Variant

Variant ID Consequence Effect Gene AC AN AF NS NHOM maxEAF
6-168227778-C-T c.-35C>T 5_prime_UTR_premature_start_codon_gain MLLT4 2 36640 5.45852E-5 18320 0 1.20038E-4
6-168227784-C-T c.-29C>T 5_prime_UTR_premature_start_codon_gain MLLT4 25 38462 6.49992E-4 19231 0 0.0015605
6-168227820-C-T p.Ala3Val missense MLLT4 1 46762 2.13849E-5 23381 0 3.02358E-5
6-168227828-C-G p.Arg6Gly missense MLLT4 1 46944 2.1302E-5 23472 0 9.82492E-6
6-168227866-C-T p.His18His synonymous MLLT4 1 51056 1.95863E-5 25528 0 3.91451E-5
6-168227891-C-T p.Leu27Leu synonymous MLLT4 1 48406 2.06586E-5 24203 0 8.46453E-6
6-168227908-G-C p.Gln32His missense MLLT4 1 42218 2.36866E-5 21109 0 NA
6-168227911-G-C p.Pro33Pro synonymous MLLT4 1 41086 2.43392E-5 20543 0 NA
6-168227917-G-C p.Glu35Asp missense+splice_region MLLT4 1 38368 2.60634E-5 19184 0 4.01059E-5
6-168265224-C-T c.106-7C>T splice_region MLLT4 204 83144 0.00245357 41572 2 0.00574089
6-168265242-C-G p.Phe39Leu missense MLLT4 1 83214 1.20172E-5 41607 0 NA
6-168265294-A-T p.Thr57Ser missense MLLT4 1 83366 1.19953E-5 41683 0 NA
6-168265308-G-T p.Arg61Arg synonymous MLLT4 4 83388 4.79685E-5 41694 0 1.59077E-5
6-168265311-C-T p.Val62Val synonymous MLLT4 1 83388 1.19921E-5 41694 0 3.97678E-6
6-168265314-T-C p.Ser63Ser synonymous MLLT4 1 83398 1.19907E-5 41699 0 NA
6-168265327-A-G p.Thr68Ala missense MLLT4 1 83404 1.19898E-5 41702 0 1.64761E-5
6-168265330-C-G p.Gln69Glu missense MLLT4 2 83404 2.39797E-5 41702 1 NA
6-168265340-T-C p.Ile72Thr missense MLLT4 13 83408 1.5586E-4 41704 0 0.0030249
6-168265347-G-A p.Thr74Thr synonymous MLLT4 3 83408 3.59678E-5 41704 0 8.23764E-6
6-168265350-C-T p.Leu75Leu synonymous MLLT4 1 83406 1.19895E-5 41703 0 1.19299E-5
6-168265353-G-A p.Ala76Ala synonymous MLLT4 7 83406 8.39268E-5 41703 0 5.03525E-4
6-168265365-A-G p.Arg80Arg synonymous MLLT4 1 83396 1.1991E-5 41698 0 6.36943E-5
6-168265383-G-C p.Leu86Leu synonymous MLLT4 1 83396 1.1991E-5 41698 0 8.23995E-6
6-168265383-G-A p.Leu86Leu synonymous MLLT4 1 83396 1.1991E-5 41698 0 NA
6-168265388-C-G p.Ser88Cys missense MLLT4 3 83390 3.59755E-5 41695 0 1.19328E-5
6-168265422-C-T p.Ser99Ser synonymous MLLT4 9 83368 1.07955E-4 41684 0 6.25E-4
6-168265431-G-A c.301+5G>A splice_region MLLT4 1 83370 1.19947E-5 41685 0 NA
6-168271067-A-G p.Glu101Glu splice_region+synonymous MLLT4 1 83008 1.2047E-5 41504 0 NA
6-168271083-G-C p.Asp107His missense MLLT4 1 83202 1.20189E-5 41601 0 NA
6-168271098-G-A p.Val112Ile missense MLLT4 1 83232 1.20146E-5 41616 0 NA
6-168271121-A-G p.Lys119Lys synonymous MLLT4 12 83276 1.44099E-4 41638 0 6.37064E-5
6-168271129-G-A p.Arg122Gln missense MLLT4 1 83278 1.2008E-5 41639 0 8.24429E-6
6-168271163-C-T p.Asp133Asp synonymous MLLT4 2 83232 2.40292E-5 41616 0 3.30655E-5
6-168271167-A-G p.Ile135Val missense MLLT4 1 83240 1.20135E-5 41620 0 3.18552E-5
6-168271173-C-G p.Pro137Ala missense MLLT4 28 83216 3.36474E-4 41608 0 0.00302115
6-168271178-G-A p.Lys138Lys splice_region+synonymous MLLT4 1 83190 1.20207E-5 41595 0 4.06716E-6
6-168272943-A-G p.Gln155Arg missense MLLT4 1 80200 1.24688E-5 40100 0 1.64837E-5
6-168272951-A-C p.Lys158Gln missense MLLT4 1 80222 1.24654E-5 40111 0 9.5511E-5
6-168272956-A-G p.Arg159Arg synonymous MLLT4 1 80226 1.24648E-5 40113 0 NA
6-168272969-AAAGAAAAGAAGG-A p.Glu165_Glu168del conservative_inframe_deletion MLLT4 2 80228 2.4929E-5 40114 0 4.02356E-6
6-168272974-A-G p.Glu165Glu synonymous MLLT4 3 80234 3.73906E-5 40117 0 3.21846E-5
6-168273000-AAG-A p.Glu175fs frameshift MLLT4 1 80306 1.24524E-5 40153 0 NA
6-168273005-G-A p.Ala176Thr missense MLLT4 4 80304 4.98107E-5 40152 0 4.12079E-5
6-168273007-A-T p.Ala176Ala synonymous MLLT4 2 80318 2.4901E-5 40159 0 3.1835E-5
6-168273033-A-G p.Asp185Gly missense MLLT4 1 80356 1.24446E-5 40178 0 1.89879E-4
6-168273047-G-C p.Gly190Arg missense MLLT4 1 80358 1.24443E-5 40179 0 4.13623E-6
6-168273049-G-A p.Gly190Gly synonymous MLLT4 2 80354 2.48899E-5 40177 0 2.54745E-4
6-168273053-G-A p.Asp192Asn missense MLLT4 2 80352 2.48905E-5 40176 0 NA
6-168276008-C-G c.579-7C>G splice_region MLLT4 1 83264 1.201E-5 41632 0 4.36152E-6
6-168276024-T-A p.Ser196Ser synonymous MLLT4 6 83304 7.20254E-5 41652 0 8.30689E-6
6-168276024-T-C p.Ser196Ser synonymous MLLT4 2 83304 2.40085E-5 41652 0 4.15344E-6
6-168276026-G-A p.Arg197Gln missense MLLT4 3 83306 3.60118E-5 41653 0 NA
6-168276057-G-A p.Pro207Pro synonymous MLLT4 12 83334 1.43999E-4 41667 0 4.44928E-4
6-168276065-G-C p.Ser210Thr missense MLLT4 1 83344 1.19985E-5 41672 0 1.19374E-5
6-168276074-G-A p.Arg213Gln missense MLLT4 1 83342 1.19988E-5 41671 0 8.23818E-6
6-168276078-C-G p.Thr214Thr synonymous MLLT4 6 83338 7.1996E-5 41669 0 0.001875
6-168276079-A-G p.Ile215Val missense MLLT4 2 83342 2.39975E-5 41671 0 NA
6-168276087-T-C p.Asn217Asn synonymous MLLT4 1 83340 1.1999E-5 41670 0 1.64761E-5
6-168276099-T-A p.Val221Val synonymous MLLT4 1 83348 1.19979E-5 41674 0 NA
6-168276135-A-T p.Arg233Ser missense MLLT4 1 83340 1.1999E-5 41670 0 NA
6-168276152-G-A p.Ser239Asn missense MLLT4 14 83320 1.68027E-4 41660 0 5.03525E-4
6-168276163-C-T p.Arg243Trp missense MLLT4 4 83306 4.80158E-5 41653 0 2.47889E-5
6-168276172-T-A p.Ser246Thr missense MLLT4 3 83298 3.60153E-5 41649 0 NA
6-168281046-C-T p.Thr249Ile missense MLLT4 2 83002 2.40958E-5 41501 0 1.64894E-5
6-168281052-G-A p.Arg251Lys missense MLLT4 1 83018 1.20456E-5 41509 0 8.24334E-6
6-168281053-A-G p.Arg251Arg synonymous MLLT4 2 83014 2.40923E-5 41507 0 4.40229E-5
6-168281064-A-G p.Asp255Gly missense MLLT4 1 83040 1.20424E-5 41520 0 NA
6-168281073-A-G p.Lys258Arg missense MLLT4 2 83054 2.40807E-5 41527 0 NA
6-168281074-A-G p.Lys258Lys synonymous MLLT4 2 83058 2.40796E-5 41529 0 6.37227E-5
6-168281077-A-G p.Pro259Pro synonymous MLLT4 1 83060 1.20395E-5 41530 0 NA
6-168281104-G-C p.Leu268Leu synonymous MLLT4 1 83016 1.20459E-5 41508 0 NA
6-168281125-C-G p.Asp275Glu missense MLLT4 17 82974 2.04883E-4 41487 0 2.86661E-4
6-168281156-G-A p.Gly286Ser missense MLLT4 1 82788 1.2079E-5 41394 0 NA
6-168281191-C-T p.Ile297Ile synonymous MLLT4 8 82260 9.72526E-5 41130 0 0.00151057
6-168281192-G-A p.Ala298Thr missense MLLT4 1 82198 1.21657E-5 41099 0 3.18715E-5
6-168281192-G-T p.Ala298Ser missense MLLT4 1 82198 1.21657E-5 41099 0 1.60047E-5
6-168281195-C-T p.Arg299Trp missense+splice_region MLLT4 4 82152 4.86902E-5 41076 0 2.86679E-4
6-168281200-A-G c.897+3A>G splice_region MLLT4 1 82024 1.21916E-5 41012 0 8.30317E-6
6-168281201-A-G c.897+4A>G splice_region MLLT4 1 82014 1.2193E-5 41007 0 8.30289E-6
6-168281202-G-A c.897+5G>A splice_region MLLT4 2 81972 2.43986E-5 40986 0 3.32231E-5
6-168281205-A-G c.897+8A>G splice_region MLLT4 1 81860 1.2216E-5 40930 0 3.18552E-5
6-168289887-T-C c.898-8T>C splice_region MLLT4 13 81960 1.58614E-4 40980 0 6.25E-4
6-168289888-T-G c.898-7T>G splice_region MLLT4 1673 81914 0.0204239 40957 25 0.0238914
6-168289896-T-G p.Val300Gly missense+splice_region MLLT4 1 82302 1.21504E-5 41151 0 2.80253E-5
6-168289904-C-T p.Pro303Ser missense MLLT4 2 82494 2.42442E-5 41247 0 NA
6-168289905-C-T p.Pro303Leu missense MLLT4 3 82514 3.63575E-5 41257 0 8.28995E-6
6-168289905-C-G p.Pro303Arg missense MLLT4 1 82514 1.21192E-5 41257 0 NA
6-168289913-G-T p.Ala306Ser missense MLLT4 1 82660 1.20978E-5 41330 0 NA
6-168289917-A-G p.Gln307Arg missense MLLT4 1 82736 1.20866E-5 41368 0 NA
6-168289918-G-A p.Gln307Gln synonymous MLLT4 5 82734 6.04346E-5 41367 0 6.25E-4
6-168289925-G-A p.Asp310Asn missense MLLT4 3 82796 3.62336E-5 41398 0 1.19577E-5
6-168289930-A-G p.Glu311Glu synonymous MLLT4 1 82840 1.20715E-5 41420 0 NA
6-168289948-T-C p.Ile317Ile synonymous MLLT4 1 82914 1.20607E-5 41457 0 NA
6-168289949-A-G p.Ile318Val missense MLLT4 1 82918 1.20601E-5 41459 0 NA
6-168289954-T-G p.Leu319Leu synonymous MLLT4 1 82936 1.20575E-5 41468 0 8.24674E-6
6-168289955-G-T p.Asp320Tyr missense MLLT4 1 82944 1.20563E-5 41472 0 3.18532E-5
6-168289957-T-C p.Asp320Asp synonymous MLLT4 1 82952 1.20552E-5 41476 0 NA
6-168289961-G-A p.Asp322Asn missense MLLT4 3 82964 3.61603E-5 41482 0 7.96445E-6
6-168289965-A-T p.Glu323Val missense MLLT4 1 82970 1.20525E-5 41485 0 2.38918E-5
6-168289990-A-G p.Glu331Glu synonymous MLLT4 1 82894 1.20636E-5 41447 0 3.98356E-6
6-168291537-T-C c.1010-5T>C splice_region MLLT4 2 82910 2.41225E-5 41455 0 4.00106E-6
6-168291539-T-C c.1010-3T>C splice_region MLLT4 1 82948 1.20557E-5 41474 0 6.05057E-4
6-168291551-T-G p.Val340Gly missense MLLT4 1 83020 1.20453E-5 41510 0 NA
6-168291559-T-C p.Leu343Leu synonymous MLLT4 3 83046 3.61246E-5 41523 0 NA
6-168291570-G-A p.Arg346Arg synonymous MLLT4 1 83058 1.20398E-5 41529 0 3.99776E-6
6-168291570-G-T p.Arg346Ser missense MLLT4 1 83058 1.20398E-5 41529 0 NA
6-168291572-C-T p.Pro347Leu missense MLLT4 5 83088 6.01772E-5 41544 0 8.2496E-6
6-168291580-C-T p.His350Tyr missense MLLT4 1 83102 1.20334E-5 41551 0 8.24511E-6
6-168291587-C-T p.Pro352Leu missense MLLT4 1 83122 1.20305E-5 41561 0 NA
6-168291609-G-A p.Leu359Leu synonymous MLLT4 7 83132 8.42034E-5 41566 0 0.00100705
6-168291614-G-A p.Gly361Asp missense MLLT4 1 83110 1.20322E-5 41555 0 NA
6-168291617-A-G p.Lys362Arg missense MLLT4 1 83120 1.20308E-5 41560 0 8.24076E-6
6-168291632-A-G p.Lys367Arg missense MLLT4 1 83100 1.20337E-5 41550 0 NA
6-168291633-G-C p.Lys367Asn missense MLLT4 1 83090 1.20351E-5 41545 0 3.18451E-5
6-168291638-GA-TT p.Arg369Ile missense MLLT4 1 83058 1.20398E-5 41529 0 NA
6-168291643-G-A p.Asp371Asn missense MLLT4 2 83050 2.40819E-5 41525 0 NA
6-168291646-G-A p.Gly372Arg missense MLLT4 1 83026 1.20444E-5 41513 0 3.18593E-5
6-168291657-T-C p.Tyr375Tyr synonymous MLLT4 1 83016 1.20459E-5 41508 0 NA
6-168291667-C-T p.Leu379Phe missense MLLT4 1 83014 1.20462E-5 41507 0 NA
6-168291674-C-T p.Pro381Leu missense MLLT4 1 82956 1.20546E-5 41478 0 5.03525E-4
6-168291675-G-A p.Pro381Pro synonymous MLLT4 3 82944 3.6169E-5 41472 0 1.15603E-4
6-168291684-G-A p.Leu384Leu synonymous MLLT4 1 82928 1.20587E-5 41464 0 5.03525E-4
6-168291686-C-CAAGGAAT p.Tyr386fs frameshift MLLT4 1 82914 1.20607E-5 41457 0 NA
6-168291689-A-G p.Tyr386Cys missense MLLT4 7 82894 8.44452E-5 41447 0 3.18512E-5
6-168294539-C-T c.1178-3C>T splice_region MLLT4 1 82436 1.21306E-5 41218 0 9.50272E-6
6-168294566-A-G p.Tyr401Cys missense MLLT4 1 82438 1.21303E-5 41219 0 2.29326E-5
6-168294572-A-G p.Tyr403Cys missense MLLT4 1 82416 1.21336E-5 41208 0 4.59939E-5
6-168294574-C-G p.His404Asp missense MLLT4 1 82432 1.21312E-5 41216 0 NA
6-168294579-T-G p.Thr405Thr synonymous MLLT4 1 82406 1.2135E-5 41203 0 NA
6-168294582-C-T p.Tyr406Tyr synonymous MLLT4 3 82386 3.6414E-5 41193 0 2.39331E-5
6-168294583-G-A p.Glu407Lys missense MLLT4 18 82390 2.18473E-4 41195 0 0.00119893
6-168294594-T-G c.1222+8T>G splice_region MLLT4 1 82354 1.21427E-5 41177 0 NA
6-168297561-G-A p.Gly409Asp missense MLLT4 1 82474 1.2125E-5 41237 0 NA
6-168297567-A-G p.Asp411Gly missense MLLT4 1 82498 1.21215E-5 41249 0 NA
6-168297568-C-G p.Asp411Glu missense MLLT4 1 82518 1.21186E-5 41259 0 3.98451E-6
6-168297571-T-C p.Ser412Ser synonymous MLLT4 1 82556 1.2113E-5 41278 0 1.65336E-5
6-168297622-G-A p.Gly429Gly synonymous MLLT4 2 82608 2.42107E-5 41304 0 8.26064E-6
6-168297636-A-T p.Asp434Val missense MLLT4 1 82524 1.21177E-5 41262 0 3.98422E-6
6-168297640-C-G p.Asp435Glu missense MLLT4 4 82532 4.8466E-5 41266 0 1.65494E-5
6-168297642-A-G p.Asn436Ser missense MLLT4 1 82482 1.21239E-5 41241 0 6.37186E-5
6-168297647-A-G p.Ile438Val missense MLLT4 1611 82342 0.0195647 41171 15 0.026875
6-168297657-G-T c.1317+5G>T splice_region MLLT4 6 82284 7.29182E-5 41142 0 6.25391E-4
6-168297657-G-A c.1317+5G>A splice_region MLLT4 7 82284 8.50712E-5 41142 0 6.25391E-4
6-168297659-A-G c.1317+7A>G splice_region MLLT4 3 82294 3.64547E-5 41147 0 3.9923E-5
6-168298895-C-G p.Pro443Arg missense MLLT4 9 83304 1.08038E-4 41652 0 1.1559E-4
6-168298903-C-G p.Gln446Glu missense MLLT4 1 83320 1.20019E-5 41660 0 3.18532E-5
6-168298910-A-G p.His448Arg missense MLLT4 1 83324 1.20013E-5 41662 0 NA
6-168298921-C-A p.Leu452Ile missense MLLT4 1 83332 1.20002E-5 41666 0 NA
6-168298925-C-A p.Thr453Asn missense MLLT4 2 83336 2.39992E-5 41668 0 3.18573E-5
6-168298941-GG-TA p.ValVal458ValIle missense MLLT4 2 83324 2.40027E-5 41662 0 NA
6-168298952-C-T p.Thr462Met missense MLLT4 1 83320 1.20019E-5 41660 0 5.03525E-4
6-168298953-G-A p.Thr462Thr synonymous MLLT4 3 83320 3.60058E-5 41660 0 1.64919E-5
6-168298963-A-G p.Met466Val missense MLLT4 5 83332 6.0001E-5 41666 0 3.18573E-5
6-168298968-C-T p.Asp467Asp synonymous MLLT4 1 83338 1.19993E-5 41669 0 0.00125
6-168298969-G-A p.Ala468Thr missense MLLT4 2 83340 2.39981E-5 41670 0 3.97817E-6
6-168298977-C-T p.Thr470Thr synonymous MLLT4 4 83336 4.79985E-5 41668 0 3.18218E-5
6-168298978-T-G p.Tyr471Asp missense MLLT4 3 83332 3.60006E-5 41666 0 7.41815E-5
6-168298980-C-T p.Tyr471Tyr synonymous MLLT4 10 83332 1.20002E-4 41666 0 0.00125
6-168298981-G-A p.Val472Met missense MLLT4 1 83334 1.19999E-5 41667 0 1.59105E-5
6-168298994-G-A p.Arg476His missense MLLT4 2 83330 2.4001E-5 41665 0 2.47255E-5
6-168298996-A-G p.Ile477Val missense MLLT4 1 83336 1.19996E-5 41668 0 8.24171E-6
6-168299001-A-G p.Ser478Ser synonymous MLLT4 1 83336 1.19996E-5 41668 0 3.97766E-6
6-168299008-A-G p.Thr481Ala missense MLLT4 3 83340 3.59971E-5 41670 0 1.19322E-5
6-168299010-C-G p.Thr481Thr synonymous MLLT4 1 83344 1.19985E-5 41672 0 7.95469E-6
6-168299013-G-A p.Met482Ile missense MLLT4 1 83340 1.1999E-5 41670 0 NA
6-168299016-G-A p.Leu483Leu synonymous MLLT4 1 83342 1.19988E-5 41671 0 NA
6-168299019-G-A p.Gln484Gln synonymous MLLT4 27 83346 3.23951E-4 41673 1 0.0015166
6-168299022-T-C p.Ser485Ser synonymous MLLT4 4 83346 4.79927E-5 41673 0 5.03525E-4
6-168299032-G-T p.Val489Leu missense MLLT4 1 83350 1.19976E-5 41675 0 NA
6-168299045-C-T p.Ala493Val missense MLLT4 2 83310 2.40067E-5 41655 0 8.24416E-6
6-168299046-G-A p.Ala493Ala synonymous MLLT4 1 83312 1.20031E-5 41656 0 3.29772E-5
6-168299068-G-A p.Asp501Asn missense MLLT4 1 83302 1.20045E-5 41651 0 NA
6-168299084-A-G p.His506Arg missense MLLT4 1 83292 1.2006E-5 41646 0 8.24974E-6
6-168299093-C-G p.Ala509Gly missense MLLT4 2 83276 2.40165E-5 41638 0 9.56572E-5
6-168299103-T-C p.Ser512Ser synonymous MLLT4 2 83270 2.40183E-5 41635 0 NA
6-168299109-T-C p.Asp514Asp synonymous MLLT4 1 83254 1.20114E-5 41627 0 NA
6-168299131-C-T p.Pro522Ser missense MLLT4 1 83202 1.20189E-5 41601 0 7.96597E-6
6-168299135-G-A p.Arg523Lys missense MLLT4 24 83204 2.88448E-4 41602 0 5.03525E-4
6-168299152-A-G c.1580+5A>G splice_region MLLT4 1 83090 1.20351E-5 41545 0 8.78627E-6
6-168299154-A-AGATT c.1580+7_1580+8insGATT splice_region MLLT4 4 83070 4.81522E-5 41535 0 4.00599E-6
6-168299155-G-C c.1580+8G>C splice_region MLLT4 2 83070 2.40761E-5 41535 0 NA
6-168302990-C-T c.1581-7C>T splice_region MLLT4 1412 83220 0.0169671 41610 20 0.015637
6-168303001-G-A p.Val529Ile missense MLLT4 1 83308 1.20036E-5 41654 0 NA
6-168303004-C-G p.Gln530Glu missense MLLT4 1 83306 1.20039E-5 41653 0 8.24239E-6
6-168303013-A-G p.Thr533Ala missense MLLT4 4 83320 4.80077E-5 41660 0 5.03525E-4
6-168303035-T-C p.Ile540Thr missense MLLT4 19 83322 2.28031E-4 41661 0 5.41401E-4
6-168303038-A-G p.His541Arg missense MLLT4 1 83324 1.20013E-5 41662 0 NA
6-168303057-G-A p.Pro547Pro synonymous MLLT4 386 83284 0.00463474 41642 6 0.00971833
6-168303064-A-C p.Lys550Gln missense+splice_region MLLT4 1 83280 1.20077E-5 41640 0 8.24362E-6
6-168303065-A-G p.Lys550Arg missense+splice_region MLLT4 1 83284 1.20071E-5 41642 0 NA
6-168307844-CATG-C c.1651-6_1651-4delATG splice_region MLLT4 8 83262 9.60822E-5 41631 0 4.28583E-4
6-168307847-G-T c.1651-4G>T splice_region MLLT4 4 83274 4.80342E-5 41637 0 NA
6-168307848-T-C c.1651-3T>C splice_region MLLT4 1 83266 1.20097E-5 41633 0 NA
6-168307866-G-A p.Asp556Asn missense MLLT4 5 83302 6.00226E-5 41651 0 4.37839E-5
6-168307882-C-T p.Ser561Leu missense MLLT4 2 83314 2.40056E-5 41657 0 NA
6-168307885-C-G p.Ser562Cys missense MLLT4 1 83316 1.20025E-5 41658 0 3.9794E-6
6-168307888-C-T p.Ala563Val missense MLLT4 1 83328 1.20008E-5 41664 0 NA
6-168307896-A-G p.Thr566Ala missense MLLT4 2 83316 2.4005E-5 41658 0 1.98888E-5
6-168307900-CC-TT p.Ala567Val missense MLLT4 1 83324 1.20013E-5 41662 0 NA
6-168307903-A-G p.Glu568Gly missense MLLT4 1 83322 1.20016E-5 41661 0 NA
6-168307905-C-A p.Arg569Arg synonymous MLLT4 1 83312 1.20031E-5 41656 0 3.18451E-5
6-168307905-C-T p.Arg569Trp missense MLLT4 3 83312 3.60092E-5 41656 0 8.23927E-6
6-168307906-G-A p.Arg569Gln missense MLLT4 1 83328 1.20008E-5 41664 0 1.98899E-5
6-168307912-T-A p.Met571Lys missense MLLT4 1 83322 1.20016E-5 41661 0 3.97772E-6
6-168307921-C-T p.Pro574Leu missense MLLT4 16 83326 1.92017E-4 41663 0 0.00100705
6-168307921-C-G p.Pro574Arg missense MLLT4 1 83326 1.20011E-5 41663 0 NA
6-168307922-G-A p.Pro574Pro synonymous MLLT4 1 83328 1.20008E-5 41664 0 NA
6-168307928-C-G p.Ile576Met missense MLLT4 2 83322 2.40033E-5 41661 0 3.1839E-5
6-168307954-G-A p.Arg585His missense MLLT4 1 83292 1.2006E-5 41646 0 6.36821E-5
6-168307968-A-G p.Arg590Gly missense+splice_region MLLT4 2 83250 2.4024E-5 41625 0 7.97467E-5
6-168307976-AAC-A c.1769+8_1769+9delAC splice_region MLLT4 1 83200 1.20192E-5 41600 0 NA
6-168311783-C-T p.Thr591Ile missense+splice_region MLLT4 13 83286 1.56089E-4 41643 0 2.36189E-4
6-168311786-A-T p.Gln592Leu missense MLLT4 1 83286 1.20068E-5 41643 0 NA
6-168311789-A-G p.Asp593Gly missense MLLT4 1 83292 1.2006E-5 41646 0 NA
6-168311790-T-A p.Asp593Glu missense MLLT4 3 83298 3.60153E-5 41649 0 1.19916E-5
6-168311805-G-A p.Glu598Glu synonymous MLLT4 2505 83248 0.0300908 41624 53 0.0438328
6-168311817-T-C p.Pro602Pro synonymous MLLT4 2 83334 2.39998E-5 41667 0 NA
6-168311819-C-T p.Ala603Val missense MLLT4 2 83328 2.40015E-5 41664 0 3.18471E-5
6-168311842-TGTGAGTAATTTCAGATTTCATTGTCAATGAATTATTTCTTGATCCATTTTACTCCATCTGATTTTCACATTCGTTTTTATTCTTTTTTCCTTTTTTCTTTGTTTTTGAAATCTTTCCACAG-T c.1831+1_1832-1del splice_acceptor MLLT4 2 83316 2.4005E-5 41658 1 NA
6-168311847-GTAAT-G c.1831+6_1831+9delTAAT splice_region MLLT4 3 83312 3.60092E-5 41656 0 4.77661E-5
6-168311958-C-T c.1832-6C>T splice_region MLLT4 1 83294 1.20057E-5 41647 0 NA
6-168311960-A-G c.1832-4A>G splice_region MLLT4 8 83294 9.60453E-5 41647 0 0.00125313
6-168311961-C-T c.1832-3C>T splice_region MLLT4 2 83292 2.40119E-5 41646 0 NA
6-168311970-A-T p.Asp613Val missense MLLT4 5 83302 6.00226E-5 41651 0 1.653E-5
6-168311998-T-C p.Tyr622Tyr synonymous MLLT4 9 83312 1.08028E-4 41656 0 9.55171E-5
6-168312000-C-T p.Thr623Ile missense MLLT4 1 83314 1.20028E-5 41657 0 NA
6-168312030-C-G p.Ser633Cys missense MLLT4 1 83312 1.20031E-5 41656 0 NA
6-168312057-G-GC p.Arg643fs frameshift MLLT4 1 83294 1.20057E-5 41647 0 NA
6-168312062-T-C p.Tyr644His missense MLLT4 1 83296 1.20054E-5 41648 0 NA
6-168312073-C-T p.Ser647Ser synonymous MLLT4 1 83284 1.20071E-5 41642 0 NA
6-168312074-A-G p.Asn648Asp missense MLLT4 4 83284 4.80284E-5 41642 0 3.18512E-5
6-168312075-A-G p.Asn648Ser missense MLLT4 57 83286 6.84389E-4 41643 0 0.00190289
6-168312101-A-G p.Thr657Ala missense MLLT4 3 83260 3.60317E-5 41630 0 NA
6-168312105-A-G p.Glu658Gly missense MLLT4 48 83246 5.76604E-4 41623 0 6.25E-4
6-168312107-C-T p.Arg659Cys missense MLLT4 1 83246 1.20126E-5 41623 0 3.18634E-5
6-168312108-G-A p.Arg659His missense MLLT4 3 83242 3.60395E-5 41621 0 3.18715E-5
6-168312131-G-A p.Val667Ile missense MLLT4 6 83230 7.20894E-5 41615 0 5.03525E-4
6-168312138-A-G p.Lys669Arg missense MLLT4 1 83236 1.2014E-5 41618 0 3.18471E-5
6-168312147-G-A p.Ser672Asn missense MLLT4 2 83222 2.40321E-5 41611 0 NA
6-168312157-G-C p.Glu675Asp missense MLLT4 19 83210 2.28338E-4 41605 0 8.59982E-4
6-168312173-C-T p.Arg379Cys missense MLLT4 4 83182 4.80873E-5 41591 0 9.9677E-5
6-168312183-G-A p.Arg382Gln missense MLLT4 2 83124 2.40604E-5 41562 0 2.88667E-5
6-168312191-A-G p.Met385Val missense MLLT4 1 83092 1.20349E-5 41546 0 1.01484E-5
6-168312194-C-T p.Leu386Phe missense MLLT4 1 83048 1.20412E-5 41524 0 NA
6-168312196-C-T p.Leu386Leu synonymous MLLT4 1 83054 1.20404E-5 41527 0 8.07487E-6
6-168312200-C-G p.Gln388Glu missense MLLT4 6 83042 7.22526E-5 41521 0 5.44034E-5
6-168312201-A-G p.Gln388Arg missense MLLT4 1 83028 1.20441E-5 41514 0 1.09491E-5
6-168314100-C-T p.Asp685Asp synonymous MLLT4 1 76310 1.31044E-5 38155 0 9.56023E-5
6-168314109-A-T c.2058+6A>T splice_region MLLT4 1 76324 1.3102E-5 38162 0 6.3743E-5
6-168314111-A-G c.2058+8A>G splice_region MLLT4 1 76312 1.31041E-5 38156 0 NA
6-168314855-A-G p.Lys682Arg missense MLLT4 1 83168 1.20239E-5 41584 0 NA
6-168314858-A-C p.Asn683Thr missense MLLT4 1 83180 1.20221E-5 41590 0 NA
6-168314864-C-G p.Ala685Gly missense MLLT4 1 83190 1.20207E-5 41595 0 NA
6-168314874-T-C p.Leu688Leu synonymous MLLT4 1 83220 1.20163E-5 41610 0 NA
6-168314877-C-T p.Ala689Ala synonymous MLLT4 1 83228 1.20152E-5 41614 0 7.95779E-6
6-168314880-C-T p.Phe690Phe synonymous MLLT4 1 83244 1.20129E-5 41622 0 1.2734E-4
6-168314919-G-A p.Lys703Lys synonymous MLLT4 1 83254 1.20114E-5 41627 0 NA
6-168314927-G-A p.Arg706Gln missense MLLT4 9 83242 1.08118E-4 41621 0 0.00194218
6-168314939-G-A p.Arg710Gln missense MLLT4 67 83226 8.05037E-4 41613 1 9.55536E-4
6-168314946-A-G p.Thr712Thr synonymous MLLT4 1 83244 1.20129E-5 41622 0 8.24076E-6
6-168314953-G-A p.Ala715Thr missense MLLT4 2 83228 2.40304E-5 41614 0 3.18431E-5
6-168314958-A-G p.Gln716Gln synonymous MLLT4 1 83222 1.20161E-5 41611 0 8.24212E-6
6-168314959-G-A p.Asp717Asn missense MLLT4 2 83222 2.40321E-5 41611 1 NA
6-168314962-G-A p.Val718Ile missense MLLT4 1 83206 1.20184E-5 41603 0 8.24226E-6
6-168314975-T-C p.Leu722Ser missense MLLT4 1 83182 1.20218E-5 41591 0 1.47281E-4
6-168314987-C-T p.Ala726Val missense MLLT4 2 83122 2.4061E-5 41561 0 NA
6-168314997-AG-A c.2183+5delG splice_region MLLT4 12422 82936 0.149778 41468 1015 0.135575
6-168315336-C-T p.His732His synonymous MLLT4 1 82994 1.20491E-5 41497 0 NA
6-168315345-A-G p.Gln735Gln synonymous MLLT4 137 83040 0.00164981 41520 1 0.00337515
6-168315362-A-G p.Tyr741Cys missense MLLT4 2 83088 2.40709E-5 41544 0 5.03525E-4
6-168315367-C-A p.Pro743Thr missense MLLT4 3 83102 3.61002E-5 41551 0 6.36943E-5
6-168315378-A-G p.Leu746Leu synonymous MLLT4 1 83122 1.20305E-5 41561 0 NA
6-168315387-T-C p.Pro749Pro synonymous MLLT4 6 83126 7.21796E-5 41563 0 6.3678E-5
6-168315397-A-G p.Ser753Gly missense MLLT4 1 83096 1.20343E-5 41548 0 NA
6-168315402-G-C p.Leu754Leu synonymous MLLT4 1 83076 1.20372E-5 41538 0 3.98298E-6
6-168315422-A-T c.2278+4A>T splice_region MLLT4 2 82904 2.41243E-5 41452 0 NA
6-168315424-G-C c.2278+6G>C splice_region MLLT4 24 82870 2.8961E-4 41435 0 4.14171E-4
6-168315425-A-G c.2278+7A>G splice_region MLLT4 1 82860 1.20685E-5 41430 0 3.18471E-5
6-168315892-C-T p.Arg775Cys missense MLLT4 2 82912 2.4122E-5 41456 0 8.23995E-6
6-168315893-G-A p.Arg775His missense MLLT4 1 82930 1.20584E-5 41465 0 NA
6-168315909-C-T p.Ala780Ala synonymous MLLT4 3 83066 3.61159E-5 41533 0 3.58149E-5
6-168315938-TC-AA p.Leu790Gln missense MLLT4 1 83160 1.2025E-5 41580 0 NA
6-168315939-C-T p.Leu790Leu synonymous MLLT4 7 83164 8.4171E-5 41582 0 1.64758E-4
6-168315953-A-G p.Asn795Ser missense MLLT4 2 83160 2.405E-5 41580 0 4.11909E-5
6-168315955-A-T p.Met796Leu missense MLLT4 1 83158 1.20253E-5 41579 0 NA
6-168315975-G-T p.Leu802Phe missense MLLT4 4 83108 4.81301E-5 41554 0 3.18451E-5
6-168315978-G-C p.Val803Val synonymous MLLT4 8752 82966 0.105489 41483 559 0.133113
6-168315980-C-T p.Thr804Ile missense MLLT4 1 83094 1.20346E-5 41547 0 3.97858E-6
6-168315981-C-T p.Thr804Thr synonymous MLLT4 3 83098 3.6102E-5 41549 0 5.03525E-4
6-168315982-G-A p.Asp805Asn missense MLLT4 2 83086 2.40714E-5 41543 0 2.38753E-5
6-168316002-C-T p.Cys811Cys synonymous MLLT4 2 83042 2.40842E-5 41521 0 3.18451E-5
6-168316019-C-T p.Ala817Val missense MLLT4 24 83002 2.8915E-4 41501 0 1.79109E-4
6-168316023-T-C p.Ile818Ile synonymous MLLT4 9 83030 1.08395E-4 41515 0 1.59195E-4
6-168316027-C-T p.Arg820Cys missense MLLT4 6 83012 7.22787E-5 41506 0 2.47329E-5
6-168316028-G-A p.Arg820His missense MLLT4 8 83014 9.63693E-5 41507 0 3.1837E-5
6-168316046-T-C p.Ile826Thr missense MLLT4 44 82972 5.30299E-4 41486 0 0.00146497
6-168316071-G-C p.Gly834Gly synonymous MLLT4 1 82908 1.20616E-5 41454 0 1.99273E-5
6-168316086-G-A p.Ala839Ala synonymous MLLT4 1 82826 1.20735E-5 41413 0 3.18512E-5
6-168316096-C-T p.Leu843Leu synonymous MLLT4 1 82800 1.20773E-5 41400 0 NA
6-168316099-A-T p.Ser844Cys missense MLLT4 1 82738 1.20863E-5 41369 0 4.00824E-6
6-168316118-T-G c.2544+5T>G splice_region MLLT4 35514 78394 0.453019 39197 7949 0.529363
6-168317773-C-T p.Thr850Met missense MLLT4 5 83224 6.00788E-5 41612 0 6.25E-4
6-168317789-G-A p.Met855Ile missense MLLT4 1 83258 1.20109E-5 41629 0 NA
6-168317792-T-G p.Asp856Glu missense MLLT4 3 83272 3.60265E-5 41636 0 NA
6-168317816-A-C p.Pro864Pro synonymous MLLT4 8960 83124 0.107791 41562 574 0.134455
6-168317817-A-G p.Asn865Asp missense MLLT4 1 83278 1.2008E-5 41639 0 8.24674E-6
6-168317817-A-C p.Asn865His missense MLLT4 1 83278 1.2008E-5 41639 0 5.03525E-4
6-168317820-A-G p.Ile866Val missense MLLT4 1 83282 1.20074E-5 41641 0 NA
6-168317827-G-A p.Ser868Asn missense MLLT4 6 83294 7.2034E-5 41647 0 4.8043E-5
6-168317830-C-G p.Thr869Ser missense MLLT4 3 83290 3.60187E-5 41645 0 3.18532E-5
6-168317854-A-G p.Gln877Arg missense MLLT4 1 83316 1.20025E-5 41658 0 NA
6-168317867-A-G p.Leu881Leu synonymous MLLT4 3 83292 3.60179E-5 41646 0 5.0005E-5
6-168317882-C-G p.His886Gln missense MLLT4 11 83276 1.32091E-4 41638 0 5.30686E-5
6-168317892-G-A p.Asp890Asn missense MLLT4 1 83238 1.20137E-5 41619 0 NA
6-168317906-C-T p.Ile894Ile synonymous MLLT4 3 83098 3.6102E-5 41549 0 4.28758E-5
6-168317909-A-G p.Pro895Pro synonymous MLLT4 1 83056 1.20401E-5 41528 0 8.81158E-6
6-168317911-C-T p.Thr896Met missense+splice_region MLLT4 1 83046 1.20415E-5 41523 0 3.18492E-5
6-168317920-G-C c.2688+8G>C splice_region MLLT4 1 82914 1.20607E-5 41457 0 NA
6-168319408-CA-C c.2689-6delA splice_region MLLT4 1 82620 1.21036E-5 41310 0 2.3897E-5
6-168319409-A-G c.2689-6A>G splice_region MLLT4 2 82658 2.41961E-5 41329 0 NA
6-168319412-C-T c.2689-3C>T splice_region MLLT4 2 82718 2.41785E-5 41359 0 NA
6-168319422-T-C p.Ile899Thr missense MLLT4 6 82902 7.23746E-5 41451 0 0.00201613
6-168319422-T-A p.Ile899Lys missense MLLT4 2 82902 2.41249E-5 41451 0 NA
6-168319429-T-C p.Asn901Asn synonymous MLLT4 2 82978 2.41028E-5 41489 0 8.26692E-6
6-168319450-C-T p.Asn908Asn synonymous MLLT4 2 83142 2.40552E-5 41571 0 8.27499E-6
6-168319456-C-T p.Ala910Ala synonymous MLLT4 13 83166 1.56314E-4 41583 0 0.00100705
6-168319458-A-G p.Asp911Gly missense MLLT4 1 83172 1.20233E-5 41586 0 NA
6-168319459-T-C p.Asp911Asp synonymous MLLT4 1 83174 1.2023E-5 41587 0 3.98241E-6
6-168319464-T-A p.Leu913Gln missense MLLT4 2 83194 2.40402E-5 41597 0 NA
6-168319466-G-T p.Ala914Ser missense MLLT4 2 83190 2.40414E-5 41595 0 NA
6-168319470-G-A p.Arg915His missense MLLT4 1 83190 1.20207E-5 41595 0 6.36821E-5
6-168319471-C-T p.Arg915Arg synonymous MLLT4 1 83198 1.20195E-5 41599 0 3.31752E-5
6-168319476-A-T p.Asp917Val missense MLLT4 1 83196 1.20198E-5 41598 0 3.99017E-6
6-168319496-G-A p.Glu924Lys missense MLLT4 1 83168 1.20239E-5 41584 0 9.55171E-5
6-168319505-C-T p.Pro927Ser missense MLLT4 1 83140 1.20279E-5 41570 0 3.18512E-5
6-168319569-T-G p.Ile948Ser missense MLLT4 1 82906 1.20619E-5 41453 0 NA
6-168319575-A-G p.Asn950Ser missense MLLT4 1 82858 1.20688E-5 41429 0 NA
6-168319579-T-C p.Gly951Gly synonymous MLLT4 2 82806 2.41528E-5 41403 0 5.17491E-5
6-168319584-A-G p.Gln953Arg missense MLLT4 1 82754 1.2084E-5 41377 0 NA
6-168319597-C-T p.Asp957Asp synonymous MLLT4 1 82608 1.21054E-5 41304 0 NA
6-168319605-G-A p.Cys960Tyr missense MLLT4 3 82502 3.63628E-5 41251 0 NA
6-168323528-C-T c.2888-8C>T splice_region MLLT4 17 83046 2.04706E-4 41523 0 6.73272E-4
6-168323543-C-T p.Cys965Cys synonymous MLLT4 2 83152 2.40523E-5 41576 0 NA
6-168323553-C-G p.Pro969Ala missense MLLT4 1 83174 1.2023E-5 41587 0 4.00471E-6
6-168323556-C-T p.His970Tyr missense MLLT4 1 83188 1.2021E-5 41594 0 3.18431E-5
6-168323562-C-T p.Arg972Cys missense MLLT4 4 83186 4.8085E-5 41593 0 3.29772E-5
6-168323567-A-C p.Ser973Ser synonymous MLLT4 1 83170 1.20236E-5 41585 0 1.64864E-5
6-168323616-C-T p.Leu990Phe missense MLLT4 23 83174 2.76529E-4 41587 0 2.22567E-4
6-168323623-G-A p.Arg992His missense MLLT4 6 83160 7.21501E-5 41580 0 1.48405E-4
6-168323628-A-G p.Asn994Asp missense MLLT4 1 83152 1.20262E-5 41576 0 NA
6-168323659-C-G p.Pro167Arg missense MLLT4 14 82966 1.68744E-4 41483 0 5.41332E-4
6-168323882-AC-A c.*222delC splice_region MLLT4 2 27264 7.33568E-5 13632 0 6.37024E-5
6-168325614-C-G c.2996-6C>G splice_region MLLT4 1 80098 1.24847E-5 40049 0 3.18593E-5
6-168325623-T-C c.2997+2T>C splice_donor MLLT4 1 80658 1.2398E-5 40329 0 NA
6-168325626-A-G c.2997+5A>G splice_region MLLT4 376 80918 0.00464668 40459 5 0.00946041
6-168325694-C-T p.Leu1001Leu synonymous MLLT4 2 83144 2.40547E-5 41572 0 2.78458E-5
6-168325696-G-T p.Leu1001Leu synonymous MLLT4 1 83150 1.20265E-5 41575 0 NA
6-168325700-A-C p.Lys1003Gln missense MLLT4 1 83166 1.20241E-5 41583 0 NA
6-168325701-A-G p.Lys1003Arg missense MLLT4 1 83172 1.20233E-5 41586 0 3.1837E-5
6-168325714-A-G p.Ile1007Met missense MLLT4 4 83212 4.807E-5 41606 0 7.95545E-6
6-168325749-G-A p.Gly1019Asp missense MLLT4 1 83216 1.20169E-5 41608 0 NA
6-168343804-A-C c.3079-5A>C splice_region MLLT4 2 83218 2.40333E-5 41609 0 1.66381E-5
6-168343823-T-G p.Asp1031Glu missense MLLT4 1 83232 1.20146E-5 41616 0 NA
6-168343823-T-C p.Asp1031Asp synonymous MLLT4 1 83232 1.20146E-5 41616 0 NA
6-168343837-A-G p.Tyr1036Cys missense MLLT4 1 83224 1.20158E-5 41612 0 NA
6-168343838-T-C p.Tyr1036Tyr synonymous MLLT4 36949 82636 0.44713 41318 8421 0.510539
6-168343847-G-A p.Ser1039Ser synonymous MLLT4 1 83194 1.20201E-5 41597 0 3.1839E-5
6-168343847-G-C p.Ser1039Ser synonymous MLLT4 1 83194 1.20201E-5 41597 0 8.25764E-6
6-168343872-G-A c.3093+1G>A splice_donor MLLT4 3 83026 3.61333E-5 41513 0 3.98794E-6
6-168344083-A-T p.Asp1049Val missense+splice_region MLLT4 1 83350 1.19976E-5 41675 0 NA
6-168344083-A-G p.Asp1049Gly missense+splice_region MLLT4 1 83350 1.19976E-5 41675 0 NA
6-168344089-G-A p.Arg1051His missense MLLT4 1 83360 1.19962E-5 41680 0 8.23642E-6
6-168344099-A-G p.Ala1054Ala synonymous MLLT4 1 83360 1.19962E-5 41680 0 NA
6-168344128-G-A p.Arg1064Gln missense MLLT4 2 83346 2.39964E-5 41673 0 3.18471E-5
6-168344128-G-T p.Arg1064Leu missense MLLT4 2 83346 2.39964E-5 41673 0 NA
6-168344145-T-C p.Ser1070Pro missense MLLT4 1 83316 1.20025E-5 41658 0 8.23642E-6
6-168344160-C-T c.3218+5C>T splice_region MLLT4 2 83258 2.40217E-5 41629 0 3.97852E-6
6-168344616-C-T c.3219-5C>T splice_region MLLT4 1 83298 1.20051E-5 41649 0 1.59165E-5
6-168344624-G-A p.Ala1074Ala synonymous MLLT4 3 83308 3.60109E-5 41654 0 6.36532E-5
6-168344675-G-C p.Lys1091Asn missense MLLT4 1 83342 1.19988E-5 41671 0 3.97687E-6
6-168344678-G-A p.Gln1092Gln synonymous MLLT4 5 83344 5.99923E-5 41672 0 8.35143E-5
6-168344693-C-T p.His1097His synonymous MLLT4 5 83320 6.00096E-5 41660 0 1.91095E-4
6-168344694-G-A p.Gly1098Ser missense MLLT4 2 83316 2.4005E-5 41658 0 0.00100806
6-168344711-C-T p.Leu1103Leu synonymous MLLT4 1 83274 1.20085E-5 41637 0 3.97833E-6
6-168344725-C-G p.Pro1108Arg missense MLLT4 1 83220 1.20163E-5 41610 0 NA
6-168344728-T-A p.Met1109Lys missense MLLT4 9 83198 1.08176E-4 41599 0 6.68659E-4
6-168347383-C-T c.3338-4C>T splice_region MLLT4 1 83288 1.20065E-5 41644 0 NA
6-168347385-A-G c.3338-2A>G splice_acceptor MLLT4 1 83302 1.20045E-5 41651 0 NA
6-168347392-G-T p.Asp1115Tyr missense MLLT4 1 83310 1.20034E-5 41655 0 NA
6-168347396-G-A p.Arg1116His missense MLLT4 1 83314 1.20028E-5 41657 0 3.3077E-5
6-168347402-G-C p.Gly1118Ala missense MLLT4 4 83324 4.80054E-5 41662 0 4.37947E-5
6-168347417-G-A p.Arg1123Gln missense MLLT4 2 83310 2.40067E-5 41655 0 8.25314E-6
6-168347457-T-A p.Thr1136Thr synonymous MLLT4 15 83330 1.80007E-4 41665 0 1.27421E-4
6-168347467-TCTCCTGAGAGTC-T p.Pro1141_Pro1144del disruptive_inframe_deletion MLLT4 1 83348 1.19979E-5 41674 0 NA
6-168347471-C-T p.Pro1141Leu missense MLLT4 1 83342 1.19988E-5 41671 0 6.36821E-5
6-168347475-G-A p.Glu1142Glu synonymous MLLT4 1 83340 1.1999E-5 41670 0 NA
6-168347478-T-G p.Ser1143Arg missense MLLT4 1 83332 1.20002E-5 41666 0 NA
6-168347495-C-T p.Ala1149Val missense MLLT4 1 83348 1.19979E-5 41674 0 3.18573E-5
6-168347497-G-A p.Glu1150Lys missense MLLT4 1 83344 1.19985E-5 41672 0 NA
6-168347504-G-A p.Ser1152Asn missense MLLT4 1 83348 1.19979E-5 41674 0 NA
6-168347505-T-C p.Ser1152Ser synonymous MLLT4 2 83348 2.39958E-5 41674 0 8.23655E-6
6-168347509-C-A p.Pro1154Thr missense MLLT4 1 83350 1.19976E-5 41675 0 NA
6-168347512-A-G p.Lys1155Glu missense MLLT4 3 83346 3.59945E-5 41673 0 NA
6-168347514-G-T p.Lys1155Asn missense MLLT4 1 83352 1.19973E-5 41676 0 NA
6-168347522-C-G p.Pro1158Arg missense MLLT4 1 83346 1.19982E-5 41673 0 3.18492E-5
6-168347529-T-C p.Asp1160Asp synonymous MLLT4 2 83352 2.39946E-5 41676 0 NA
6-168347532-C-G p.Asp1161Glu missense MLLT4 1 83350 1.19976E-5 41675 0 NA
6-168347547-T-G p.Asn1166Lys missense MLLT4 6 83324 7.20081E-5 41662 0 NA
6-168347547-T-C p.Asn1166Asn synonymous MLLT4 3 83324 3.6004E-5 41662 0 NA
6-168347550-A-G p.Arg1167Arg synonymous MLLT4 1 83326 1.20011E-5 41663 0 NA
6-168347556-T-A p.Asp1169Glu missense MLLT4 1 83308 1.20036E-5 41654 0 2.47113E-5
6-168347561-G-A p.Arg1171His missense MLLT4 4 83296 4.80215E-5 41648 0 6.25E-4
6-168347573-A-G p.Asn1175Ser missense MLLT4 2 83276 2.40165E-5 41638 0 NA
6-168347574-C-T p.Asn1175Asn synonymous MLLT4 2 83262 2.40206E-5 41631 0 2.47174E-5
6-168347578-G-A p.Ala1177Thr missense MLLT4 2 83250 2.4024E-5 41625 0 6.36862E-5
6-168347584-A-G c.3532+3A>G splice_region MLLT4 2 83200 2.40385E-5 41600 0 1.23042E-5
6-168348545-G-C p.Ser1182Thr missense MLLT4 2 83172 2.40466E-5 41586 0 8.253E-6
6-168348549-T-C p.Pro1183Pro synonymous MLLT4 5 83190 6.01034E-5 41595 0 0.00100705
6-168348550-G-A p.Gly1184Arg missense MLLT4 1 83196 1.20198E-5 41598 0 9.57304E-5
6-168348552-A-T p.Gly1184Gly synonymous MLLT4 3 83200 3.60577E-5 41600 0 1.27641E-4
6-168348559-A-G p.Ser1187Gly missense MLLT4 320 83194 0.00384643 41597 5 0.00681876
6-168348560-G-A p.Ser1187Asn missense MLLT4 1 83206 1.20184E-5 41603 0 3.97788E-6
6-168348570-C-T p.Ala1190Ala synonymous MLLT4 1 83232 1.20146E-5 41616 0 NA
6-168348572-C-T p.Ser1191Phe missense MLLT4 5 83236 6.00702E-5 41618 0 3.29663E-5
6-168348583-G-A p.Ala1195Thr missense MLLT4 7 83248 8.40861E-5 41624 0 1.91192E-4
6-168348594-A-G p.Thr1198Thr synonymous MLLT4 8 83240 9.61076E-5 41620 0 8.24198E-6
6-168348606-T-G p.Thr1202Thr synonymous MLLT4 3 83238 3.60412E-5 41619 0 9.55718E-5
6-168348624-G-A p.Glu1208Glu splice_region+synonymous MLLT4 1 83136 1.20285E-5 41568 0 NA
6-168348625-G-GAGCAGACGCCTCCGCCTAGACCTGAAGCCTACCCCA c.3624+1_3624+2insAGCAGACGCCTCCGCCTAGACCTGAAGCCTACCCCA splice_donor MLLT4 1 83128 1.20296E-5 41564 0 NA
6-168348627-CTGAT-C c.3624+4_3624+7delTGAT splice_region MLLT4 2 83112 2.40639E-5 41556 0 NA
6-168348968-T-C c.3625-5T>C splice_region MLLT4 3 83072 3.61133E-5 41536 0 1.66711E-5
6-168348970-C-T c.3625-3C>T splice_region MLLT4 1 83092 1.20349E-5 41546 0 4.18473E-6
6-168348980-C-T p.Thr1211Met missense MLLT4 7 83202 8.41326E-5 41601 1 3.18634E-5
6-168348981-G-A p.Thr1211Thr synonymous MLLT4 250 83190 0.00300517 41595 7 0.00939283
6-168348987-G-A p.Pro1213Pro synonymous MLLT4 36 83252 4.32422E-4 41626 0 3.50743E-4
6-168348987-G-T p.Pro1213Pro synonymous MLLT4 1 83254 1.20114E-5 41627 0 NA
6-168348989-C-T p.Pro1214Leu missense MLLT4 9 83270 1.08082E-4 41635 0 1.91119E-4
6-168348991-A-C p.Arg1215Arg synonymous MLLT4 1 83282 1.20074E-5 41641 0 NA
6-168348995-C-G p.Pro1216Arg missense MLLT4 1 83302 1.20045E-5 41651 0 NA
6-168348996-T-C p.Pro1216Pro synonymous MLLT4 3 83308 3.60109E-5 41654 0 3.18512E-5
6-168349011-C-T p.Ile1221Ile synonymous MLLT4 18997 82890 0.229183 41445 2213 0.25875
6-168349044-C-A p.Thr1232Thr synonymous MLLT4 3 83380 3.59799E-5 41690 0 7.15768E-5
6-168349052-C-G p.Ala1235Gly missense MLLT4 4 83380 4.79731E-5 41690 0 8.23764E-6
6-168349052-C-T p.Ala1235Val missense MLLT4 3 83380 3.59799E-5 41690 0 3.9764E-6
6-168349056-C-T p.Ser1236Ser synonymous MLLT4 1 83386 1.19924E-5 41693 0 4.11889E-5
6-168349067-A-G p.Asp1240Gly missense MLLT4 1 83380 1.19933E-5 41690 0 NA
6-168349070-G-A p.Arg1241Gln missense MLLT4 2 83386 2.39848E-5 41693 0 2.47158E-5
6-168349074-G-T p.Met1242Ile missense MLLT4 13 83382 1.55909E-4 41691 0 1.07102E-4
6-168349077-T-C p.Ala1243Ala synonymous MLLT4 4 83384 4.79708E-5 41692 0 6.37186E-5
6-168349078-C-G p.Pro1244Ala missense MLLT4 2 83384 2.39854E-5 41692 0 NA
6-168349082-C-T p.Pro1245Leu missense MLLT4 2 83386 2.39848E-5 41693 0 NA
6-168349104-T-C p.Tyr1252Tyr synonymous MLLT4 1 83368 1.1995E-5 41684 0 6.25E-4
6-168349123-C-G p.His1259Asp missense MLLT4 1 83360 1.19962E-5 41680 0 3.97716E-6
6-168349125-C-T p.His1259His synonymous MLLT4 57 83354 6.8383E-4 41677 0 4.25579E-4
6-168349127-C-T p.Thr1260Ile missense MLLT4 1 83350 1.19976E-5 41675 0 1.65125E-5
6-168349138-C-T p.His1264Tyr missense MLLT4 2 83346 2.39964E-5 41673 0 NA
6-168349147-A-G p.Ile1267Val missense MLLT4 2 83316 2.4005E-5 41658 0 NA
6-168349150-G-T p.Ala1268Ser missense MLLT4 4 83304 4.80169E-5 41652 0 1.41196E-4
6-168351866-C-T p.Arg1271Cys missense+splice_region MLLT4 2 83064 2.40778E-5 41532 0 6.40738E-5
6-168351867-G-A p.Arg1271His missense+splice_region MLLT4 16 83214 1.92275E-4 41607 0 0.00100705
6-168351873-C-T p.Thr1273Ile missense MLLT4 8 83322 9.60131E-5 41661 0 2.86734E-4
6-168351874-A-T p.Thr1273Thr synonymous MLLT4 2 83330 2.4001E-5 41665 0 NA
6-168351875-C-G p.Arg1274Gly missense MLLT4 1 83326 1.20011E-5 41663 0 NA
6-168351879-C-A p.Ser1275Tyr missense MLLT4 1 83332 1.20002E-5 41666 0 3.59848E-5
6-168351893-C-T p.Arg1280* stop_gained MLLT4 1 83354 1.1997E-5 41677 0 4.61757E-6
6-168351894-G-A p.Arg1280Gln missense MLLT4 1 83314 1.20028E-5 41657 0 1.77579E-5
6-168351920-C-T p.Arg1289Trp missense MLLT4 3 83398 3.59721E-5 41699 0 3.18532E-5
6-168351921-G-A p.Arg1289Gln missense MLLT4 4 83390 4.79674E-5 41695 0 6.02078E-5
6-168351924-A-C p.His1290Pro missense MLLT4 3 83400 3.59712E-5 41700 0 5.03525E-4
6-168351934-G-A p.Glu1293Glu synonymous MLLT4 1 83410 1.1989E-5 41705 0 NA
6-168351941-A-G p.Met1296Val missense MLLT4 2 83408 2.39785E-5 41704 0 8.3987E-6
6-168351948-G-A p.Arg1298Gln missense MLLT4 1 83392 1.19916E-5 41696 0 3.33472E-5
6-168351948-G-T p.Arg1298Leu missense MLLT4 1 83392 1.19916E-5 41696 0 3.18654E-5
6-168351950-A-G p.Lys1299Glu missense MLLT4 1 83402 1.19901E-5 41701 0 NA
6-168351966-T-C p.Met1304Thr missense MLLT4 1 83414 1.19884E-5 41707 0 1.65393E-5
6-168351978-A-T p.Gln1308Leu missense MLLT4 127 83406 0.00152267 41703 1 0.00337558
6-168351984-C-T p.Ser1310Phe missense MLLT4 1 83408 1.19893E-5 41704 0 NA
6-168352005-C-A p.Ser1317Tyr missense MLLT4 1 83428 1.19864E-5 41714 0 NA
6-168352021-G-A p.Leu1322Leu synonymous MLLT4 4 83426 4.79467E-5 41713 0 6.37714E-5
6-168352024-C-T p.Asn1323Asn synonymous MLLT4 3 83420 3.59626E-5 41710 0 NA
6-168352029-C-T p.Ser1325Phe missense MLLT4 1 83420 1.19875E-5 41710 0 3.97706E-6
6-168352039-G-A p.Ser1328Ser synonymous MLLT4 2 83388 2.39843E-5 41694 0 3.18857E-5
6-168352041-T-A p.Val1329Asp missense MLLT4 1 83380 1.19933E-5 41690 0 NA
6-168352051-T-C p.Ala1332Ala synonymous MLLT4 1 83362 1.19959E-5 41681 0 NA
6-168352062-C-T p.Thr1336Ile missense MLLT4 2 83312 2.40061E-5 41656 0 3.18634E-5
6-168352075-T-C p.Pro1340Pro synonymous MLLT4 11 83244 1.32142E-4 41622 0 6.37796E-5
6-168352079-C-G p.Arg1342Gly missense MLLT4 1 83206 1.20184E-5 41603 0 NA
6-168352080-G-A p.Arg1342His missense MLLT4 22 83204 2.6441E-4 41602 0 0.00125
6-168352098-C-T p.Ala1348Val missense MLLT4 1 83186 1.20213E-5 41593 0 3.18654E-5
6-168352104-C-T p.Pro1350Leu missense MLLT4 2 83142 2.40552E-5 41571 0 6.25E-4
6-168352105-G-A p.Pro1350Pro synonymous MLLT4 13661 82894 0.164801 41447 1145 0.176737
6-168352113-C-A p.Pro1353His missense MLLT4 2 83098 2.4068E-5 41549 0 4.00218E-6
6-168352134-T-C p.Ile1360Thr missense MLLT4 1 83120 1.20308E-5 41560 0 3.98928E-6
6-168352137-G-A p.Arg1361Gln missense MLLT4 3 83112 3.60959E-5 41556 0 5.04032E-4
6-168352138-A-G p.Arg1361Arg synonymous MLLT4 1 83112 1.2032E-5 41556 0 1.66406E-5
6-168352143-A-T p.Asp1363Val missense MLLT4 1 83024 1.20447E-5 41512 0 7.98231E-6
6-168352144-C-T p.Asp1363Asp synonymous MLLT4 2 83082 2.40726E-5 41541 0 0.00100705
6-168352146-TGCCTCCGCC-T p.Pro1365_Pro1367del disruptive_inframe_deletion MLLT4 1 83054 1.20404E-5 41527 0 8.32016E-6
6-168352150-TCCGCCACCC-T p.Pro1369_Pro1371del disruptive_inframe_deletion MLLT4 3 83006 3.6142E-5 41503 0 1.27551E-4
6-168352152-C-T p.Pro1366Leu missense MLLT4 23 83002 2.77102E-4 41501 0 7.32998E-4
6-168352153-G-A p.Pro1366Pro synonymous MLLT4 2 82976 2.41034E-5 41488 0 1.66633E-5
6-168352156-A-G p.Pro1367Pro synonymous MLLT4 2 82896 2.41266E-5 41448 0 3.19407E-5
6-168352161-C-T p.Pro1369Leu missense MLLT4 1 83022 1.2045E-5 41511 0 1.66431E-5
6-168352176-A-C p.His1374Pro missense MLLT4 3 83068 3.6115E-5 41534 0 5.03525E-4
6-168352183-C-T p.Ala1376Ala synonymous MLLT4 2 83070 2.40761E-5 41535 0 2.4895E-5
6-168352184-G-A p.Gly1377Ser missense MLLT4 1 83062 1.20392E-5 41531 0 2.39252E-5
6-168352192-C-T p.Phe1379Phe synonymous MLLT4 169 83092 0.00203389 41546 1 0.00353661
6-168352193-G-A p.Asp1380Asn missense MLLT4 138 83106 0.00166053 41553 1 0.00356824
6-168352195-T-G p.Asp1380Glu missense MLLT4 1 83120 1.20308E-5 41560 0 NA
6-168352205-A-G p.Met1384Val missense MLLT4 3 83100 3.61011E-5 41550 0 6.37714E-5
6-168352219-C-T p.Leu1388Leu synonymous MLLT4 1727 83116 0.0207782 41558 107 0.0470742
6-168352228-C-T p.Pro1391Pro synonymous MLLT4 1 83176 1.20227E-5 41588 0 NA
6-168352229-C-A p.Pro1392Thr missense MLLT4 15 83180 1.80332E-4 41590 0 1.32387E-4
6-168352230-C-G p.Pro1392Arg missense MLLT4 4 83198 4.80781E-5 41599 0 1.19564E-5
6-168352234-C-T p.Ser1393Ser synonymous MLLT4 6 83202 7.21137E-5 41601 0 2.39215E-4
6-168352234-C-A p.Ser1393Ser synonymous MLLT4 1 83202 1.20189E-5 41601 0 8.2776E-6
6-168352234-C-G p.Ser1393Ser synonymous MLLT4 1 83202 1.20189E-5 41601 0 8.2776E-6
6-168352235-G-A p.Ala1394Thr missense MLLT4 1 83192 1.20204E-5 41596 0 3.98791E-6
6-168352255-G-A p.Pro1400Pro synonymous MLLT4 7 83212 8.41225E-5 41606 0 2.22944E-4
6-168352257-C-T p.Ser1401Phe missense MLLT4 2 83218 2.40333E-5 41609 0 NA
6-168352261-G-A p.Ala1402Ala synonymous MLLT4 68 83198 8.17327E-4 41599 0 0.00152857
6-168352280-C-A p.Arg1409Arg synonymous MLLT4 47 83192 5.64958E-4 41596 0 0.00453172
6-168352280-C-G p.Arg1409Gly missense MLLT4 1 83192 1.20204E-5 41596 0 NA
6-168352290-GAGA-G p.Glu1414del conservative_inframe_deletion MLLT4 1 83236 1.2014E-5 41618 0 7.95684E-6
6-168352326-C-G p.Ala1424Gly missense MLLT4 2 83198 2.4039E-5 41599 0 8.26255E-6
6-168352328-C-T p.Arg1425Cys missense MLLT4 3 83198 3.60586E-5 41599 0 2.78705E-5
6-168352330-C-T p.Arg1425Arg synonymous MLLT4 82 83198 9.85601E-4 41599 0 0.00168844
6-168352335-A-T p.Glu1427Val missense MLLT4 1 83216 1.20169E-5 41608 0 NA
6-168352344-G-A p.Arg1430Gln missense MLLT4 4 83208 4.80723E-5 41604 0 3.982E-6
6-168352355-CGGAGAGAGCA-C p.Glu1436fs frameshift MLLT4 2 83154 2.40518E-5 41577 0 NA
6-168352355-C-T p.Arg1434Trp missense MLLT4 1 83154 1.20259E-5 41577 0 2.47938E-5
6-168352356-G-A p.Arg1434Gln missense MLLT4 2 83164 2.40489E-5 41582 0 1.65166E-5
6-168352357-G-C p.Arg1434Arg synonymous MLLT4 1 83158 1.20253E-5 41579 0 2.38939E-5
6-168352360-A-C p.Arg1435Ser missense MLLT4 1 83154 1.20259E-5 41577 0 NA
6-168352369-G-A p.Glu1438Glu synonymous MLLT4 1 83134 1.20288E-5 41567 0 NA
6-168352374-A-G p.Lys1440Arg missense MLLT4 3 83106 3.60985E-5 41553 0 4.12718E-5
6-168352379-G-A p.Gly1442Ser missense MLLT4 2 83068 2.40767E-5 41534 0 NA
6-168352380-G-A p.Gly1442Asp missense MLLT4 2 83042 2.40842E-5 41521 0 3.18593E-5
6-168352389-G-T p.Arg1445Leu missense MLLT4 1 83028 1.20441E-5 41514 0 NA
6-168352389-G-C p.Arg1445Pro missense MLLT4 1 83028 1.20441E-5 41514 0 1.64992E-5
6-168352392-C-G p.Thr1446Ser missense MLLT4 4 83034 4.8173E-5 41517 0 2.23143E-4
6-168352403-A-G p.Asn1450Asp missense MLLT4 2 83018 2.40912E-5 41509 0 6.37674E-5
6-168352414-G-A p.Pro1453Pro synonymous MLLT4 6 82982 7.23048E-5 41491 0 0.00100705
6-168352414-G-C p.Pro1453Pro synonymous MLLT4 4 82982 4.82032E-5 41491 0 NA
6-168352417-T-G p.Phe1454Leu missense MLLT4 4 83020 4.81812E-5 41510 0 3.9782E-6
6-168352422-C-A p.Pro1456His missense MLLT4 3 83026 3.61333E-5 41513 0 1.0741E-4
6-168352429-T-C p.Thr1458Thr synonymous MLLT4 1 83020 1.20453E-5 41510 0 NA
6-168352432-A-G p.Ala1459Ala synonymous MLLT4 1 83004 1.20476E-5 41502 0 1.9888E-5
6-168352434-A-G p.Gln1460Arg missense MLLT4 1 82994 1.20491E-5 41497 0 4.37532E-5
6-168352439-A-G p.Met1462Val missense MLLT4 3 82996 3.61463E-5 41498 0 9.94352E-5
6-168352445-C-A p.Pro1464Thr missense MLLT4 47 82928 5.66757E-4 41464 0 0.00156091
6-168352447-C-T p.Pro1464Pro synonymous MLLT4 22 82924 2.65303E-4 41462 0 0.00100559
6-168352449-A-G p.Glu1465Gly missense MLLT4 4 82928 4.82346E-5 41464 0 4.12126E-5
6-168352457-T-G p.Ser1468Ala missense MLLT4 1 82896 1.20633E-5 41448 0 NA
6-168352461-C-T p.Thr1469Ile missense MLLT4 1 82852 1.20697E-5 41426 0 NA
6-168352468-G-T p.Gln1471His missense MLLT4 1 82818 1.20747E-5 41409 0 NA
6-168352470-G-A p.Arg1472Gln missense MLLT4 1 82840 1.20715E-5 41420 0 3.29821E-5
6-168352470-G-C p.Arg1472Pro missense MLLT4 1 82840 1.20715E-5 41420 0 3.97776E-6
6-168352475-C-T p.Gln1474* stop_gained MLLT4 2 82814 2.41505E-5 41407 0 NA
6-168352476-A-G p.Gln1474Arg missense MLLT4 1 82808 1.20761E-5 41404 0 NA
6-168352479-A-C p.Glu1475Ala missense MLLT4 1 82802 1.2077E-5 41401 0 7.95494E-6
6-168352482-C-T p.Thr1476Ile missense MLLT4 1 82780 1.20802E-5 41390 0 NA
6-168352483-A-G p.Thr1476Thr synonymous MLLT4 1 82776 1.20808E-5 41388 0 NA
6-168352502-C-G p.Pro1483Ala missense MLLT4 12 82554 1.45359E-4 41277 0 1.27462E-4
6-168352518-G-A p.Arg1488His missense MLLT4 2 82440 2.42601E-5 41220 0 8.26078E-6
6-168352521-C-T p.Thr1489Met missense MLLT4 1 82452 1.21283E-5 41226 0 7.96001E-6
6-168352522-G-T p.Thr1489Thr synonymous MLLT4 7 82460 8.48896E-5 41230 0 3.18593E-5
6-168352522-G-A p.Thr1489Thr synonymous MLLT4 3 82458 3.63822E-5 41229 0 3.18593E-5
6-168352525-C-T p.Ile1490Ile synonymous MLLT4 1 82408 1.21347E-5 41204 0 3.18552E-5
6-168352525-C-G p.Ile1490Met missense MLLT4 2 82408 2.42695E-5 41204 0 3.18552E-5
6-168352526-G-A p.Glu1491Lys missense MLLT4 3 82370 3.6421E-5 41185 0 5.03525E-4
6-168352543-G-A p.Gln1496Gln synonymous MLLT4 1 82320 1.21477E-5 41160 0 6.37105E-5
6-168352547-A-C p.Ile1498Leu missense MLLT4 1 82332 1.21459E-5 41166 0 NA
6-168352547-A-G p.Ile1498Val missense MLLT4 1 82332 1.21459E-5 41166 0 NA
6-168352553-G-A p.Val1500Ile missense MLLT4 1 82276 1.21542E-5 41138 0 3.98549E-6
6-168352567-G-C p.Glu1504Asp missense MLLT4 7 82234 8.51229E-5 41117 0 4.15565E-5
6-168352576-G-A p.Ser1507Ser synonymous MLLT4 1 81844 1.22184E-5 40922 0 NA
6-168352586-C-G p.Leu1? start_lost MLLT4 10 81912 1.22082E-4 40956 0 1.91782E-4
6-168352588-G-T p.Leu1? start_lost MLLT4 1 81886 1.22121E-5 40943 0 8.33792E-6
6-168352591-C-T p.Ser1512Ser synonymous MLLT4 1 82102 1.218E-5 41051 0 NA
6-168352595-G-A p.Asp1514Asn missense MLLT4 1 82226 1.21616E-5 41113 0 NA
6-168352607-C-T p.Arg1518Trp missense MLLT4 1 82642 1.21004E-5 41321 0 3.18593E-5
6-168352612-C-T p.Asp1519Asp synonymous MLLT4 3 82714 3.62696E-5 41357 0 5.03525E-4
6-168352654-G-C p.Val1533Val synonymous MLLT4 2 83024 2.40894E-5 41512 0 1.6536E-5
6-168352674-TC-T p.Gln1541fs frameshift MLLT4 1 83022 1.2045E-5 41511 0 NA
6-168352676-C-G p.Gln1541Glu missense MLLT4 1 83026 1.20444E-5 41513 0 6.37105E-5
6-168352686-A-G p.Gln1544Arg missense MLLT4 5 83056 6.02003E-5 41528 0 6.6131E-5
6-168352694-C-G p.Pro1547Ala missense MLLT4 5 83070 6.01902E-5 41535 0 0.00125
6-168352695-C-T p.Pro1547Leu missense MLLT4 3 83054 3.61211E-5 41527 0 1.6539E-5
6-168352696-G-A p.Pro1547Pro synonymous MLLT4 4 83058 4.81591E-5 41529 0 3.58349E-5
6-168352705-C-T p.Ser1550Ser synonymous MLLT4 3 83050 3.61228E-5 41525 0 4.96065E-5
6-168352706-G-A p.Ala1551Thr missense MLLT4 3 83076 3.61115E-5 41538 0 3.18532E-5
6-168352717-C-T p.Ser1554Ser synonymous MLLT4 5 83102 6.0167E-5 41551 0 6.25E-4
6-168352727-C-T p.Arg1558Cys missense MLLT4 1 83000 1.20482E-5 41500 0 NA
6-168352738-G-A p.Met1561Ile missense MLLT4 2 83066 2.40772E-5 41533 0 4.38394E-5
6-168352754-C-G p.Gln1567Glu missense MLLT4 1 83028 1.20441E-5 41514 0 NA
6-168352768-G-T p.Gln1571His missense MLLT4 1 83174 1.2023E-5 41587 0 NA
6-168352782-A-C p.Lys1576Thr missense MLLT4 1 83274 1.20085E-5 41637 0 NA
6-168352783-GGACGAAGAT-G p.Asp1579_Glu1581del disruptive_inframe_deletion MLLT4 1 83268 1.20094E-5 41634 0 NA
6-168352786-C-T p.Asp1577Asp synonymous MLLT4 1 83262 1.20103E-5 41631 0 3.97953E-6
6-168352787-G-C p.Glu1578Gln missense MLLT4 2 83284 2.40142E-5 41642 0 NA
6-168352795-CGAG-C p.Glu1584del disruptive_inframe_deletion MLLT4 7 83280 8.40538E-5 41640 0 6.37471E-5
6-168352795-C-T p.Asp1580Asp synonymous MLLT4 1 83284 1.20071E-5 41642 0 1.59245E-5
6-168352795-C-CGAG p.Glu1584dup disruptive_inframe_insertion MLLT4 7 83284 8.40498E-5 41642 0 9.56206E-5
6-168352807-G-C p.Glu1584Asp missense MLLT4 6 83306 7.20236E-5 41653 0 2.47145E-5
6-168352810-C-T p.Asp1585Asp synonymous MLLT4 31 83308 3.72113E-4 41654 0 7.65013E-4
6-168352811-G-A p.Asp1586Asn missense MLLT4 7 83304 8.40296E-5 41652 0 9.55696E-5
6-168352814-G-A p.Asp1587Asn missense MLLT4 6 83310 7.20202E-5 41655 0 3.18492E-5
6-168352819-G-A p.Val1588Val synonymous MLLT4 2 83296 2.40108E-5 41648 0 NA
6-168352826-A-G p.Met1591Val missense MLLT4 2 83270 2.40183E-5 41635 0 3.18573E-5
6-168352831-G-C p.Leu1592Leu synonymous MLLT4 16 83236 1.92225E-4 41618 0 1.40038E-4
6-168352832-A-T p.Ile1593Phe missense MLLT4 5 83228 6.00759E-5 41614 0 9.55962E-5
6-168352842-G-A p.Arg1596His missense MLLT4 10 83066 1.20386E-4 41533 0 9.55597E-5
6-168352862-G-T p.Ala1603Ser missense MLLT4 5 82852 6.03486E-5 41426 0 1.2738E-4
6-168352864-G-T p.Ala1603Ala synonymous MLLT4 1 82828 1.20732E-5 41414 0 8.24076E-6
6-168352869-T-TA c.4812+5dupA splice_region MLLT4 2 82774 2.41622E-5 41387 0 4.00224E-6
6-168352873-G-C c.4812+6G>C splice_region MLLT4 8 82704 9.67305E-5 41352 0 1.08093E-4
6-168352874-G-C c.4812+7G>C splice_region MLLT4 3 82666 3.62906E-5 41333 0 0.00125
6-168352874-G-T c.4812+7G>T splice_region MLLT4 10 82666 1.20969E-4 41333 1 7.20611E-5
6-168352875-G-T c.4812+8G>T splice_region MLLT4 1 82638 1.2101E-5 41319 0 NA
6-168355147-A-G p.Met1608Val missense MLLT4 7 82488 8.48608E-5 41244 0 1.69165E-5
6-168355181-C-T c.4848+8C>T splice_region MLLT4 1 82486 1.21233E-5 41243 0 3.40443E-5
6-168363109-T-C c.4849-4T>C splice_region MLLT4 3 82436 3.63919E-5 41218 0 4.15883E-5
6-168363113-T-C p.Leu1617Leu splice_region+synonymous MLLT4 30 82460 3.63813E-4 41230 0 2.32935E-4
6-168363114-T-TGCA p.Gln1618dup conservative_inframe_insertion MLLT4 2 82460 2.42542E-5 41230 0 1.20486E-5
6-168363122-G-A p.Glu1620Lys missense MLLT4 1 82572 1.21106E-5 41286 0 6.36983E-5
6-168363129-G-A p.Arg1622Gln missense MLLT4 26 82642 3.1461E-4 41321 0 0.00137004
6-168363134-C-T p.Arg1624Trp missense MLLT4 2 82640 2.42014E-5 41320 0 1.82554E-4
6-168363135-G-GGCA p.Gln1627dup conservative_inframe_insertion MLLT4 5 82668 6.04829E-5 41334 0 3.21125E-5
6-168363135-G-A p.Arg1624Gln missense MLLT4 1 82668 1.20966E-5 41334 0 9.5584E-5
6-168363143-C-G p.Gln1627Glu missense MLLT4 1 82690 1.20934E-5 41345 0 3.18695E-5
6-168363147-T-C p.Leu1628Ser missense MLLT4 1 82710 1.20904E-5 41355 0 NA
6-168363153-A-AGATGCG p.Arg1632_Lys1633insMetArg disruptive_inframe_insertion MLLT4 1 82744 1.20855E-5 41372 0 NA
6-168363155-A-T p.Met1631Leu missense MLLT4 1 82754 1.2084E-5 41377 0 6.25E-4
6-168363156-T-C p.Met1631Thr missense MLLT4 2 82748 2.41698E-5 41374 0 8.28816E-6
6-168363158-C-T p.Arg1632Cys missense MLLT4 1 82768 1.2082E-5 41384 0 NA
6-168363159-G-A p.Arg1632His missense MLLT4 2 82768 2.41639E-5 41384 0 NA
6-168363164-C-T p.Arg1634Trp missense MLLT4 1 82768 1.2082E-5 41384 0 1.65747E-5
6-168363165-G-A p.Arg1634Gln missense MLLT4 1 82802 1.2077E-5 41401 0 4.01213E-6
6-168363172-G-A p.Ala1636Ala synonymous MLLT4 1203 82774 0.0145335 41387 13 0.0196375
6-168363172-GGAA-G p.Glu1637del disruptive_inframe_deletion MLLT4 1 82804 1.20767E-5 41402 0 NA
6-168363180-G-T p.Arg1639Leu missense MLLT4 4 82806 4.83057E-5 41403 0 3.18471E-5
6-168363183-C-T p.Ala1640Val missense MLLT4 2 82794 2.41563E-5 41397 0 0.00100705
6-168363192-A-C p.Glu1643Ala missense MLLT4 1 82824 1.20738E-5 41412 0 NA
6-168363193-G-A p.Glu1643Glu synonymous MLLT4 1 82828 1.20732E-5 41414 0 8.28542E-6
6-168363203-C-A p.Arg1647Arg synonymous MLLT4 3 82844 3.62126E-5 41422 0 3.18471E-5
6-168363206-C-A p.Arg1648Arg synonymous MLLT4 1 82838 1.20718E-5 41419 0 6.37308E-5
6-168363208-G-T p.Arg1648Arg synonymous MLLT4 1 82852 1.20697E-5 41426 0 8.285E-6
6-168363211-G-C p.Gln1649His missense MLLT4 2 82852 2.41394E-5 41426 0 1.65695E-5
6-168363222-G-A p.Arg1653Gln missense MLLT4 1 82846 1.20706E-5 41423 0 8.28459E-6
6-168363223-A-G p.Arg1653Arg synonymous MLLT4 6 82844 7.24253E-5 41422 0 6.37146E-5
6-168363235-C-T p.Asp1657Asp synonymous MLLT4 2 82858 2.41377E-5 41429 0 3.31351E-5
6-168363247-G-GAGGCGACAGGAAGAAGGGTATTACAGCCGCCTGGAAGCCGAGAGGCGCAGACAGCAC c.4968_4968+1insAGGCGACAGGAAGAAGGGTATTACAGCCGCCTGGAAGCCGAGAGGCGCAGACAGCAC splice_donor MLLT4 1 82864 1.2068E-5 41432 0 NA
6-168363256-C-T p.Val1664Val synonymous MLLT4 2 82840 2.41429E-5 41420 0 8.28542E-6
6-168363337-TTTCTTAAGAA-T c.*76_*85delTTCTTAAGAA splice_region MLLT4 1 82102 1.218E-5 41051 0 3.18552E-5
6-168366429-G-A c.4969-8G>A splice_region MLLT4 1 76106 1.31396E-5 38053 0 NA
6-168366431-C-T c.4969-6C>T splice_region MLLT4 1 76176 1.31275E-5 38088 0 NA
6-168366433-G-T c.4969-4G>T splice_region MLLT4 2 76222 2.62391E-5 38111 0 6.38986E-6
6-168366439-G-T p.Arg1657Ser missense+splice_region MLLT4 2 76424 2.61698E-5 38212 0 4.17537E-5
6-168366454-G-T p.Gly1662Gly synonymous MLLT4 2 76982 2.59801E-5 38491 0 NA
6-168366456-A-G p.Tyr1663Cys missense MLLT4 3 77056 3.89327E-5 38528 0 5.73059E-6
6-168366467-C-T p.Leu1667Leu synonymous MLLT4 1 77244 1.2946E-5 38622 0 NA
6-168366474-C-T p.Ala1669Val missense MLLT4 1 77390 1.29216E-5 38695 0 4.37484E-5
6-168366475-C-T p.Ala1669Ala synonymous MLLT4 4 77428 5.16609E-5 38714 0 3.02899E-4
6-168366482-C-T p.Arg1672Cys missense MLLT4 24 77518 3.09606E-4 38759 0 0.0011586
6-168366496-C-A p.Asp1676Glu missense MLLT4 8 77606 1.03085E-4 38803 0 1.91205E-4
6-168366496-C-T p.Asp1676Asp synonymous MLLT4 4 77606 5.15424E-5 38803 0 2.45399E-5
6-168366497-G-A p.Glu1677Lys missense MLLT4 3 77626 3.86468E-5 38813 0 5.22302E-5
6-168366504-C-T p.Ala1679Val missense MLLT4 2 77506 2.58045E-5 38753 0 1.13999E-4
6-168366505-G-A p.Ala1679Ala synonymous MLLT4 1 77474 1.29076E-5 38737 0 0.00104712
6-168366507-G-T p.Arg1680Leu missense MLLT4 2 77474 2.58151E-5 38737 0 NA
6-168366507-G-A p.Arg1680His missense MLLT4 1 77474 1.29076E-5 38737 0 0.00125
6-168366519-A-AGCCCGAGGC c.4985_4993dupAGGCGCCCG splice_donor MLLT4 2 77392 2.58425E-5 38696 0 NA
6-168366520-G-A p.Glu1684Glu synonymous MLLT4 2 77364 2.58518E-5 38682 0 NA
6-168366524-G-A p.Glu1686Lys missense MLLT4 1 77306 1.29356E-5 38653 0 3.18735E-5
6-168366528-C-T p.Ala1687Val missense MLLT4 2 77140 2.59269E-5 38570 0 NA
6-168366529-G-C p.Ala1687Ala synonymous MLLT4 369 77042 0.0047896 38521 1 0.00858369
6-168366531-C-G p.Pro1664Arg missense+splice_region MLLT4 1 77122 1.29665E-5 38561 0 9.64453E-5
6-168366533-G-A p.Gly1665Arg missense+splice_region MLLT4 4 77108 5.18753E-5 38554 0 8.26241E-5
6-168366542-C-T p.Arg1692Cys missense MLLT4 1 76876 1.3008E-5 38438 0 3.18695E-5
6-168366543-G-A p.Arg1692His missense MLLT4 1 76758 1.3028E-5 38379 0 7.6321E-5
6-168366546-C-T p.Pro1693Leu missense MLLT4 1 76892 1.30053E-5 38446 0 NA
6-168366549-C-T p.Pro1694Leu missense MLLT4 2 76792 2.60444E-5 38396 0 3.18573E-5
6-168366549-C-G p.Pro1694Arg missense MLLT4 2 76792 2.60444E-5 38396 0 NA
6-168366557-C-T p.Arg1697Trp missense MLLT4 46 76594 6.00569E-4 38297 0 8.92516E-4
6-168366558-GGGACTACGA-G p.Asp1698_Glu1700del conservative_inframe_deletion MLLT4 1 76548 1.30637E-5 38274 0 6.97778E-6
6-168366558-G-A p.Arg1697Gln missense MLLT4 2 76548 2.61274E-5 38274 0 1.39556E-5
6-168366565-C-T p.Tyr1699Tyr synonymous MLLT4 1 76308 1.31048E-5 38154 0 1.39897E-5
6-168366566-G-C p.Glu1700Gln missense MLLT4 5 76204 6.56134E-5 38102 0 6.99047E-6
6-168366572-C-T p.Pro1702Ser missense MLLT4 1 76132 1.31351E-5 38066 0 NA
6-168366573-C-T p.Pro1702Leu missense MLLT4 1 76078 1.31444E-5 38039 0 3.18918E-5
6-168366578-C-T p.Pro1704Ser missense MLLT4 3 75966 3.94914E-5 37983 0 6.37755E-5
6-168366579-C-T p.Pro1704Leu missense MLLT4 2 75966 2.63276E-5 37983 0 6.37918E-5
6-168366580-G-A p.Pro1704Pro synonymous MLLT4 829 75448 0.0109877 37724 9 0.0134979
6-168366582-C-T p.Ser1705Phe missense MLLT4 11 75908 1.44912E-4 37954 0 8.1473E-5
6-168366582-C-G p.Ser1705Cys missense MLLT4 1 75910 1.31735E-5 37955 0 NA
6-168366583-C-T p.Ser1705Ser synonymous MLLT4 1 75952 1.31662E-5 37976 0 NA
6-168366586-C-T p.Pro1706Pro synonymous MLLT4 1 75926 1.31707E-5 37963 0 2.4264E-4
6-168366592-C-T p.Pro1708Pro synonymous MLLT4 1 75756 1.32003E-5 37878 0 3.4615E-5
6-168366595-C-T p.Gly1709Gly synonymous MLLT4 1 75474 1.32496E-5 37737 0 6.91047E-6
6-168366602-C-G p.Pro1712Ala missense MLLT4 1 76114 1.31382E-5 38057 0 NA
6-168366606-C-T p.Pro1713Leu missense MLLT4 3 76412 3.92608E-5 38206 0 NA
6-168366622-C-T p.Asn1718Asn synonymous MLLT4 26 76870 3.38233E-4 38435 0 2.23714E-4
6-168366629-T-G p.Tyr1721Asp missense MLLT4 1 77280 1.294E-5 38640 0 NA
6-168366651-C-T p.Ser1728Phe missense MLLT4 3 77888 3.85168E-5 38944 0 6.22278E-5
6-168366652-C-T p.Ser1728Ser synonymous MLLT4 1 77912 1.2835E-5 38956 0 NA
6-168366656-G-A p.Asp1730Asn missense MLLT4 52 77924 6.67317E-4 38962 0 0.00104346
6-168366656-G-T p.Asp1730Tyr missense MLLT4 1 77926 1.28327E-5 38963 0 NA
6-168366660-C-T p.Ser1731Leu missense MLLT4 2 78018 2.56351E-5 39009 0 NA
6-168366664-G-T p.Leu1732Leu synonymous MLLT4 2 78100 2.56082E-5 39050 0 3.32903E-5
6-168366667-C-G p.Phe1733Leu missense MLLT4 1 78106 1.28031E-5 39053 0 NA
6-168366667-C-A p.Phe1733Leu missense MLLT4 1 78106 1.28031E-5 39053 0 NA
6-168366670-T-A p.Thr1734Thr synonymous MLLT4 2 78132 2.55977E-5 39066 0 3.33209E-5
6-168366677-T-C p.Phe1737Leu missense MLLT4 1 78118 1.28011E-5 39059 0 NA
6-168366680-G-T p.Val1738Phe missense MLLT4 2 78126 2.55997E-5 39063 0 3.03951E-4
6-168366690-A-G p.Asn1741Ser missense MLLT4 6 78064 7.686E-5 39032 0 0.0025
6-168366691-TGAG-T p.Glu1747del disruptive_inframe_deletion MLLT4 45 74900 6.00801E-4 37450 0 0.00591418
6-168366691-T-TGAG p.Glu1747dup disruptive_inframe_insertion MLLT4 16 78062 2.04965E-4 39031 0 2.51667E-4
6-168366691-T-TGAGGAG p.Glu1746_Glu1747dup disruptive_inframe_insertion MLLT4 2 78062 2.56207E-5 39031 0 NA
6-168366691-TGAGGAG-T p.Glu1746_Glu1747del disruptive_inframe_deletion MLLT4 1 78062 1.28103E-5 39031 0 7.23715E-6
6-168366695-G-A p.Glu1743Lys missense MLLT4 1 78018 1.28176E-5 39009 0 NA
6-168366722-G-A p.Ala1752Thr missense MLLT4 2 77476 2.58144E-5 38738 0 NA
6-168366723-C-T p.Ala1752Val missense+splice_region MLLT4 1 77450 1.29116E-5 38725 0 3.18492E-5
6-168366737-T-A p.Tyr41Asn missense MLLT4 1 77134 1.29645E-5 38567 0 7.06534E-6
6-168366739-C-T p.Tyr41Tyr synonymous MLLT4 3 77088 3.89166E-5 38544 0 7.08085E-6
6-168366744-G-C p.Ser43Thr missense MLLT4 1 77030 1.2982E-5 38515 0 NA
6-168366747-C-G p.Thr44Arg missense MLLT4 2 76974 2.59828E-5 38487 0 1.91144E-4
6-168366755-T-G p.Ser47Ala missense MLLT4 1 76918 1.30009E-5 38459 0 NA
6-168366756-C-T p.Ser47Phe missense MLLT4 1 76910 1.30022E-5 38455 0 7.0922E-5
6-168366768-TT-AC p.Leu51His missense MLLT4 294 76760 0.00383012 38380 1 NA
6-168366768-T-A p.Leu51His missense MLLT4 41 76760 5.34132E-4 38380 4 0.00711006
6-168366769-T-C p.Leu51Leu synonymous MLLT4 41 76748 5.34216E-4 38374 4 0.00711823
6-168366791-C-T p.Arg59Trp missense MLLT4 3 76642 3.9143E-5 38321 0 1.47702E-5
6-168366792-G-A p.Arg59Gln missense MLLT4 56 76622 7.30861E-4 38311 0 0.0118235
6-168366801-C-T p.Pro62Leu missense MLLT4 1 76636 1.30487E-5 38318 0 1.47743E-5
6-168366804-G-C p.Cys63Ser missense MLLT4 7 76632 9.13457E-5 38316 0 1.59668E-4
6-168366812-C-T p.Arg66Cys missense MLLT4 1 76638 1.30484E-5 38319 0 2.22005E-5
6-168366813-G-A p.Arg66His missense MLLT4 44 76630 5.74188E-4 38315 1 0.00117992
6-168366816-C-T p.Pro67Leu missense MLLT4 1 76648 1.30467E-5 38324 0 7.40171E-6
6-168366817-G-A p.Pro67Pro synonymous MLLT4 1 76642 1.30477E-5 38321 0 NA
6-168366820-C-A p.Ala68Ala synonymous MLLT4 1 76646 1.3047E-5 38323 0 7.40598E-6
6-168366823-C-T p.Ser69Ser synonymous MLLT4 2 76648 2.60933E-5 38324 0 4.44405E-5
6-168366834-T-C p.Phe73Ser missense MLLT4 2 76656 2.60906E-5 38328 0 NA
6-168366837-T-C p.Leu74Pro missense MLLT4 1 76662 1.30443E-5 38331 0 2.96463E-5
6-168366840-C-T p.Ser75Phe missense MLLT4 1 76654 1.30456E-5 38327 0 3.18756E-5
6-168366843-A-G p.Asn76Ser missense MLLT4 1 76652 1.3046E-5 38326 0 8.04376E-5
6-168366847-A-G p.Ser77Ser synonymous MLLT4 2 76654 2.60913E-5 38327 0 NA
6-168366867-A-G p.Lys84Arg missense MLLT4 6 76640 7.82881E-5 38320 0 9.64106E-5
6-168366869-G-A p.Ala85Thr missense MLLT4 2 76640 2.6096E-5 38320 0 NA
6-168366875-A-G p.Ser87Gly missense MLLT4 5 76654 6.52282E-5 38327 0 NA
6-168366879-C-T p.Thr88Ile missense MLLT4 1 76652 1.3046E-5 38326 0 3.18715E-5
6-168366886-C-CA p.Gly93fs frameshift MLLT4 1 76642 1.30477E-5 38321 0 NA
6-168366888-A-G p.Lys91Arg missense MLLT4 1 76646 1.3047E-5 38323 0 9.5645E-5
6-168366900-C-G p.Pro95Arg missense MLLT4 28 76632 3.65383E-4 38316 0 0.004375
6-168366900-C-T p.Pro95Leu missense MLLT4 1 76634 1.3049E-5 38317 0 6.37267E-5
6-168366905-C-A p.Pro97Thr missense MLLT4 1 76618 1.30518E-5 38309 0 6.37796E-5
6-168366912-C-CA p.Ser102fs frameshift MLLT4 139 76634 0.00181382 38317 0 0.00223385
6-168366921-C-G p.Ser102Cys missense MLLT4 8 76634 1.04392E-4 38317 0 0.00100536
6-168366922-C-T p.Ser102Ser synonymous MLLT4 2 76632 2.60988E-5 38316 0 NA
6-168366948-A-G p.Lys111Arg missense+splice_region MLLT4 1 76608 1.30535E-5 38304 0 NA
6-168366960-AAAGAGTGACAAATC-A c.133+5_133+18delAAGAGTGACAAATC splice_region MLLT4 1 76584 1.30576E-5 38292 0 4.66788E-5
6-168366960-A-G c.133+4A>G splice_region MLLT4 4 76584 5.22302E-5 38292 0 6.37308E-5
6-168369697-A-G n.215A>G splice_region MLLT4 1 77964 1.28264E-5 38982 0 NA
6-168369796-C-CCAAACT p.Ser1756_Tyr1757insAsnSer disruptive_inframe_insertion MLLT4 1 82532 1.21165E-5 41266 0 2.86697E-4
6-168369800-A-T p.Asn1755Ile missense MLLT4 1 82542 1.2115E-5 41271 0 4.01175E-6
6-168369843-C-T p.Asp1769Asp synonymous MLLT4 18 82594 2.17934E-4 41297 0 2.2293E-4
6-168369844-G-T p.Ala1770Ser missense MLLT4 2 82586 2.42172E-5 41293 0 3.18431E-5
6-168369850-C-T p.Arg1772Trp missense MLLT4 2 82574 2.42207E-5 41287 0 1.27405E-4
6-168369851-G-A p.Arg1772Gln missense MLLT4 1 82580 1.21095E-5 41290 0 8.28912E-6
6-168369860-A-G p.Lys1775Arg missense MLLT4 4 82576 4.84402E-5 41288 0 2.32149E-4
6-168369866-A-T p.Lys1777Met missense MLLT4 1 82566 1.21115E-5 41283 0 NA
6-168369868-C-T p.Arg1778Cys missense MLLT4 1 82556 1.2113E-5 41278 0 1.65887E-5
6-168369869-G-A p.Arg1778His missense MLLT4 1 82550 1.21139E-5 41275 0 4.14766E-5
6-168369869-G-T p.Arg1778Leu missense MLLT4 1 82550 1.21139E-5 41275 0 8.29531E-6
6-168369878-G-GCCAA