40056 0 6.55394E-5
4-88036182-C-A p.Gln726Lys missense AFF1 3 78656 3.81408E-5 39328 0 0.385974
4-88036187-C-T p.Ala727Ala synonymous AFF1 1 82894 1.20636E-5 41447 0 3.19882E-5
4-88036188-G-A p.Val728Met missense AFF1 1 82906 1.20619E-5 41453 0 3.18674E-5
4-88036200-G-A p.Glu732Lys missense AFF1 1 83090 1.20351E-5 41545 0 NA
4-88036203-G-A p.Asp733Asn missense AFF1 4 83122 4.8122E-5 41561 0 NA
4-88036210-G-A p.Arg735His missense AFF1 2 83182 2.40437E-5 41591 0 3.18857E-5
4-88036218-A-G p.Arg738Gly missense AFF1 2 83210 2.40356E-5 41605 0 NA
4-88036219-G-T p.Arg738Ile missense AFF1 1 83216 1.20169E-5 41608 0 3.18715E-5
4-88036219-G-A p.Arg738Lys missense AFF1 1 83216 1.20169E-5 41608 0 NA
4-88036223-C-A p.Leu739Leu synonymous AFF1 2 83238 2.40275E-5 41619 0 9.56145E-5
4-88036225-C-T p.Pro740Leu missense AFF1 22 83250 2.64264E-4 41625 0 2.86807E-4
4-88036233-T-C p.Leu743Leu synonymous AFF1 9 83260 1.08095E-4 41630 0 1.91339E-4
4-88036246-A-G p.Lys747Arg missense AFF1 1 83260 1.20106E-5 41630 0 5.97205E-5
4-88036253-C-T p.Leu749Leu synonymous AFF1 1 83274 1.20085E-5 41637 0 NA
4-88036258-C-T p.Pro751Leu missense AFF1 11 83264 1.3211E-4 41632 0 6.3743E-5
4-88036262-C-A p.Leu752Leu synonymous AFF1 277 83274 0.00332637 41637 0 0.00952654
4-88036275-C-G p.Pro757Ala missense AFF1 5 83290 6.00312E-5 41645 0 0.00125
4-88036275-C-T p.Pro757Ser missense AFF1 6 83290 7.20375E-5 41645 0 5.96834E-5
4-88036279-C-T p.Pro758Leu missense AFF1 3 83288 3.60196E-5 41644 0 2.47174E-5
4-88036279-C-G p.Pro758Arg missense AFF1 1 83288 1.20065E-5 41644 0 3.97842E-6
4-88036297-A-G p.Lys764Arg missense AFF1 1 83276 1.20083E-5 41638 0 NA
4-88036302-A-G p.Thr766Ala missense AFF1 1 83266 1.20097E-5 41633 0 NA
4-88036308-G-C p.Asp768His missense AFF1 1 83268 1.20094E-5 41634 0 6.36943E-5
4-88036308-G-T p.Asp768Tyr missense AFF1 4 83268 4.80377E-5 41634 0 3.46163E-4
4-88036317-T-C p.Ser771Pro missense AFF1 1 83248 1.20123E-5 41624 0 NA
4-88036320-C-T p.Arg772Trp missense AFF1 16 83222 1.92257E-4 41611 0 3.1837E-4
4-88036321-G-A p.Arg772Gln missense AFF1 2 83224 2.40315E-5 41612 0 4.12514E-5
4-88036337-C-T p.Pro777Pro synonymous AFF1 47 83110 5.65516E-4 41555 0 6.37146E-4
4-88036338-G-A p.Gly778Arg missense AFF1 1 83138 1.20282E-5 41569 0 6.36902E-5
4-88036344-G-T p.Gly780Trp missense AFF1 1 83158 1.20253E-5 41579 0 3.98149E-6
4-88036350-C-T p.Arg782Cys missense AFF1 3 83106 3.60985E-5 41553 0 6.25E-4
4-88036351-G-A p.Arg782His missense AFF1 2 83082 2.40726E-5 41541 0 3.98254E-6
4-88036354-A-G p.Gln783Arg missense AFF1 1 83112 1.2032E-5 41556 0 NA
4-88036358-G-T p.Arg784Ser missense AFF1 70 83076 8.42602E-4 41538 2 0.005
4-88036360-A-C p.Lys785Thr missense AFF1 1 83052 1.20406E-5 41526 0 NA
4-88036368-G-A p.Asp788Asn missense AFF1 1 83020 1.20453E-5 41510 0 3.98572E-6
4-88036375-A-C p.Gln790Pro missense AFF1 1 82976 1.20517E-5 41488 0 NA
4-88036376-G-A p.Gln790Gln synonymous AFF1 8 82946 9.64483E-5 41473 0 6.36983E-5
4-88036378-C-T p.Pro791Leu missense AFF1 100 82934 0.00120578 41467 0 0.00375
4-88036379-G-A p.Pro791Pro synonymous AFF1 5 82930 6.02918E-5 41465 0 1.74877E-5
4-88036382-C-T p.Pro792Pro synonymous AFF1 2 82922 2.41191E-5 41461 0 4.00291E-6
4-88036383-G-A p.Ala793Thr missense AFF1 6 82912 7.23659E-5 41456 0 0.00201613
4-88036386-G-A p.Gly794Arg missense AFF1 1 82900 1.20627E-5 41450 0 2.69455E-5
4-88036398-A-C p.Ser798Arg missense AFF1 1 82790 1.20788E-5 41395 0 NA
4-88036408-AGAG-A p.Arg802del disruptive_inframe_deletion AFF1 6 82708 7.25444E-5 41354 0 4.57252E-4
4-88036424-C-T p.Ser806Ser synonymous AFF1 1 82342 1.21445E-5 41171 0 NA
4-88036438-C-T p.Ala811Val missense AFF1 1 81612 1.22531E-5 40806 0 NA
4-88036441-A-G p.Lys812Arg missense AFF1 2 81494 2.45417E-5 40747 0 1.65066E-5
4-88036444-A-G p.Lys813Arg missense AFF1 1 81380 1.2288E-5 40690 0 3.18532E-5
4-88036445-G-A p.Lys813Lys synonymous AFF1 2 81350 2.45851E-5 40675 0 NA
4-88036445-G-C p.Lys813Asn missense AFF1 1 81350 1.22926E-5 40675 0 NA
4-88046199-A-C p.Glu819Ala missense AFF1 31 83022 3.73395E-4 41511 1 0.0020141
4-88046202-G-C p.Arg820Thr missense AFF1 1 83026 1.20444E-5 41513 0 NA
4-88046208-G-A p.Cys822Tyr missense AFF1 1 83092 1.20349E-5 41546 0 NA
4-88046210-G-A p.Asp823Asn missense AFF1 6 83094 7.22074E-5 41547 0 5.42972E-4
4-88046215-C-G p.Asn824Lys missense AFF1 1 83116 1.20314E-5 41558 0 NA
4-88046215-CAAG-C p.Lys826del disruptive_inframe_deletion AFF1 7 83116 8.42196E-5 41558 0 2.49035E-5
4-88046234-A-G p.Lys831Glu missense AFF1 1 83144 1.20273E-5 41572 0 6.36659E-5
4-88046237-G-A p.Glu832Lys missense AFF1 1 83148 1.20267E-5 41574 0 NA
4-88046242-C-G p.Ile833Met missense AFF1 175 83142 0.00210483 41571 3 0.00452402
4-88046245-A-G p.Lys834Lys synonymous AFF1 1 83150 1.20265E-5 41575 0 NA
4-88046248-A-G p.Ser835Ser synonymous AFF1 1 83130 1.20294E-5 41565 0 1.09548E-5
4-88046250-A-G p.Gln836Arg missense AFF1 7 83130 8.42055E-5 41565 0 1.91022E-4
4-88046250-A-T p.Gln836Leu missense AFF1 1 83130 1.20294E-5 41565 0 NA
4-88046251-GTCATCT-G p.Ser841_Ser842del disruptive_inframe_deletion AFF1 9 83122 1.08275E-4 41561 0 8.75388E-5
4-88046251-G-GTCATCT p.Ser841_Ser842dup disruptive_inframe_insertion AFF1 1 83122 1.20305E-5 41561 0 NA
4-88046255-T-C p.Ser838Pro missense AFF1 2 83118 2.40622E-5 41559 0 5.03525E-4
4-88046260-A-G p.Ser839Ser synonymous AFF1 1 83140 1.20279E-5 41570 0 NA
4-88046268-C-T p.Ser842Phe missense AFF1 1 83098 1.2034E-5 41549 0 3.18451E-5
4-88046274-A-T p.His844Leu missense AFF1 5 83124 6.01511E-5 41562 0 2.22816E-5
4-88046292-C-G p.Thr850Arg missense AFF1 1 83026 1.20444E-5 41513 0 8.25464E-6
4-88046427-T-C n.596T>C splice_region AFF1 2 66810 2.99356E-5 33405 0 NA
4-88047244-ACTCCAGGCC-A p.Lys851_Pro852delinsAsn splice_acceptor AFF1 2 83218 2.40333E-5 41609 0 9.57916E-5
4-88047285-G-A p.Glu863Lys missense AFF1 4 83314 4.80111E-5 41657 0 3.18552E-5
4-88047292-T-TC p.Pro868fs frameshift AFF1 1 83264 1.201E-5 41632 0 3.99329E-6
4-88047298-C-A p.Pro867Gln missense AFF1 1 83304 1.20042E-5 41652 0 1.64794E-5
4-88047298-C-G p.Pro867Arg missense AFF1 3 83304 3.60127E-5 41652 0 8.23968E-6
4-88047298-C-T p.Pro867Leu missense AFF1 3 83304 3.60127E-5 41652 0 4.77483E-5
4-88047303-C-CCCGTGT p.Val870_Ser871dup conservative_inframe_insertion AFF1 6 83298 7.20305E-5 41649 0 5.17141E-5
4-88047305-C-T p.Pro869Pro synonymous AFF1 6 83284 7.20426E-5 41642 0 1.48297E-4
4-88047306-G-A p.Val870Met missense AFF1 3 83304 3.60127E-5 41652 0 0.00100705
4-88047313-C-T p.Ser872Leu missense AFF1 18 83294 2.16102E-4 41647 0 2.5481E-4
4-88047314-G-A p.Ser872Ser synonymous AFF1 969 83268 0.0116371 41634 8 0.018125
4-88047323-G-A p.Gln875Gln synonymous AFF1 6 83290 7.20375E-5 41645 0 5.17285E-5
4-88047328-C-T p.Pro877Leu missense AFF1 425 83304 0.0051018 41652 1 0.00553877
4-88047350-G-A p.Arg884Arg synonymous AFF1 1 83360 1.19962E-5 41680 0 NA
4-88047355-G-A p.Arg886Lys missense AFF1 1 83362 1.19959E-5 41681 0 8.2371E-6
4-88047356-G-A p.Arg886Arg synonymous AFF1 2 83356 2.39935E-5 41678 0 1.64745E-5
4-88047357-C-T p.Arg887Trp missense AFF1 3 83352 3.59919E-5 41676 0 5.03525E-4
4-88047360-G-A p.Glu888Lys missense AFF1 1 83350 1.19976E-5 41675 0 1.19312E-5
4-88047364-C-G p.Ala889Gly missense AFF1 1 83348 1.19979E-5 41674 0 3.97697E-6
4-88047367-A-G p.Asp890Gly missense AFF1 4 83340 4.79962E-5 41670 0 3.18167E-5
4-88047382-A-G p.Asp895Gly missense AFF1 1 83304 1.20042E-5 41652 0 8.23954E-6
4-88047385-C-T p.Pro896Leu missense AFF1 2 83306 2.40079E-5 41653 0 8.2394E-6
4-88047386-T-C p.Pro896Pro synonymous AFF1 5 83292 6.00298E-5 41646 0 0.00125
4-88047387-CCCAAAAGTGCCAGCAGTA-C p.Ser899_Lys904del disruptive_inframe_deletion AFF1 1 83298 1.20051E-5 41649 0 NA
4-88047409-A-C p.Lys904Thr missense AFF1 1 83222 1.20161E-5 41611 0 NA
4-88047414-A-G p.Asn906Asp missense AFF1 2 83204 2.40373E-5 41602 0 1.19359E-5
4-88047428-T-C p.Ser910Ser synonymous AFF1 1 83130 1.20294E-5 41565 0 NA
4-88047448-G-T p.Arg917Ile missense AFF1 1 83076 1.20372E-5 41538 0 8.26597E-6
4-88047450-G-C p.Val918Leu missense AFF1 9 83052 1.08366E-4 41526 0 6.25E-4
4-88047452-A-G p.Val918Val synonymous AFF1 3 83050 3.61228E-5 41525 0 4.13442E-5
4-88047455-G-A p.Glu919Glu synonymous AFF1 1 83020 1.20453E-5 41510 0 NA
4-88047458-G-A p.Gly920Gly synonymous AFF1 2 83006 2.40946E-5 41503 0 NA
4-88047460-A-G p.Lys921Arg missense AFF1 1 82998 1.20485E-5 41499 0 NA
4-88047463-G-A p.Gly922Asp missense AFF1 3 82968 3.61585E-5 41484 0 NA
4-88047466-C-G p.Ser923Cys missense AFF1 1 82922 1.20595E-5 41461 0 9.55962E-5
4-88047479-G-A p.Ser927Ser synonymous AFF1 20 82740 2.41721E-4 41370 0 3.18634E-4
4-88047492-A-C c.2790+4A>C splice_region AFF1 2 82556 2.4226E-5 41278 0 1.66232E-5
4-88047493-G-A c.2790+5G>A splice_region AFF1 3 82514 3.63575E-5 41257 0 3.18532E-5
4-88047493-G-GC c.2790+5_2790+6insC splice_region AFF1 1 82514 1.21192E-5 41257 0 NA
4-88048169-T-TG c.2791-9_2791-8insG splice_region AFF1 4 83252 4.80469E-5 41626 0 1.3222E-4
4-88048179-G-A p.Gly931Asp missense+splice_region AFF1 8 83294 9.60453E-5 41647 0 1.29099E-4
4-88048186-C-T p.Ser933Ser synonymous AFF1 3 83312 3.60092E-5 41656 0 4.12269E-5
4-88048187-G-A p.Gly934Arg missense AFF1 4 83318 4.80088E-5 41659 0 1.19398E-5
4-88048190-G-T p.Asp935Tyr missense AFF1 3 83320 3.60058E-5 41660 0 1.98954E-5
4-88048194-C-T p.Thr936Ile missense AFF1 1 83338 1.19993E-5 41669 0 NA
4-88048196-G-A p.Ala937Thr missense AFF1 5 83332 6.0001E-5 41666 0 NA
4-88048197-C-G p.Ala937Gly missense AFF1 1 83330 1.20005E-5 41665 0 7.95678E-6
4-88048201-T-C p.Asn938Asn synonymous AFF1 1 83332 1.20002E-5 41666 0 3.18735E-5
4-88048209-C-T p.Pro941Leu missense AFF1 1 83340 1.1999E-5 41670 0 NA
4-88048212-T-C p.Val942Ala missense AFF1 1 83346 1.19982E-5 41673 0 NA
4-88048214-C-T p.Pro943Ser missense AFF1 36 83354 4.31893E-4 41677 0 8.00051E-4
4-88048216-T-C p.Pro943Pro synonymous AFF1 1 83358 1.19964E-5 41679 0 NA
4-88048218-C-T p.Ser944Phe missense AFF1 3 83358 3.59893E-5 41679 0 2.78432E-5
4-88048228-T-G p.Asn947Lys missense AFF1 1 83358 1.19964E-5 41679 0 1.64745E-5
4-88048229-G-C p.Gly948Arg missense AFF1 3 83358 3.59893E-5 41679 0 NA
4-88048234-C-T p.Asn949Asn synonymous AFF1 8 83354 9.59762E-5 41677 0 6.25E-4
4-88048245-G-A p.Gly953Glu missense AFF1 2 83342 2.39975E-5 41671 0 3.19652E-5
4-88048251-C-T p.Pro955Leu missense AFF1 1 83342 1.19988E-5 41671 0 8.23737E-6
4-88048255-A-G p.Gln956Gln synonymous AFF1 1 83332 1.20002E-5 41666 0 8.23764E-6
4-88048267-C-T p.Asp960Asp splice_region+synonymous AFF1 1 83294 1.20057E-5 41647 0 3.98241E-6
4-88048804-A-T p.Ala964Ala synonymous AFF1 9 83388 1.07929E-4 41694 0 5.16985E-5
4-88048840-G-A p.Gln976Gln synonymous AFF1 1 83380 1.19933E-5 41690 0 1.27372E-4
4-88048845-C-T p.Ala978Val missense AFF1 1 83384 1.19927E-5 41692 0 NA
4-88048853-A-T p.Met981Leu missense+splice_region AFF1 3 83370 3.59842E-5 41685 0 3.97697E-6
4-88048854-T-C p.Met981Thr missense+splice_region AFF1 1 83370 1.19947E-5 41685 0 1.64889E-5
4-88048856-GT-G c.2943+2delT splice_donor AFF1 1 83352 1.19973E-5 41676 0 NA
4-88048863-T-C c.2943+8T>C splice_region AFF1 14366 83036 0.173009 41518 1472 0.209375
4-88052225-TCTC-T c.2944-9_2944-7delCTC splice_region AFF1 2 83356 2.39935E-5 41678 0 NA
4-88052236-C-T p.Thr982Met missense+splice_region AFF1 1 83384 1.19927E-5 41692 0 8.24565E-6
4-88052270-A-G p.Glu993Glu synonymous AFF1 4 83408 4.7957E-5 41704 0 3.29516E-5
4-88052273-C-T p.Ala994Ala synonymous AFF1 1865 83378 0.022368 41689 108 0.0465376
4-88052274-G-A p.Val995Ile missense AFF1 1 83402 1.19901E-5 41701 0 1.98851E-5
4-88052276-C-T p.Val995Val synonymous AFF1 2 83404 2.39797E-5 41702 0 1.19315E-5
4-88052294-C-T p.Cys1001Cys synonymous AFF1 3 83400 3.59712E-5 41700 0 0.00100705
4-88052295-G-T p.Gly1002* stop_gained AFF1 3 83402 3.59704E-5 41701 0 NA
4-88052329-A-C p.Lys1013Thr missense AFF1 3 83390 3.59755E-5 41695 0 3.97693E-6
4-88052341-C-G p.Ser1017Cys missense AFF1 4 83390 4.79674E-5 41695 0 6.36699E-5
4-88052362-A-C p.Asp1024Ala missense AFF1 2 83388 2.39843E-5 41694 0 NA
4-88052371-A-AATTCATAAT c.3080_3080+1insATTCATAAT splice_donor AFF1 5 83362 5.99794E-5 41681 2 NA
4-88052371-A-AATTCATAATGTCATTAAAATCCTTCTCAGATGCCACAGC c.3080_3080+1insATTCATAATGTCATTAAAATCCTTCTCAGATGCCACAGC splice_donor AFF1 1 83366 1.19953E-5 41683 0 NA
4-88052374-A-G c.3080+3A>G splice_region AFF1 8 83340 9.59923E-5 41670 0 2.22902E-4
4-88052939-C-T c.3081-6C>T splice_region AFF1 2 82796 2.41558E-5 41398 0 4.46326E-4
4-88052952-A-G p.Met1030Val missense AFF1 1 82940 1.20569E-5 41470 0 1.07814E-5
4-88052953-T-C p.Met1030Thr missense AFF1 1 82940 1.20569E-5 41470 0 NA
4-88052963-A-T p.Lys1033Asn missense AFF1 1 82990 1.20496E-5 41495 0 NA
4-88052977-C-G p.Ala1038Gly missense AFF1 1 83028 1.20441E-5 41514 0 4.73306E-5
4-88052980-CAGCGCCAACACA-C p.Ala1040_Gln1043del disruptive_inframe_deletion AFF1 1 83038 1.20427E-5 41519 0 NA
4-88052983-C-T p.Ala1040Val missense AFF1 2 83050 2.40819E-5 41525 0 0.00100908
4-88052985-C-T p.Pro1041Ser missense AFF1 49 83058 5.89949E-4 41529 0 0.00125
4-88052989-C-T p.Thr1042Ile missense AFF1 3 83052 3.61219E-5 41526 0 1.69795E-4
4-88053428-G-A p.Arg1053His missense AFF1 2 83318 2.40044E-5 41659 0 1.60578E-5
4-88053456-G-T p.Met1062Ile missense AFF1 20 83316 2.4005E-4 41658 0 4.5396E-4
4-88053475-A-T p.Ile1069Leu missense AFF1 1 83310 1.20034E-5 41655 0 NA
4-88053476-T-C p.Ile1069Thr missense AFF1 1 83312 1.20031E-5 41656 0 NA
4-88053494-G-A p.Arg1075His missense AFF1 7 83288 8.40457E-5 41644 0 1.31902E-4
4-88053494-G-C p.Arg1075Pro missense AFF1 1 83288 1.20065E-5 41644 0 NA
4-88053510-C-CAAGGATATAATTTATA p.Phe1081fs frameshift AFF1 1 83286 1.20068E-5 41643 0 NA
4-88053513-C-T p.Phe1081Phe synonymous AFF1 2 83264 2.402E-5 41632 0 8.24239E-6
4-88053513-C-G p.Phe1081Leu missense AFF1 1 83264 1.201E-5 41632 0 NA
4-88053514-G-A p.Glu1082Lys missense AFF1 1 83254 1.20114E-5 41627 0 1.64851E-5
4-88053517-A-G p.Ser1083Gly missense AFF1 2 83258 2.40217E-5 41629 0 NA
4-88053526-A-G p.Lys1086Glu missense AFF1 1 83248 1.20123E-5 41624 0 NA
4-88053532-G-A p.Ala1088Thr missense AFF1 2 83222 2.40321E-5 41611 0 5.03525E-4
4-88053534-C-T p.Ala1088Ala synonymous AFF1 1 83224 1.20158E-5 41612 0 NA
4-88053545-C-T p.Ser1092Phe missense AFF1 1 83194 1.20201E-5 41597 0 NA
4-88053548-C-G p.Pro1093Arg missense AFF1 1 83186 1.20213E-5 41593 0 NA
4-88053549-A-G p.Pro1093Pro synonymous AFF1 36 83188 4.32755E-4 41594 0 2.86515E-4
4-88053556-G-A p.Ala1096Thr missense AFF1 1 83148 1.20267E-5 41574 0 NA
4-88053565-CTCTAAG-C c.3290+6_3290+11delTCTAAG splice_region AFF1 3 83034 3.61298E-5 41517 0 1.66022E-5
4-88053567-C-G c.3290+7C>G splice_region AFF1 1 83006 1.20473E-5 41503 0 3.1841E-5
4-88053567-C-CT c.3290+7_3290+8insT splice_region AFF1 1 83006 1.20473E-5 41503 0 NA
4-88055619-C-G c.3291-7C>G splice_region AFF1 1 81784 1.22273E-5 40892 0 NA
4-88055637-C-T p.Pro1101Leu missense AFF1 1 82246 1.21586E-5 41123 0 3.32693E-5
4-88055639-T-C p.Ser1102Pro missense AFF1 1 82292 1.21518E-5 41146 0 8.77501E-6
4-88055646-T-C p.Leu1104Pro missense AFF1 1 82424 1.21324E-5 41212 0 3.18512E-5
4-88055654-A-G p.Met1107Val missense AFF1 1 82596 1.21071E-5 41298 0 3.18817E-5
4-88055666-G-A p.Ala1111Thr missense AFF1 2 82856 2.41383E-5 41428 0 1.2065E-5
4-88055673-C-A p.Ser1113Tyr missense AFF1 1 82978 1.20514E-5 41489 0 NA
4-88055674-C-T p.Ser1113Ser synonymous AFF1 34 82992 4.09678E-4 41496 0 3.83768E-4
4-88055675-G-A p.Val1114Ile missense AFF1 1 83008 1.2047E-5 41504 0 3.18735E-5
4-88055679-G-C p.Gly1115Ala missense AFF1 2 83092 2.40697E-5 41546 0 NA
4-88055686-G-T p.Gln1117His missense AFF1 1 83146 1.2027E-5 41573 0 3.98867E-6
4-88055691-G-T p.Ser1119Ile missense AFF1 2 83172 2.40466E-5 41586 0 NA
4-88055700-G-A p.Ser1122Asn missense AFF1 1 83204 1.20187E-5 41602 0 NA
4-88055711-A-G p.Ser1126Gly missense AFF1 5 83236 6.00702E-5 41618 0 3.18613E-5
4-88055712-G-A p.Ser1126Asn missense AFF1 1 83240 1.20135E-5 41620 0 NA
4-88055717-G-C p.Val1128Leu missense AFF1 1 83242 1.20132E-5 41621 0 NA
4-88055729-A-G p.Ile1132Val missense AFF1 1 83282 1.20074E-5 41641 0 NA
4-88055731-C-T p.Ile1132Ile synonymous AFF1 1 83288 1.20065E-5 41644 0 NA
4-88055732-A-C p.Ser1133Arg missense AFF1 1 83282 1.20074E-5 41641 0 NA
4-88055755-T-C p.Asn1140Asn synonymous AFF1 1 83340 1.1999E-5 41670 0 6.3743E-5
4-88055756-A-G p.Met1141Val missense AFF1 2 83346 2.39964E-5 41673 0 NA
4-88055761-A-G p.Thr1142Thr synonymous AFF1 1 83356 1.19967E-5 41678 0 NA
4-88055766-C-A p.Ser1144Tyr missense AFF1 1 83358 1.19964E-5 41679 0 NA
4-88055779-C-T p.Ile1148Ile synonymous AFF1 1 83364 1.19956E-5 41682 0 3.97681E-6
4-88055781-C-T p.Thr1149Ile missense AFF1 2 83358 2.39929E-5 41679 0 8.23778E-6
4-88055789-G-T p.Val1152Phe missense AFF1 1 83370 1.19947E-5 41685 0 NA
4-88055794-T-C p.Leu1153Leu synonymous AFF1 1 83372 1.19944E-5 41686 0 NA
4-88055797-C-T p.Thr1154Thr synonymous AFF1 258 83368 0.00309471 41684 2 0.00621138
4-88055800-C-G p.Ala1155Ala synonymous AFF1 20 83380 2.39866E-4 41690 0 6.25E-4
4-88055810-T-G p.Trp1159Gly missense AFF1 1 83386 1.19924E-5 41693 0 NA
4-88055818-G-A p.Gln1161Gln synonymous AFF1 1 83378 1.19936E-5 41689 0 NA
4-88055832-C-G p.Thr1166Arg missense AFF1 1 83352 1.19973E-5 41676 0 NA
4-88055835-G-A p.Arg1167Lys missense AFF1 1 83348 1.19979E-5 41674 0 NA
4-88056724-T-G c.3512-8T>G splice_region AFF1 119 82784 0.00143748 41392 1 0.00254858
4-88056725-T-G c.3512-7T>G splice_region AFF1 8 82800 9.66184E-5 41400 0 6.25E-4
4-88056729-C-T c.3512-3C>T splice_region AFF1 2 82714 2.41797E-5 41357 0 9.80402E-6
4-88056732-A-G p.Glu1171Gly missense+splice_region AFF1 2 82856 2.41383E-5 41428 0 5.04541E-4
4-88056743-C-T p.Arg1175Trp missense AFF1 1 82950 1.20555E-5 41475 0 4.33388E-5
4-88056744-G-A p.Arg1175Gln missense AFF1 3 82898 3.61891E-5 41449 0 NA
4-88056751-C-T p.Ser1177Ser synonymous AFF1 1 83204 1.20187E-5 41602 0 4.07647E-6
4-88056756-A-G p.Asn1179Ser missense AFF1 1 83238 1.20137E-5 41619 0 NA
4-88056767-T-C p.Leu1183Leu synonymous AFF1 1 83266 1.20097E-5 41633 0 4.02175E-6
4-88056771-C-T p.Ala1184Val missense AFF1 1 83260 1.20106E-5 41630 0 NA
4-88056790-G-A p.Val1190Val synonymous AFF1 1 83322 1.20016E-5 41661 0 6.37227E-5
4-88056794-C-T p.Leu1192Leu synonymous AFF1 280 83318 0.00336062 41659 2 0.0068515
4-88056805-T-C p.Tyr1195Tyr synonymous AFF1 1 83348 1.19979E-5 41674 0 NA
4-88056829-A-G p.Leu1203Leu synonymous AFF1 1 83370 1.19947E-5 41685 0 8.53053E-6
4-88056841-C-T p.Thr1207Thr synonymous AFF1 1 83340 1.1999E-5 41670 0 NA
4-88062206-A-G c.*5353A>G splice_region AFF1 24 42590 5.63513E-4 21295 0 7.96128E-4