Variant

Variant ID Consequence Effect Gene AC AN AF NS NHOM maxEAF
10-116054585-C-G c.*1216G>C splice_region AFAP1L2 4661 67256 0.0693024 33628 95 0.0886371
10-116054585-C-CAAAT n.3700_3703dupATTT splice_region AFAP1L2 21 67824 3.09625E-4 33912 0 5.66478E-4
10-116055801-C-T p.Ter819Ter stop_retained AFAP1L2 27 82644 3.26702E-4 41322 1 3.50296E-4
10-116055801-C-G p.Ter819Tyrext*? stop_lost AFAP1L2 2 82644 2.42002E-5 41322 0 NA
10-116055808-G-C p.Ala817Gly missense AFAP1L2 1 82642 1.21004E-5 41321 0 4.11821E-5
10-116055835-A-T c.2431-8T>A splice_region AFAP1L2 1 82494 1.21221E-5 41247 0 NA
10-116056740-G-A p.Ala809Ala synonymous AFAP1L2 3 83350 3.59928E-5 41675 0 6.37146E-5
10-116056749-G-A p.Leu806Leu synonymous AFAP1L2 3 83354 3.59911E-5 41677 0 6.37024E-5
10-116056752-T-C p.Val805Val synonymous AFAP1L2 2 83356 2.39935E-5 41678 0 NA
10-116056764-G-T p.Gly801Gly synonymous AFAP1L2 1 83374 1.19941E-5 41687 0 NA
10-116056775-C-T p.Val798Met missense AFAP1L2 4 83364 4.79823E-5 41682 0 1.91095E-4
10-116056779-C-T p.Ser796Ser synonymous AFAP1L2 1695 83312 0.0203452 41656 96 0.041587
10-116056780-G-A p.Ser796Leu missense AFAP1L2 1 83350 1.19976E-5 41675 0 5.03525E-4
10-116056787-G-T p.Pro794Thr missense AFAP1L2 2 83352 2.39946E-5 41676 0 NA
10-116056822-G-A p.Thr782Ile missense AFAP1L2 1 83310 1.20034E-5 41655 0 1.98842E-5
10-116056826-A-G p.Cys781Arg missense AFAP1L2 2 83294 2.40113E-5 41647 0 NA
10-116056829-C-A p.Asp780Tyr missense AFAP1L2 3 83272 3.60265E-5 41636 0 3.18593E-5
10-116056833-G-A p.Ala778Ala synonymous AFAP1L2 3 83252 3.60352E-5 41626 0 3.2962E-5
10-116056835-C-G p.Ala778Pro missense AFAP1L2 24 83238 2.8833E-4 41619 0 1.15366E-4
10-116056835-C-T p.Ala778Thr missense AFAP1L2 1 83240 1.20135E-5 41620 0 NA
10-116056857-G-A p.Pro770Pro splice_region+synonymous AFAP1L2 1 83066 1.20386E-5 41533 0 NA
10-116056859-GCTGTGGTTATAGGAGGAGAGCAAGGGCTGAGTCAAGGGGAGGGAGATGTGACCCACCCACCCCAACCCATGTCCAGGGAGCCCTGCAAGCAGCCCAGAGGCCGCAGTTCCAGCACTCAC-G c.2307+1_2308-1del splice_acceptor AFAP1L2 2 83040 2.40848E-5 41520 1 NA
10-116056859-G-GGCGGGGGCTCACATTCT c.2308-1_2308insAGAATGTGAGCCCCCGC splice_acceptor AFAP1L2 2 83042 2.40842E-5 41521 1 NA
10-116056866-T-A c.2308-7A>T splice_region AFAP1L2 1 82964 1.20534E-5 41482 0 NA
10-116056976-C-G c.2307+3G>C splice_region AFAP1L2 1 82352 1.2143E-5 41176 0 8.45752E-6
10-116056978-C-T c.2307+1G>A splice_donor AFAP1L2 5 82330 6.07312E-5 41165 0 1.2751E-4
10-116056979-G-A p.Arg769Arg splice_region+synonymous AFAP1L2 4 82306 4.85991E-5 41153 0 9.61323E-5
10-116056980-C-T p.Arg769His missense+splice_region AFAP1L2 6 82334 7.28739E-5 41167 0 2.53156E-4
10-116056981-G-A p.Arg769Cys missense+splice_region AFAP1L2 822 82294 0.00998858 41147 5 0.0115493
10-116056985-G-T p.Ser767Arg missense AFAP1L2 123 82370 0.00149326 41185 0 0.00376012
10-116056991-A-G p.Asn765Asn splice_region+synonymous AFAP1L2 1052 82424 0.0127633 41212 46 0.0288068
10-116056994-C-T p.Glu764Glu synonymous AFAP1L2 1 82470 1.21256E-5 41235 0 1.6769E-5
10-116057000-G-A p.His762His synonymous AFAP1L2 339 82470 0.00411059 41235 2 0.00436988
10-116057002-G-T p.His762Asn missense AFAP1L2 7 82474 8.48752E-5 41237 0 9.5645E-5
10-116057006-GG-TC p.Thr760Arg missense AFAP1L2 1 82482 1.21239E-5 41241 0 NA
10-116057014-C-A p.Val758Leu missense AFAP1L2 4 82522 4.84719E-5 41261 0 3.18878E-5
10-116057015-G-A p.Thr757Thr synonymous AFAP1L2 33 82522 3.99893E-4 41261 0 5.73833E-4
10-116057019-G-A p.Thr756Ile missense AFAP1L2 1 82500 1.21212E-5 41250 0 1.19595E-5
10-116057027-C-T p.Thr753Thr synonymous AFAP1L2 234 82600 0.00283293 41300 1 0.00596073
10-116057028-G-A p.Thr753Met missense AFAP1L2 7 82588 8.47581E-5 41294 0 6.25E-4
10-116057042-C-T p.Glu748Glu synonymous AFAP1L2 7 82618 8.47273E-5 41309 0 1.19516E-5
10-116057047-CCTT-C p.Lys746del conservative_inframe_deletion AFAP1L2 1 82590 1.2108E-5 41295 0 NA
10-116057049-T-C p.Lys746Arg missense AFAP1L2 1 82612 1.21048E-5 41306 0 1.27453E-4
10-116057058-T-C p.Asn743Ser missense AFAP1L2 1 82550 1.21139E-5 41275 0 NA
10-116057078-G-T p.Ser736Arg missense AFAP1L2 1 82530 1.21168E-5 41265 0 3.98514E-6
10-116057079-C-T p.Ser736Asn missense AFAP1L2 1 82546 1.21145E-5 41273 0 3.98505E-6
10-116057095-C-T p.Val731Met missense AFAP1L2 2 82538 2.42313E-5 41269 0 1.67023E-5
10-116057096-G-A p.Arg730Arg synonymous AFAP1L2 41 82532 4.96777E-4 41266 0 0.00101917
10-116057097-C-T p.Arg730His missense AFAP1L2 6 82546 7.26867E-5 41273 0 5.97938E-5
10-116057098-G-C p.Arg730Gly missense AFAP1L2 2 82536 2.42319E-5 41268 0 NA
10-116057098-G-A p.Arg730Cys missense AFAP1L2 3 82536 3.63478E-5 41268 0 1.50416E-4
10-116057110-C-T p.Glu726Lys missense AFAP1L2 27 82612 3.26829E-4 41306 0 5.86648E-4
10-116057111-G-A p.Gly725Gly synonymous AFAP1L2 3 82542 3.63451E-5 41271 0 1.91107E-4
10-116057111-G-C p.Gly725Gly synonymous AFAP1L2 1 82542 1.2115E-5 41271 0 NA
10-116057112-C-T p.Gly725Asp missense AFAP1L2 303 82578 0.00366926 41289 0 0.00348888
10-116057115-C-T p.Arg724Gln missense AFAP1L2 4 82620 4.84144E-5 41310 0 3.19124E-5
10-116057116-G-A p.Arg724Trp missense AFAP1L2 1 82596 1.21071E-5 41298 0 5.88473E-5
10-116057124-T-C p.Glu721Gly missense AFAP1L2 1 82670 1.20963E-5 41335 0 3.98816E-6
10-116057125-C-T p.Glu721Lys missense AFAP1L2 8 82658 9.67843E-5 41329 0 5.03525E-4
10-116057126-G-A p.Asp720Asp synonymous AFAP1L2 7 82646 8.46986E-5 41323 0 3.18512E-5
10-116057130-A-G p.Ile719Thr missense AFAP1L2 2 82676 2.41908E-5 41338 0 8.45151E-6
10-116057144-C-T p.Gln714Gln synonymous AFAP1L2 2 82710 2.41809E-5 41355 0 2.57834E-5
10-116057156-C-T p.Ala710Ala synonymous AFAP1L2 7 82602 8.47437E-5 41301 0 1.91083E-4
10-116057157-G-A p.Ala710Val missense AFAP1L2 4 82538 4.84625E-5 41269 0 7.04523E-5
10-116057164-C-T p.Val708Ile missense AFAP1L2 2 82548 2.42283E-5 41274 0 3.18512E-5
10-116057171-G-C p.Asp705Glu missense+splice_region AFAP1L2 1 82464 1.21265E-5 41232 0 9.27334E-6
10-116057180-G-A c.2114-8C>T splice_region AFAP1L2 1 82294 1.21516E-5 41147 0 NA
10-116059011-C-T c.2113+8G>A splice_region AFAP1L2 1 83310 1.20034E-5 41655 0 3.97839E-6
10-116059015-T-C c.2113+4A>G splice_region AFAP1L2 2 83326 2.40021E-5 41663 0 NA
10-116059023-G-A p.Cys703Cys synonymous AFAP1L2 1 83348 1.19979E-5 41674 0 NA
10-116059031-G-C p.Leu701Val missense AFAP1L2 161 83366 0.00193124 41683 0 0.00143285
10-116059034-G-T p.Leu700Ile missense AFAP1L2 1 83366 1.19953E-5 41683 0 NA
10-116059036-G-T p.Thr699Asn missense AFAP1L2 1 83368 1.1995E-5 41684 0 NA
10-116059046-G-C p.Leu696Val missense AFAP1L2 1 83366 1.19953E-5 41683 0 NA
10-116059047-C-T p.Glu695Glu synonymous AFAP1L2 2 83366 2.39906E-5 41683 0 4.11909E-5
10-116059051-C-T p.Arg694Gln missense AFAP1L2 2 83366 2.39906E-5 41683 0 1.6475E-5
10-116059079-G-A p.His685Tyr missense AFAP1L2 1 83356 1.19967E-5 41678 0 1.98813E-4
10-116059084-C-T p.Arg683Gln missense AFAP1L2 1 83352 1.19973E-5 41676 0 2.47109E-5
10-116059085-G-A p.Arg683Trp missense AFAP1L2 1 83356 1.19967E-5 41678 0 1.98813E-5
10-116059086-G-T p.Ile682Ile synonymous AFAP1L2 11 83352 1.3197E-4 41676 0 6.25782E-4
10-116059095-C-T p.Lys679Lys synonymous AFAP1L2 1093 83326 0.0131172 41663 9 0.0221394
10-116059116-C-T p.Lys672Lys synonymous AFAP1L2 2 83356 2.39935E-5 41678 0 3.18471E-5
10-116059118-TCTC-T p.Glu671del conservative_inframe_deletion AFAP1L2 3 83348 3.59937E-5 41674 0 3.18532E-5
10-116059122-C-T p.Glu670Glu synonymous AFAP1L2 1 83348 1.19979E-5 41674 0 NA
10-116059126-G-A p.Thr669Ile missense AFAP1L2 1 83344 1.19985E-5 41672 0 NA
10-116059132-C-T p.Arg667Gln missense AFAP1L2 2 83340 2.39981E-5 41670 0 4.11868E-5
10-116059133-G-A p.Arg667Trp missense AFAP1L2 1 83346 1.19982E-5 41673 0 6.37105E-5
10-116059141-T-C p.Glu664Gly missense AFAP1L2 1 83344 1.19985E-5 41672 0 3.29527E-5
10-116059154-G-A p.Arg660Trp missense AFAP1L2 4 83332 4.80008E-5 41666 0 8.23981E-6
10-116059172-T-A p.Ile654Phe missense+splice_region AFAP1L2 1 83286 1.20068E-5 41643 0 3.9775E-6
10-116059178-C-T c.1958-4G>A splice_region AFAP1L2 1 83262 1.20103E-5 41631 0 3.97947E-6
10-116059946-C-CA c.1957+6_1957+7insT splice_region AFAP1L2 2 83162 2.40494E-5 41581 0 NA
10-116059952-C-G c.1957+1G>C splice_donor AFAP1L2 2 83208 2.40361E-5 41604 0 NA
10-116059957-A-T p.Ser651Arg missense AFAP1L2 2 83228 2.40304E-5 41614 0 NA
10-116059966-G-A p.Arg648Arg synonymous AFAP1L2 10 83256 1.20111E-4 41628 0 1.27364E-4
10-116059967-C-T p.Arg648His missense AFAP1L2 32 83260 3.84338E-4 41630 0 2.42632E-4
10-116059968-G-A p.Arg648Cys missense AFAP1L2 2 83254 2.40229E-5 41627 0 1.19326E-5
10-116059982-ACAGGTGGGCTGGCAC-A p.Gly638_Pro642del disruptive_inframe_deletion AFAP1L2 1 83260 1.20106E-5 41630 0 3.9769E-6
10-116059985-G-A p.Pro642Leu missense AFAP1L2 2 83260 2.40211E-5 41630 0 8.239E-6
10-116060003-G-A p.Pro636Leu missense AFAP1L2 4 83246 4.80504E-5 41623 0 3.29554E-5
10-116060005-G-C p.Thr635Thr synonymous AFAP1L2 368 83246 0.00442063 41623 0 0.00453172
10-116060017-G-A p.Ala631Ala synonymous AFAP1L2 11 83274 1.32094E-4 41637 0 1.23272E-4
10-116060023-C-T p.Pro629Pro synonymous AFAP1L2 4 83282 4.80296E-5 41641 0 6.25E-4
10-116060024-G-A p.Pro629Leu missense AFAP1L2 1 83292 1.2006E-5 41646 0 2.47166E-5
10-116060032-C-T p.Pro626Pro synonymous AFAP1L2 2 83294 2.40113E-5 41647 0 1.98828E-5
10-116060033-G-A p.Pro626Leu missense AFAP1L2 4 83296 4.80215E-5 41648 0 5.03525E-4
10-116060050-C-G p.Gln620His missense AFAP1L2 2 83318 2.40044E-5 41659 0 3.9764E-6
10-116060057-T-G p.Glu618Ala missense AFAP1L2 1 83322 1.20016E-5 41661 0 NA
10-116060059-C-T p.Thr617Thr synonymous AFAP1L2 2 83328 2.40015E-5 41664 0 7.95305E-6
10-116060060-G-A p.Thr617Met missense AFAP1L2 18 83318 2.1604E-4 41659 0 6.25E-4
10-116060061-T-C p.Thr617Ala missense AFAP1L2 1 83322 1.20016E-5 41661 0 NA
10-116060071-G-A p.Val613Val synonymous AFAP1L2 1 83326 1.20011E-5 41663 0 1.64764E-5
10-116060073-C-T p.Val613Ile missense AFAP1L2 3 83320 3.60058E-5 41660 0 0.00151057
10-116060074-G-A p.Thr612Thr synonymous AFAP1L2 1 83318 1.20022E-5 41659 0 1.64769E-5
10-116060078-G-T p.Thr611Asn missense AFAP1L2 1 83322 1.20016E-5 41661 0 7.95336E-6
10-116060090-G-A p.Ser607Phe missense AFAP1L2 1 83324 1.20013E-5 41662 0 NA
10-116060095-A-T p.Asp605Glu missense AFAP1L2 1 83318 1.20022E-5 41659 0 8.239E-6
10-116060106-C-T p.Glu602Lys missense AFAP1L2 1 83304 1.20042E-5 41652 0 3.18573E-5
10-116060115-C-T p.Glu599Lys missense AFAP1L2 2 83294 2.40113E-5 41647 0 9.55657E-5
10-116060119-C-T p.Gln597Gln splice_region+synonymous AFAP1L2 2 83276 2.40165E-5 41638 0 1.64796E-5
10-116060199-T-C c.1788+5A>G splice_region AFAP1L2 1066 83172 0.0128168 41586 48 0.0292572
10-116060209-C-T p.Glu595Lys missense AFAP1L2 1 83206 1.20184E-5 41603 0 2.47117E-5
10-116060248-G-A p.Pro582Ser missense AFAP1L2 1 83146 1.2027E-5 41573 0 3.97709E-5
10-116060254-G-C p.Pro580Ala missense AFAP1L2 1 83122 1.20305E-5 41561 0 NA
10-116060264-T-C p.Ser576Ser synonymous AFAP1L2 1 83146 1.2027E-5 41573 0 NA
10-116060266-A-G p.Ser576Pro missense AFAP1L2 1063 83118 0.012789 41559 47 0.0290872
10-116060274-G-A p.Pro573Leu missense AFAP1L2 2 83168 2.40477E-5 41584 0 6.37349E-5
10-116060274-G-T p.Pro573Gln missense AFAP1L2 1 83168 1.20239E-5 41584 0 8.2394E-6
10-116060280-G-A p.Ala571Val missense AFAP1L2 1 83168 1.20239E-5 41584 0 NA
10-116060284-C-T p.Glu570Lys missense AFAP1L2 18 83182 2.16393E-4 41591 0 5.09879E-4
10-116060309-C-T p.Thr561Thr synonymous AFAP1L2 7 83190 8.41447E-5 41595 0 5.76815E-5
10-116060310-G-A p.Thr561Met missense AFAP1L2 4 83190 4.80827E-5 41595 0 4.11997E-5
10-116060312-C-T p.Pro560Pro synonymous AFAP1L2 2 83184 2.40431E-5 41592 0 2.47215E-5
10-116060313-G-A p.Pro560Leu missense AFAP1L2 3 83184 3.60646E-5 41592 0 9.55962E-5
10-116060314-G-A p.Pro560Ser missense AFAP1L2 2 83200 2.40385E-5 41600 0 6.25E-4
10-116060317-A-T p.Ser559Thr missense AFAP1L2 255 83160 0.00306638 41580 3 0.00634607
10-116060327-G-C p.Ala555Ala synonymous AFAP1L2 69 83178 8.29546E-4 41589 0 0.00149825
10-116060331-T-C p.Gln554Arg missense AFAP1L2 1 83184 1.20215E-5 41592 0 NA
10-116060337-C-T p.Ser552Asn missense AFAP1L2 4 83184 4.80862E-5 41592 0 9.56267E-5
10-116060337-C-G p.Ser552Thr missense AFAP1L2 1 83184 1.20215E-5 41592 0 NA
10-116060341-T-C p.Ser551Gly missense AFAP1L2 1 83188 1.2021E-5 41594 0 3.98254E-6
10-116060342-G-C p.Pro550Pro synonymous AFAP1L2 4 83186 4.8085E-5 41593 0 3.18674E-5
10-116060365-C-T p.Val543Ile missense AFAP1L2 8 83206 9.61469E-5 41603 0 3.50363E-4
10-116060387-T-C p.Arg535Arg synonymous AFAP1L2 59198 78648 0.752696 39324 22904 0.789375
10-116060387-T-G p.Arg535Arg synonymous AFAP1L2 1 83236 1.2014E-5 41618 0 NA
10-116060388-C-T p.Arg535Gln missense AFAP1L2 6 83232 7.20877E-5 41616 0 1.03944E-4
10-116060389-G-A p.Arg535* stop_gained AFAP1L2 1 83230 1.20149E-5 41615 0 3.99965E-6
10-116060390-G-A p.Asp534Asp synonymous AFAP1L2 1 83236 1.2014E-5 41618 0 NA
10-116060396-TTC-T p.Glu532fs frameshift AFAP1L2 1 83230 1.20149E-5 41615 0 NA
10-116060402-C-T p.Glu530Glu synonymous AFAP1L2 134 83250 0.00160961 41625 1 0.00232677
10-116060403-T-C p.Glu530Gly missense AFAP1L2 3 83246 3.60378E-5 41623 0 8.05652E-6
10-116060415-T-C p.Asp526Gly missense AFAP1L2 2 83236 2.40281E-5 41618 0 NA
10-116060427-G-C p.Thr522Ser missense AFAP1L2 3207 83146 0.0385707 41573 72 0.073125
10-116060432-T-G p.Glu520Asp missense AFAP1L2 1 83194 1.20201E-5 41597 0 4.22101E-6
10-116060438-G-A p.Thr518Thr synonymous AFAP1L2 7 83180 8.41548E-5 41590 0 6.25E-4
10-116060438-G-C p.Thr518Thr synonymous AFAP1L2 1 83180 1.20221E-5 41590 0 NA
10-116060455-G-GGA c.1543-7_1543-6insTC splice_region AFAP1L2 3 83138 3.60846E-5 41569 0 1.79134E-5
10-116061107-C-G c.1542+6G>C splice_region AFAP1L2 1 81800 1.22249E-5 40900 0 NA
10-116061113-C-T p.Ala514Ala splice_region+synonymous AFAP1L2 2 82082 2.43659E-5 41041 0 3.18552E-5
10-116061114-G-A p.Ala514Val missense+splice_region AFAP1L2 20 82064 2.43712E-4 41032 0 3.50341E-4
10-116061125-C-T p.Glu510Glu synonymous AFAP1L2 3 82456 3.6383E-5 41228 0 1.1934E-5
10-116061131-C-T p.Leu508Leu synonymous AFAP1L2 3 82544 3.63443E-5 41272 0 NA
10-116061135-T-C p.Asp507Gly missense AFAP1L2 1 82614 1.21045E-5 41307 0 3.18532E-5
10-116061143-G-A p.Asp504Asp synonymous AFAP1L2 4 82754 4.8336E-5 41377 0 3.57907E-5
10-116061150-A-G p.Leu502Pro missense AFAP1L2 1 82836 1.2072E-5 41418 0 8.24266E-6
10-116061162-C-T p.Arg498His missense AFAP1L2 5 82894 6.0318E-5 41447 0 3.18451E-5
10-116061163-G-A p.Arg498Cys missense AFAP1L2 7 82894 8.44452E-5 41447 1 5.96478E-5
10-116061179-G-A p.Gly492Gly synonymous AFAP1L2 1 82840 1.20715E-5 41420 0 3.18512E-5
10-116061183-T-A p.Asp491Val missense AFAP1L2 1 82802 1.2077E-5 41401 0 3.18471E-5
10-116061185-G-A p.Ile490Ile synonymous AFAP1L2 5 82802 6.0385E-5 41401 0 9.55536E-5
10-116061197-G-A p.Pro486Pro synonymous AFAP1L2 1 82774 1.20811E-5 41387 0 NA
10-116061208-A-G p.Phe483Leu missense AFAP1L2 2 82586 2.42172E-5 41293 0 1.23286E-4
10-116061209-C-A p.Lys482Asn missense AFAP1L2 30 82578 3.63293E-4 41289 0 0.00100705
10-116061232-C-A c.1431-8G>T splice_region AFAP1L2 2 81938 2.44087E-5 40969 0 8.2791E-6
10-116062098-AAG-A p.Leu477fs frameshift AFAP1L2 2 83202 2.40379E-5 41601 0 NA
10-116062102-G-T p.Leu476Ile missense AFAP1L2 5 83228 6.00759E-5 41614 0 6.37471E-5
10-116062103-A-G p.Ser475Ser synonymous AFAP1L2 2 83230 2.40298E-5 41615 0 9.062E-5
10-116062115-C-T p.Ala471Ala synonymous AFAP1L2 9 83240 1.08121E-4 41620 1 3.29511E-5
10-116062116-G-A p.Ala471Val missense AFAP1L2 2 83246 2.40252E-5 41623 0 6.25E-4
10-116062116-G-T p.Ala471Glu missense AFAP1L2 1 83246 1.20126E-5 41623 0 1.19333E-5
10-116062133-G-T p.Val465Val synonymous AFAP1L2 1 83296 1.20054E-5 41648 0 NA
10-116062141-C-T p.Asp463Asn missense AFAP1L2 1 83302 1.20045E-5 41651 0 1.98825E-5
10-116062142-G-A p.Ala462Ala synonymous AFAP1L2 32 83296 3.84172E-4 41648 0 5.03525E-4
10-116062154-G-A p.Asp458Asp synonymous AFAP1L2 22 83296 2.64118E-4 41648 0 0.0025
10-116062156-C-A p.Asp458Tyr missense AFAP1L2 2 83288 2.40131E-5 41644 0 3.97659E-6
10-116062157-G-A p.Tyr457Tyr synonymous AFAP1L2 20 83282 2.40148E-4 41641 0 0.00151057
10-116062172-T-C p.Pro452Pro synonymous AFAP1L2 1 83286 1.20068E-5 41643 0 3.2956E-5
10-116062173-G-A p.Pro452Leu missense AFAP1L2 6 83288 7.20392E-5 41644 1 2.34609E-4
10-116062178-T-G p.Thr450Thr synonymous AFAP1L2 2 83278 2.40159E-5 41639 0 9.56023E-5
10-116062180-T-TC p.Thr450fs frameshift AFAP1L2 1 83266 1.20097E-5 41633 0 NA
10-116062216-A-G p.Trp438Arg missense AFAP1L2 1 83192 1.20204E-5 41596 0 8.24498E-6
10-116062217-G-A p.His437His synonymous AFAP1L2 1 83186 1.20213E-5 41593 0 7.95482E-6
10-116062225-T-C p.Met435Val missense AFAP1L2 1 83148 1.20267E-5 41574 0 3.18959E-5
10-116062229-C-T p.Glu433Glu synonymous AFAP1L2 1 83118 1.20311E-5 41559 0 NA
10-116062231-C-T p.Glu433Lys missense AFAP1L2 3 83086 3.61072E-5 41543 0 3.30082E-5
10-116062232-G-A p.Ser432Ser synonymous AFAP1L2 9 83068 1.08345E-4 41534 0 7.16292E-5
10-116062250-C-T c.1285-7G>A splice_region AFAP1L2 15 82810 1.81138E-4 41405 0 1.43443E-4
10-116062251-G-C c.1285-8C>G splice_region AFAP1L2 1 82762 1.20828E-5 41381 0 1.99367E-5
10-116064470-G-A c.1284+8C>T splice_region AFAP1L2 4 78328 5.10673E-5 39164 0 1.12435E-5
10-116064472-C-T c.1284+6G>A splice_region AFAP1L2 5 78450 6.37349E-5 39225 0 1.64701E-4
10-116064472-CG-C c.1284+5delC splice_region AFAP1L2 1 78450 1.2747E-5 39225 0 1.09801E-5
10-116064478-C-T p.Glu428Glu splice_region+synonymous AFAP1L2 1 79232 1.26212E-5 39616 0 NA
10-116064498-C-T p.Glu422Lys missense AFAP1L2 2 79894 2.50332E-5 39947 0 4.0707E-6
10-116064503-T-C p.Lys420Arg missense AFAP1L2 2 80036 2.49888E-5 40018 0 1.62051E-5
10-116064506-TGGA-T p.Leu418del disruptive_inframe_deletion AFAP1L2 1 80212 1.2467E-5 40106 0 NA
10-116064511-G-A p.Ile417Ile synonymous AFAP1L2 1 80466 1.24276E-5 40233 0 1.71925E-5
10-116064518-AAGG-A p.Ser414del disruptive_inframe_deletion AFAP1L2 1 80608 1.24057E-5 40304 0 8.51615E-6
10-116064521-G-A p.Ser414Phe missense AFAP1L2 1 80802 1.23759E-5 40401 0 NA
10-116064527-A-C p.Leu412Arg missense AFAP1L2 1 80960 1.23518E-5 40480 0 NA
10-116064528-G-A p.Leu412Phe missense AFAP1L2 4763 80810 0.0589407 40405 445 0.106454
10-116064535-G-A p.Pro409Pro synonymous AFAP1L2 6 81202 7.38898E-5 40601 0 5.04244E-5
10-116064542-G-C p.Pro407Arg missense AFAP1L2 2 81546 2.4526E-5 40773 0 4.39669E-5
10-116064542-G-A p.Pro407Leu missense AFAP1L2 2 81546 2.4526E-5 40773 0 NA
10-116064554-A-G p.Val403Ala missense AFAP1L2 3 81796 3.66766E-5 40898 0 3.99272E-6
10-116064556-C-A p.Glu402Asp missense AFAP1L2 42 81900 5.1282E-4 40950 0 5.04032E-4
10-116064559-G-A p.Cys401Cys synonymous AFAP1L2 34 81934 4.14968E-4 40967 0 6.25E-4
10-116064567-C-T p.Val399Met missense AFAP1L2 2 82118 2.43552E-5 41059 0 2.49825E-5
10-116064578-G-A p.Pro395Leu missense AFAP1L2 1 82360 1.21418E-5 41180 0 NA
10-116064579-G-C p.Pro395Ala missense AFAP1L2 2 82368 2.42813E-5 41184 0 3.98562E-6
10-116064584-T-C p.Gln393Arg missense AFAP1L2 1 82416 1.21336E-5 41208 0 2.49339E-5
10-116064592-C-T p.Lys390Lys synonymous AFAP1L2 20 82496 2.42436E-4 41248 0 3.18512E-4
10-116064620-T-C p.His381Arg missense AFAP1L2 14 82476 1.69746E-4 41238 0 3.15295E-4
10-116064623-A-G p.Leu380Pro missense AFAP1L2 1 82488 1.2123E-5 41244 0 8.29752E-6
10-116064624-G-C p.Leu380Val missense AFAP1L2 2 82486 2.42465E-5 41243 0 2.4893E-5
10-116064632-T-A p.Asp377Val missense AFAP1L2 1 82378 1.21392E-5 41189 0 NA
10-116064633-C-T p.Asp377Asn missense AFAP1L2 1 82350 1.21433E-5 41175 0 5.03525E-4
10-116064637-G-C p.Val375Val synonymous AFAP1L2 2 82300 2.43013E-5 41150 0 6.7708E-5
10-116064641-G-C p.Ser374Cys missense AFAP1L2 1 82210 1.2164E-5 41105 0 NA
10-116064643-G-A p.Cys373Cys synonymous AFAP1L2 1 82176 1.2169E-5 41088 0 NA
10-116064646-C-T p.Trp372* stop_gained AFAP1L2 1 82102 1.218E-5 41051 0 3.98448E-6
10-116064679-G-T p.Asn361Lys missense AFAP1L2 1 80536 1.24168E-5 40268 0 NA
10-116064679-G-A p.Asn361Asn synonymous AFAP1L2 1 80538 1.24165E-5 40269 0 1.5975E-5
10-116067570-T-C p.Thr356Ala missense AFAP1L2 2 83042 2.40842E-5 41521 0 NA
10-116067573-CGAG-C p.Leu354del conservative_inframe_deletion AFAP1L2 3 83052 3.61219E-5 41526 0 8.25682E-6
10-116067573-C-T p.Glu355Lys missense AFAP1L2 18 83052 2.16732E-4 41526 0 0.00100908
10-116067586-C-T p.Val350Val synonymous AFAP1L2 1 83146 1.2027E-5 41573 0 NA
10-116067589-A-G p.Pro349Pro synonymous AFAP1L2 1 83166 1.20241E-5 41583 0 NA
10-116067602-G-A p.Thr345Ile missense AFAP1L2 1 83206 1.20184E-5 41603 0 NA
10-116067617-C-T p.Gly340Asp missense AFAP1L2 1 83214 1.20172E-5 41607 0 8.23968E-6
10-116067626-A-T p.Met337Lys missense AFAP1L2 2 83224 2.40315E-5 41612 0 NA
10-116067637-C-T p.Leu333Leu synonymous AFAP1L2 1 83214 1.20172E-5 41607 0 NA
10-116067668-A-G p.Val323Ala missense+splice_region AFAP1L2 2 83082 2.40726E-5 41541 0 2.47827E-5
10-116068185-A-T c.967+7T>A splice_region AFAP1L2 2 83020 2.40906E-5 41510 0 3.97747E-6
10-116068185-A-C c.967+7T>G splice_region AFAP1L2 2 83020 2.40906E-5 41510 0 8.24253E-6
10-116068193-G-A p.Asp322Asp splice_region+synonymous AFAP1L2 30 83116 3.60941E-4 41558 0 0.00125
10-116068201-T-C p.Thr320Ala missense AFAP1L2 4 83144 4.81093E-5 41572 0 4.94503E-5
10-116068228-C-T p.Val311Met missense AFAP1L2 33 83224 3.9652E-4 41612 0 0.00100705
10-116068235-C-A p.Gly308Gly synonymous AFAP1L2 2 83258 2.40217E-5 41629 0 NA
10-116068235-C-T p.Gly308Gly synonymous AFAP1L2 1 83258 1.20109E-5 41629 0 3.97643E-6
10-116068237-C-T p.Gly308Arg missense AFAP1L2 1 83254 1.20114E-5 41627 0 NA
10-116068249-C-T p.Ala304Thr missense AFAP1L2 5 83248 6.00615E-5 41624 0 2.47325E-5
10-116068250-C-T p.Ser303Ser synonymous AFAP1L2 1 83250 1.2012E-5 41625 0 1.19304E-5
10-116068251-G-A p.Ser303Leu missense AFAP1L2 2 83256 2.40223E-5 41628 0 3.29794E-5
10-116068273-C-T p.Asp296Asn missense AFAP1L2 11 83192 1.32224E-4 41596 0 5.96673E-5
10-116068280-T-C c.883-4A>G splice_region AFAP1L2 2 83140 2.40558E-5 41570 0 8.25682E-6
10-116068282-G-T c.883-6C>A splice_region AFAP1L2 1 83136 1.20285E-5 41568 0 1.65248E-5
10-116070129-C-T p.Arg289His missense AFAP1L2 13 83254 1.56149E-4 41627 0 3.98422E-5
10-116070140-C-T p.Pro285Pro synonymous AFAP1L2 8 83268 9.60753E-5 41634 0 0.00100705
10-116070141-G-A p.Pro285Leu missense AFAP1L2 101 83284 0.00121272 41642 0 0.00302115
10-116070144-G-T p.Thr284Asn missense AFAP1L2 1 83268 1.20094E-5 41634 0 NA
10-116070157-C-T p.Gly280Arg missense AFAP1L2 1 83272 1.20088E-5 41636 0 NA
10-116070172-C-T p.Glu275Lys missense AFAP1L2 4 83218 4.80665E-5 41609 0 6.37227E-5
10-116070173-G-A p.Ser274Ser synonymous AFAP1L2 26 83212 3.12455E-4 41606 0 0.00302115
10-116070184-C-G p.Gly271Arg missense AFAP1L2 5 83136 6.01424E-5 41568 0 1.65555E-5
10-116070184-C-T p.Gly271Ser missense AFAP1L2 3 83138 3.60846E-5 41569 0 1.19485E-5
10-116070185-G-A p.Ser270Ser synonymous AFAP1L2 3 83134 3.60863E-5 41567 0 6.37745E-5
10-116070186-C-T p.Ser270Asn missense AFAP1L2 1 83136 1.20285E-5 41568 0 NA
10-116070197-G-C p.Ile266Met missense AFAP1L2 1 83066 1.20386E-5 41533 0 NA
10-116073622-G-A c.792+8C>T splice_region AFAP1L2 4 82532 4.8466E-5 41266 0 6.25E-4
10-116073646-G-A p.Ala259Val missense AFAP1L2 2 83034 2.40865E-5 41517 0 NA
10-116073677-T-C p.Ile249Val missense AFAP1L2 1 83244 1.20129E-5 41622 0 2.78445E-5
10-116073684-G-A p.Ala246Ala synonymous AFAP1L2 56 83258 6.72608E-4 41629 0 0.00175349
10-116073691-A-G p.Met244Thr missense AFAP1L2 4 83258 4.80434E-5 41629 0 3.18776E-5
10-116073693-C-T p.Pro243Pro synonymous AFAP1L2 1 83252 1.20117E-5 41626 0 3.977E-6
10-116073694-G-A p.Pro243Leu missense AFAP1L2 1 83256 1.20111E-5 41628 0 4.12133E-5
10-116073696-C-T p.Thr242Thr synonymous AFAP1L2 57083 82868 0.688842 41434 21033 0.740975
10-116073696-C-G p.Thr242Thr synonymous AFAP1L2 1 83268 1.20094E-5 41634 0 1.64788E-5
10-116073697-G-A p.Thr242Met missense AFAP1L2 57 83272 6.84504E-4 41636 0 0.00152993
10-116073708-C-T p.Lys238Lys synonymous AFAP1L2 1 83308 1.20036E-5 41654 0 8.23737E-6
10-116073724-C-T p.Arg233Gln missense AFAP1L2 1 83318 1.20022E-5 41659 0 1.59058E-5
10-116073725-G-A p.Arg233Trp missense AFAP1L2 9 83308 1.08033E-4 41654 0 5.43693E-4
10-116073728-C-G p.Val232Leu missense AFAP1L2 1 83322 1.20016E-5 41661 0 NA
10-116073729-T-A p.Gln231His missense AFAP1L2 1 83316 1.20025E-5 41658 0 6.37349E-5
10-116073735-C-A p.Glu229Asp missense AFAP1L2 53 83340 6.35949E-4 41670 0 0.00151057
10-116073747-G-A p.Val225Val synonymous AFAP1L2 1 83352 1.19973E-5 41676 0 NA
10-116073749-C-T p.Val225Ile missense AFAP1L2 3 83350 3.59928E-5 41675 0 2.47162E-5
10-116073750-G-A p.Ser224Ser synonymous AFAP1L2 1 83346 1.19982E-5 41673 0 8.23873E-6
10-116073770-C-T p.Val218Met missense AFAP1L2 1 83328 1.20008E-5 41664 0 8.24701E-6
10-116073774-C-T p.Leu216Leu synonymous AFAP1L2 1 83330 1.20005E-5 41665 0 NA
10-116073795-G-A p.Ser209Ser synonymous AFAP1L2 1 83306 1.20039E-5 41653 0 1.27405E-4
10-116073797-A-G p.Ser209Pro missense AFAP1L2 1 83302 1.20045E-5 41651 0 NA
10-116073801-T-C p.Lys207Lys synonymous AFAP1L2 20724 82450 0.251352 41225 3280 0.326875
10-116073816-G-A c.613-7C>T splice_region AFAP1L2 1 83246 1.20126E-5 41623 0 4.00921E-6
10-116073817-G-A c.613-8C>T splice_region AFAP1L2 2 83232 2.40292E-5 41616 0 6.41941E-5
10-116075328-G-A p.Asn201Asn synonymous AFAP1L2 2 81464 2.45507E-5 40732 0 NA
10-116075349-C-A p.Gln194His missense AFAP1L2 1 81544 1.22633E-5 40772 0 NA
10-116075353-T-C p.Lys193Arg missense AFAP1L2 1 81594 1.22558E-5 40797 0 1.20325E-5
10-116075381-G-A p.Arg184Cys missense AFAP1L2 1 82290 1.21521E-5 41145 0 8.34362E-6
10-116075393-C-T p.Ala180Thr missense AFAP1L2 1 82460 1.21271E-5 41230 0 1.67471E-5
10-116075397-G-A p.Ile178Ile synonymous AFAP1L2 1 82528 1.21171E-5 41264 0 NA
10-116075401-C-T p.Arg177His missense AFAP1L2 1 82512 1.21194E-5 41256 0 1.68045E-5
10-116075402-G-A p.Arg177Cys missense AFAP1L2 6 82512 7.27167E-5 41256 0 6.36902E-5
10-116075405-C-T p.Ala176Thr missense AFAP1L2 14 82468 1.69763E-4 41234 0 2.86551E-4
10-116075406-G-A p.Asp175Asp synonymous AFAP1L2 2 82536 2.42319E-5 41268 0 3.1839E-5
10-116075410-C-T p.Arg174His missense AFAP1L2 1 82542 1.2115E-5 41271 0 1.68608E-5
10-116075417-G-C p.Leu172Val missense AFAP1L2 1 82536 1.21159E-5 41268 0 3.1841E-5
10-116075421-G-A p.Ile170Ile synonymous AFAP1L2 6 82502 7.27255E-5 41251 0 2.5382E-4
10-116075427-G-A p.Ala168Ala synonymous AFAP1L2 4 82460 4.85084E-5 41230 0 6.36862E-5
10-116075433-C-T p.Pro166Pro synonymous AFAP1L2 2 82400 2.42718E-5 41200 0 4.0E-5
10-116075434-G-A p.Pro166Leu missense AFAP1L2 1 82378 1.21392E-5 41189 0 3.1839E-5
10-116075436-C-A p.Ser165Ser synonymous AFAP1L2 2 82332 2.42919E-5 41166 0 8.52704E-6
10-116075441-GC-AA p.TrpPro163CysSer missense AFAP1L2 2 82330 2.42925E-5 41165 0 NA
10-116075456-C-T p.Ala159Thr missense AFAP1L2 11 82166 1.33875E-4 41083 0 1.37943E-4
10-116075458-G-A p.Ser158Leu missense AFAP1L2 2 82158 2.43433E-5 41079 0 8.63513E-6
10-116075474-C-T p.Gly153Ser missense AFAP1L2 9 81940 1.09836E-4 40970 0 6.25E-4
10-116075477-C-T p.Asp152Asn missense AFAP1L2 6 81902 7.32583E-5 40951 0 2.86533E-4
10-116075484-A-G p.Asp149Asp synonymous AFAP1L2 2 81736 2.4469E-5 40868 0 NA
10-116075486-C-T p.Asp149Asn missense AFAP1L2 1 81696 1.22405E-5 40848 0 4.03297E-6
10-116075487-G-A p.Tyr148Tyr synonymous AFAP1L2 1 81648 1.22477E-5 40824 0 2.7958E-5
10-116075496-G-A p.Tyr145Tyr synonymous AFAP1L2 8 81364 9.83236E-5 40682 0 0.00151668
10-116075508-C-T p.Val141Val synonymous AFAP1L2 1 81020 1.23426E-5 40510 0 NA
10-116075519-C-T p.Gly138Arg missense AFAP1L2 53 80642 6.57226E-4 40321 0 0.00175193
10-116075520-G-A p.Asp137Asp synonymous AFAP1L2 15 80524 1.8628E-4 40262 0 0.00203046
10-116082934-G-A p.Leu134Leu synonymous AFAP1L2 2 82160 2.43427E-5 41080 0 5.05561E-4
10-116082945-C-T p.Asp131Asn missense AFAP1L2 1 82258 1.21569E-5 41129 0 NA
10-116082948-A-G p.Tyr130His missense AFAP1L2 4 82272 4.86192E-5 41136 0 4.44998E-5
10-116082972-C-G p.Gly122Arg missense AFAP1L2 1 82348 1.21436E-5 41174 0 1.95542E-5
10-116082981-A-G p.Ser119Pro missense AFAP1L2 1 82308 1.21495E-5 41154 0 NA
10-116082985-C-T p.Thr117Thr synonymous AFAP1L2 22 82312 2.67276E-4 41156 0 4.54563E-4
10-116082986-G-A p.Thr117Met missense AFAP1L2 1 82318 1.2148E-5 41159 0 6.36699E-5
10-116082990-T-C p.Lys116Glu missense AFAP1L2 1 82330 1.21462E-5 41165 0 1.31258E-5
10-116082993-G-T p.Pro115Thr missense AFAP1L2 1 82306 1.21498E-5 41153 0 1.32333E-5
10-116083002-G-A p.Leu112Phe missense AFAP1L2 2 82290 2.43043E-5 41145 0 8.31393E-5
10-116083006-T-C p.Lys110Lys synonymous AFAP1L2 3 82264 3.6468E-5 41132 0 3.18431E-5
10-116083011-G-A p.Arg109Trp missense AFAP1L2 113 82206 0.0013746 41103 2 0.00362965
10-116083011-G-C p.Arg109Gly missense AFAP1L2 2 82212 2.43273E-5 41106 0 1.38692E-5
10-116083013-T-C p.Glu108Gly missense AFAP1L2 2 82208 2.43285E-5 41104 0 4.36872E-5
10-116083018-A-C p.Ile106Met missense+splice_region AFAP1L2 4 82174 4.86772E-5 41087 0 2.23594E-5
10-116085633-C-T c.474+8G>A splice_region AFAP1L2 2 34630 5.77534E-5 17315 0 NA
10-116085638-C-A c.474+3G>T splice_region AFAP1L2 599 34640 0.0172921 17320 6 0.0157629
10-116085638-C-T c.474+3G>A splice_region AFAP1L2 1 34670 2.88434E-5 17335 0 1.5657E-5
10-116085639-G-A c.474+2C>T splice_donor AFAP1L2 2298 34512 0.0665855 17256 85 0.0577426
10-116085648-GCAGTAAGGTCTCCCCAGTGGGTCC-G p.Gly148_Thr155del disruptive_inframe_deletion AFAP1L2 1 34706 2.88135E-5 17353 0 NA
10-116085656-G-A p.Asp153Asp synonymous AFAP1L2 1 34720 2.88018E-5 17360 0 NA
10-116085657-T-G p.Asp153Ala missense AFAP1L2 648 34702 0.0186733 17351 10 0.0558901
10-116085663-C-G p.Trp151Ser missense AFAP1L2 7 34736 2.0152E-4 17368 0 6.27353E-4
10-116085692-C-A p.Gln141His missense AFAP1L2 1 34752 2.87753E-5 17376 0 NA
10-116085695-G-A p.Ser140Ser synonymous AFAP1L2 2 34752 5.75506E-5 17376 0 NA
10-116085707-G-A p.Ser136Ser synonymous AFAP1L2 1 34750 2.8777E-5 17375 0 NA
10-116085728-C-T p.Thr129Thr synonymous AFAP1L2 37 34748 0.00106481 17374 0 0.00293162
10-116085729-G-A p.Thr129Met missense AFAP1L2 1 34756 2.8772E-5 17378 0 4.64857E-4
10-116085734-C-T p.Thr127Thr synonymous AFAP1L2 3 34758 8.63111E-5 17379 0 1.55788E-5
10-116085735-G-A p.Thr127Met missense AFAP1L2 8 34752 2.30203E-4 17376 0 6.508E-4
10-116085740-G-A p.His125His synonymous AFAP1L2 1 34752 2.87753E-5 17376 0 NA
10-116085744-G-C p.Thr124Ser missense AFAP1L2 3027 34668 0.087314 17334 162 0.140149
10-116085750-T-G p.Asp122Ala missense AFAP1L2 2 34760 5.75374E-5 17380 0 NA
10-116085768-G-A p.Ala116Val missense AFAP1L2 4 34756 1.15088E-4 17378 0 0.00125313
10-116085770-A-C p.Gly115Gly synonymous AFAP1L2 1 34754 2.87737E-5 17377 0 NA
10-116085774-G-A p.Ser114Leu missense AFAP1L2 2 34748 5.75573E-5 17374 0 5.10427E-4
10-116085782-G-GCCC p.Gly111dup disruptive_inframe_insertion AFAP1L2 4287 34684 0.123602 17342 335 0.276011
10-116085784-C-CCCG p.Leu110_Gly111insArg conservative_inframe_insertion AFAP1L2 22865 34660 0.659694 17330 8027 0.686889
10-116085784-C-CCCA p.Leu110_Gly111insTrp conservative_inframe_insertion AFAP1L2 1 34748 2.87786E-5 17374 0 3.21461E-5
10-116085807-C-G c.316-8G>C splice_region AFAP1L2 1 34744 2.87819E-5 17372 0 1.56213E-5
10-116091555-T-C c.315+7A>G splice_region AFAP1L2 54538 70270 0.776121 35135 21695 0.79727
10-116091556-G-A c.315+6C>T splice_region AFAP1L2 1 72824 1.37317E-5 36412 0 1.84986E-5
10-116091572-G-A p.Pro102Leu missense AFAP1L2 1 74572 1.34099E-5 37286 0 7.87774E-5
10-116091575-G-A p.Pro101Leu missense AFAP1L2 2 74790 2.67415E-5 37395 0 7.90639E-5
10-116091582-C-G p.Asp99His missense AFAP1L2 1 75444 1.32549E-5 37722 0 NA
10-116091591-T-C p.Ser96Gly missense AFAP1L2 2 75622 2.64473E-5 37811 0 0.00221729
10-116091592-C-T p.Lys95Lys synonymous AFAP1L2 1 75688 1.32121E-5 37844 0 1.41435E-5
10-116091605-G-A p.Ser91Leu missense AFAP1L2 24 76040 3.15623E-4 38020 0 4.04727E-4
10-116091610-G-A p.His89His synonymous AFAP1L2 1 76120 1.31372E-5 38060 0 NA
10-116091621-G-A p.Pro86Ser missense AFAP1L2 3 75698 3.96312E-5 37849 0 0.00112867
10-116091629-T-C p.Asn83Ser missense AFAP1L2 658 75666 0.00869611 37833 3 0.0251889
10-116091632-G-A p.Pro82Leu missense AFAP1L2 1 75610 1.32258E-5 37805 0 NA
10-116091633-G-A p.Pro82Ser missense AFAP1L2 3 75594 3.96857E-5 37797 0 1.74398E-4
10-116091637-C-T p.Leu80Leu synonymous AFAP1L2 1 75016 1.33305E-5 37508 0 2.12657E-5
10-116091655-C-T p.Ala74Ala splice_region+synonymous AFAP1L2 10 73146 1.36713E-4 36573 0 6.37024E-5
10-116091660-C-T c.221-4G>A splice_region AFAP1L2 2 72502 2.75854E-5 36251 0 9.27529E-5
10-116091661-G-A c.221-5C>T splice_region AFAP1L2 1 72436 1.38053E-5 36218 0 9.63577E-5
10-116092973-C-T c.220+7G>A splice_region AFAP1L2 1 82790 1.20788E-5 41395 0 3.97728E-6
10-116092984-GC-CT p.Gly72Glu missense AFAP1L2 1 82932 1.20581E-5 41466 0 NA
10-116093005-T-C p.Gln65Gln synonymous AFAP1L2 17 83046 2.04706E-4 41523 0 6.25E-4
10-116093012-T-C p.Asn63Ser missense AFAP1L2 1 83046 1.20415E-5 41523 0 1.19296E-5
10-116093022-C-T p.Val60Met missense AFAP1L2 2 83010 2.40935E-5 41505 0 8.2371E-6
10-116093032-A-G p.Tyr56Tyr synonymous AFAP1L2 1 82976 1.20517E-5 41488 0 NA
10-116093034-A-T p.Tyr56Asn missense AFAP1L2 1 82978 1.20514E-5 41489 0 NA
10-116093040-ACTC-A p.Glu53del conservative_inframe_deletion AFAP1L2 1 82914 1.20607E-5 41457 0 NA
10-116093060-G-A c.146-6C>T splice_region AFAP1L2 1 82646 1.20998E-5 41323 0 4.94364E-5
10-116100359-C-T c.145+3G>A splice_region AFAP1L2 5 82878 6.03296E-5 41439 0 2.0824E-4
10-116100364-C-T p.Ser48Asn missense+splice_region AFAP1L2 1 82924 1.20592E-5 41462 0 NA
10-116100382-C-T p.Arg42Gln missense AFAP1L2 6 83074 7.22248E-5 41537 1 0.0020141
10-116100383-G-A p.Arg42Trp missense AFAP1L2 25 83106 3.00821E-4 41553 0 0.00125
10-116100389-G-A p.Leu40Phe missense AFAP1L2 1 83144 1.20273E-5 41572 0 NA
10-116100393-C-T p.Ala38Ala synonymous AFAP1L2 16 83144 1.92437E-4 41572 0 5.17273E-5
10-116100395-C-T p.Ala38Thr missense AFAP1L2 5 83160 6.01251E-5 41580 0 9.5511E-5
10-116100403-C-T p.Ser35Asn missense AFAP1L2 1 83208 1.20181E-5 41604 0 8.24117E-6
10-116100404-TC-AT p.LysSer34LysCys missense AFAP1L2 1 83224 1.20158E-5 41612 0 NA
10-116100408-C-T p.Lys33Lys synonymous AFAP1L2 1 83226 1.20155E-5 41613 0 NA
10-116100413-C-T p.Val32Met missense AFAP1L2 3 83236 3.60421E-5 41618 0 3.1841E-5
10-116100419-C-G p.Ala30Pro missense AFAP1L2 1 83254 1.20114E-5 41627 0 8.23927E-6
10-116100420-T-C p.Thr29Thr synonymous AFAP1L2 1 83256 1.20111E-5 41628 0 NA
10-116100422-T-A p.Thr29Ser missense AFAP1L2 1 83262 1.20103E-5 41631 0 3.18451E-5
10-116100448-A-G p.Ile20Thr missense AFAP1L2 1 83226 1.20155E-5 41613 0 NA
10-116100453-G-A p.Leu18Leu synonymous AFAP1L2 6 83218 7.20998E-5 41609 0 3.29598E-5
10-116100461-C-T p.Asp16Asn missense AFAP1L2 722 83186 0.00867935 41593 5 0.0149064
10-116100470-C-G p.Glu13Gln missense AFAP1L2 2 83170 2.40471E-5 41585 0 8.24579E-6
10-116100487-A-G p.Leu7Pro missense AFAP1L2 1 82998 1.20485E-5 41499 0 2.3897E-5
10-116100491-C-T c.17-1G>A splice_acceptor AFAP1L2 1 82962 1.20537E-5 41481 0 NA
10-116100495-G-A c.17-5C>T splice_region AFAP1L2 1 82968 1.20528E-5 41484 0 1.65289E-5
10-116100497-A-T c.17-7T>A splice_region AFAP1L2 1 82906 1.20619E-5 41453 0 8.26952E-6
10-116158603-T-C c.70+7A>G splice_region AFAP1L2 3 77152 3.88843E-5 38576 0 2.01353E-5
10-116158611-C-G p.Ala23Ala splice_region+synonymous AFAP1L2 10 77246 1.29457E-4 38623 0 1.34181E-5
10-116158612-G-A p.Ala23Val missense+splice_region AFAP1L2 13 77238 1.68311E-4 38619 0 6.25782E-4
10-116158643-CCAGACAGCAA-C p.Cys9fs frameshift AFAP1L2 1 77442 1.29129E-5 38721 0 NA
10-116158643-C-T p.Val13Met missense AFAP1L2 1 77442 1.29129E-5 38721 0 1.34086E-5
10-116158650-G-A p.Cys10Cys synonymous AFAP1L2 1 77456 1.29106E-5 38728 0 NA
10-116158655-A-T p.Cys9Ser missense AFAP1L2 1 77430 1.29149E-5 38715 0 3.18613E-5
10-116158659-C-T p.Gln7Gln synonymous AFAP1L2 1 77434 1.29142E-5 38717 0 NA
10-116158663-G-A p.Ala6Val missense+splice_region AFAP1L2 2 77394 2.58418E-5 38697 0 6.70547E-6
10-116164203-G-A p.Tyr4Tyr synonymous AFAP1L2 1 69214 1.44479E-5 34607 0 NA
10-116164340-G-A c.-126C>T 5_prime_UTR_premature_start_codon_gain AFAP1L2 2 38076 5.25265E-5 19038 0 NA
10-116164445-G-A c.-231C>T 5_prime_UTR_premature_start_codon_gain AFAP1L2 1 16938 5.90388E-5 8469 0 6.40574E-5
10-116164502-G-A c.-288C>T 5_prime_UTR_premature_start_codon_gain AFAP1L2 2810 9176 0.306234 4588 31 0.413577