Variant

Variant ID Consequence Effect Gene AC AN AF NS NHOM maxEAF
4-7764946-TGACGAGGGGGACGGGCACGTGGAGAGGGTACGCCAAGACACAAAGTCCACGTCAG-T n.1465_*2delCTGACGTGGACTTTGTGTCTTGGCGTACCCTCTCCACGTGCCCGTCCCCCTCGTC splice_region AFAP1 1 44854 2.22946E-5 22427 0 9.55171E-5
4-7764949-C-T n.1517G>A splice_region AFAP1 1 44850 2.22965E-5 22425 0 3.18451E-5
4-7764949-C-G n.1517G>C splice_region AFAP1 1 44850 2.22965E-5 22425 0 NA
4-7764950-G-A n.1516C>T splice_region AFAP1 2 44852 4.45911E-5 22426 0 1.91022E-4
4-7765294-C-CT n.1637dupA splice_region AFAP1 1 67886 1.47306E-5 33943 0 NA
4-7765296-T-C n.1636A>G splice_region AFAP1 1 68284 1.46447E-5 34142 0 NA
4-7765491-C-CAAAGAATA c.2193_*1insTATTCTTT frameshift AFAP1 1 81188 1.23171E-5 40594 0 NA
4-7765495-G-T p.Thr730Thr synonymous AFAP1 9602 80894 0.118699 40447 742 0.19125
4-7765500-C-T p.Gly729Arg missense AFAP1 2 81122 2.46542E-5 40561 0 1.28434E-5
4-7765501-G-A p.Asn728Asn synonymous AFAP1 420 81116 0.00517777 40558 0 0.00474092
4-7765512-C-T p.Glu725Lys missense AFAP1 1 81024 1.2342E-5 40512 0 NA
4-7765514-C-T p.Trp724* stop_gained AFAP1 1 80988 1.23475E-5 40494 0 6.44621E-6
4-7765520-T-TTGGCCTTCCGC c.2167-3_2167-2insGCGGAAGGCCA splice_region AFAP1 3 80790 3.71333E-5 40395 1 NA
4-7765520-T-TTGGCCTTCCGCAGCACATGCCCTCGGC c.2167-3_2167-2insGCCGAGGGCATGTGCTGCGGAAGGCCA splice_region AFAP1 2 80790 2.47555E-5 40395 0 NA
4-7765524-G-A c.2167-6C>T splice_region AFAP1 37 80724 4.58352E-4 40362 0 8.28131E-4
4-7770563-G-C c.2166+8C>G splice_region AFAP1 2 81680 2.44858E-5 40840 0 NA
4-7770566-C-T c.2166+5G>A splice_region AFAP1 6 81746 7.33981E-5 40873 0 NA
4-7770571-C-T p.Lys722Lys splice_region+synonymous AFAP1 1 81868 1.22148E-5 40934 0 2.05486E-5
4-7770573-T-C p.Lys722Glu missense+splice_region AFAP1 1 81888 1.22118E-5 40944 0 4.09917E-6
4-7770581-C-T p.Arg719Gln missense AFAP1 2 81938 2.44087E-5 40969 0 2.5875E-5
4-7770582-G-A p.Arg719Trp missense AFAP1 8 81902 9.76777E-5 40951 1 2.44111E-5
4-7770586-C-T p.Val717Val synonymous AFAP1 1 81994 1.2196E-5 40997 0 8.55022E-6
4-7770592-C-T p.Gly715Gly synonymous AFAP1 1 82032 1.21904E-5 41016 0 4.03832E-6
4-7770593-C-T p.Gly715Glu missense AFAP1 3 82026 3.65738E-5 41013 0 8.06985E-6
4-7770594-C-T p.Gly715Arg missense AFAP1 1 82008 1.21939E-5 41004 0 NA
4-7770600-A-T p.Cys713Ser missense AFAP1 38 82052 4.63121E-4 41026 0 0.00101969
4-7770601-G-C p.Pro712Pro synonymous AFAP1 1 82078 1.21835E-5 41039 0 6.37349E-5
4-7770605-G-A p.Ser711Phe missense AFAP1 3 81980 3.65943E-5 40990 0 6.3743E-5
4-7770613-C-T p.Pro708Pro synonymous AFAP1 937 81924 0.0114374 40962 11 0.0146974
4-7770616-G-C p.Ala707Ala synonymous AFAP1 2 81990 2.43932E-5 40995 0 9.20471E-5
4-7770618-C-T p.Ala707Thr missense AFAP1 1 81942 1.22038E-5 40971 0 4.00638E-6
4-7770626-CTCT-C p.Lys703del disruptive_inframe_deletion AFAP1 2 82238 2.43197E-5 41119 0 9.55657E-5
4-7770628-C-G p.Lys703Asn missense AFAP1 3 82310 3.64476E-5 41155 0 3.99508E-6
4-7770628-C-T p.Lys703Lys synonymous AFAP1 1 82310 1.21492E-5 41155 0 1.19852E-5
4-7770634-C-T p.Leu701Leu synonymous AFAP1 3 82374 3.64193E-5 41187 0 3.18573E-5
4-7770640-G-A p.Ala699Ala synonymous AFAP1 8 82478 9.69956E-5 41239 0 1.91217E-4
4-7770643-C-T p.Ala698Ala synonymous AFAP1 4 82536 4.84637E-5 41268 0 3.58809E-5
4-7770644-G-A p.Ala698Val missense AFAP1 3 82544 3.63443E-5 41272 0 2.4912E-5
4-7770645-C-T p.Ala698Thr missense AFAP1 13 82560 1.57461E-4 41280 0 6.41813E-4
4-7770646-G-A p.Ser697Ser synonymous AFAP1 3 82550 3.63416E-5 41275 0 2.79049E-5
4-7770655-C-T p.Pro694Pro synonymous AFAP1 10 82694 1.20928E-4 41347 0 1.27421E-4
4-7770656-G-A p.Pro694Leu missense AFAP1 8 82656 9.67867E-5 41328 0 5.80171E-5
4-7770656-G-T p.Pro694Gln missense AFAP1 3 82656 3.6295E-5 41328 0 NA
4-7770660-C-T p.Val693Met missense AFAP1 11 82700 1.33011E-4 41350 0 5.03525E-4
4-7770661-G-A p.Pro692Pro synonymous AFAP1 8 82720 9.67118E-5 41360 0 1.99273E-5
4-7770664-G-A p.Gly691Gly synonymous AFAP1 1 82760 1.20831E-5 41380 0 NA
4-7770669-CGGTGTCACT-C p.Ser687_Thr689del conservative_inframe_deletion AFAP1 2 82782 2.41598E-5 41391 0 8.2776E-6
4-7770670-G-A p.Thr689Thr synonymous AFAP1 8 82764 9.66604E-5 41382 0 6.25E-4
4-7770670-G-T p.Thr689Thr synonymous AFAP1 1 82764 1.20825E-5 41382 0 NA
4-7770677-C-G p.Ser687Thr missense AFAP1 1 82860 1.20685E-5 41430 0 3.98378E-6
4-7770680-G-C p.Thr686Ser missense AFAP1 1 82902 1.20624E-5 41451 0 NA
4-7770691-G-A p.Ser682Ser synonymous AFAP1 1 82980 1.20511E-5 41490 0 NA
4-7770700-C-T p.Ser679Ser synonymous AFAP1 75 82966 9.03985E-4 41483 0 8.92061E-4
4-7770701-G-A p.Ser679Leu missense AFAP1 6 82976 7.23101E-5 41488 0 6.36943E-5
4-7770703-G-A p.Asn678Asn synonymous AFAP1 10 82978 1.20514E-4 41489 0 0.00125
4-7770707-T-C p.Glu677Gly missense AFAP1 1 83006 1.20473E-5 41503 0 7.98499E-6
4-7770712-G-A p.Thr675Thr synonymous AFAP1 4 83012 4.81858E-5 41506 0 NA
4-7770713-G-A p.Thr675Ile missense AFAP1 2 83026 2.40888E-5 41513 0 NA
4-7770714-T-C p.Thr675Ala missense AFAP1 1 83014 1.20462E-5 41507 0 3.18715E-5
4-7770716-C-T p.Arg674Gln missense AFAP1 6 83006 7.22839E-5 41503 0 5.81685E-5
4-7770717-G-A p.Arg674Trp missense AFAP1 2 83002 2.40958E-5 41501 0 8.31103E-6
4-7770722-C-T p.Arg672Gln missense AFAP1 3 82984 3.61515E-5 41492 0 6.37105E-5
4-7770723-G-T p.Arg672Arg synonymous AFAP1 17455 82566 0.211407 41283 2130 0.282828
4-7770723-G-A p.Arg672Trp missense AFAP1 3 82984 3.61515E-5 41492 0 9.56938E-5
4-7770737-T-TGTGGACTCGATGTCCCTGACTTGGGCTCGATGGCCAGCCCCAGGG c.2002-3_2002-2insCCCTGGGGCTGGCCATCGAGCCCAAGTCAGGGACATCGAGTCCAC splice_region AFAP1 3 82890 3.61925E-5 41445 1 NA
4-7770741-C-T c.2002-6G>A splice_region AFAP1 9 82836 1.08648E-4 41418 0 1.1055E-4
4-7770742-G-A c.2002-7C>T splice_region AFAP1 5 82828 6.03661E-5 41414 0 8.46095E-5
4-7774543-A-G c.2001+4T>C splice_region AFAP1 1 81946 1.22032E-5 40973 0 NA
4-7774556-C-T p.Ser664Ser synonymous AFAP1 1 81930 1.22055E-5 40965 0 1.20912E-5
4-7774557-G-A p.Ser664Leu missense AFAP1 82 82000 0.001 41000 0 0.00111593
4-7774562-C-T p.Gly662Gly synonymous AFAP1 1 82034 1.21901E-5 41017 0 8.05127E-6
4-7774564-C-G p.Gly662Arg missense AFAP1 1 82042 1.21889E-5 41021 0 NA
4-7774565-T-G p.Ser661Ser synonymous AFAP1 170 82024 0.00207256 41012 0 0.00203649
4-7774568-C-G p.Lys660Asn missense AFAP1 21 81996 2.5611E-4 40998 0 1.91782E-4
4-7774577-G-A p.Ile657Ile synonymous AFAP1 8 81960 9.76086E-5 40980 0 7.48789E-5
4-7774577-G-C p.Ile657Met missense AFAP1 1 81960 1.22011E-5 40980 0 4.15994E-5
4-7774582-C-A p.Ala656Ser missense AFAP1 2 81970 2.43992E-5 40985 0 4.02385E-6
4-7774582-C-G p.Ala656Pro missense AFAP1 2 81970 2.43992E-5 40985 0 8.31048E-6
4-7774585-G-C p.Leu655Val missense AFAP1 1 81974 1.2199E-5 40987 0 NA
4-7774600-C-T p.Gly650Arg missense AFAP1 1 82082 1.21829E-5 41041 0 NA
4-7774601-G-A p.Gly649Gly synonymous AFAP1 3 81910 3.66256E-5 40955 0 4.87797E-5
4-7774604-C-T p.Ala648Ala synonymous AFAP1 1 82588 1.21083E-5 41294 0 8.26446E-6
4-7774605-G-A p.Ala648Val missense AFAP1 2 82586 2.42172E-5 41293 0 2.47881E-5
4-7774606-CCAGCGCTTTCTTCAGGCTCTCCTTGACCTCCGT-C p.Thr637_Leu647del conservative_inframe_deletion AFAP1 1 82626 1.21027E-5 41313 0 NA
4-7774610-C-T p.Ala646Ala synonymous AFAP1 7356 82488 0.0891766 41244 432 0.179375
4-7774613-T-C p.Lys645Lys synonymous AFAP1 315 82744 0.00380692 41372 4 0.00735809
4-7774623-C-T p.Ser642Asn missense AFAP1 12 82812 1.44907E-4 41406 0 6.81827E-5
4-7774637-C-T p.Thr637Thr synonymous AFAP1 6 82728 7.25268E-5 41364 0 4.00882E-4
4-7774638-G-A p.Thr637Met missense AFAP1 3 82732 3.62617E-5 41366 0 9.55901E-5
4-7774638-G-T p.Thr637Lys missense AFAP1 2 82732 2.41744E-5 41366 0 1.6515E-5
4-7774652-C-T p.Leu632Leu synonymous AFAP1 3 82744 3.62564E-5 41372 0 5.78359E-5
4-7774660-C-G p.Val630Leu missense AFAP1 1 82720 1.2089E-5 41360 0 3.18492E-5
4-7774662-C-T p.Arg629His missense AFAP1 3 82758 3.62503E-5 41379 0 1.65379E-5
4-7774667-C-T p.Ala627Ala synonymous AFAP1 22 82780 2.65765E-4 41390 0 6.25E-4
4-7774667-C-A p.Ala627Ala synonymous AFAP1 4 82778 4.8322E-5 41389 0 3.60453E-4
4-7774670-C-G p.Glu626Asp missense AFAP1 1 82778 1.20805E-5 41389 0 NA
4-7774680-C-T p.Arg623Gln missense AFAP1 10 82664 1.20972E-4 41332 0 1.16256E-4
4-7774680-C-G p.Arg623Pro missense AFAP1 2 82664 2.41943E-5 41332 0 NA
4-7774681-G-A p.Arg623Trp missense AFAP1 40 82656 4.83933E-4 41328 0 3.92833E-4
4-7774681-G-T p.Arg623Arg synonymous AFAP1 1 82656 1.20983E-5 41328 0 NA
4-7774682-G-A p.Cys622Cys synonymous AFAP1 5 82620 6.0518E-5 41310 0 2.36543E-4
4-7774683-C-T p.Cys622Tyr missense AFAP1 1 82628 1.21024E-5 41314 0 NA
4-7774684-ACTC-A p.Glu621del conservative_inframe_deletion AFAP1 1 82596 1.21071E-5 41298 0 2.4914E-5
4-7774685-C-T p.Glu621Glu synonymous AFAP1 160 82634 0.00193625 41317 1 0.00461783
4-7774687-CCTCCTCCAGCTGCTTCAGCTT-C p.Lys614_Glu620del conservative_inframe_deletion AFAP1 1 82610 1.21051E-5 41305 0 NA
4-7774691-C-T p.Glu619Glu synonymous AFAP1 1 82626 1.21027E-5 41313 0 NA
4-7774695-AGCTGCTTCAGCTTCTCCTCCAGGATCGCCT-A p.Gln608_Gln617del disruptive_inframe_deletion AFAP1 1 82576 1.21101E-5 41288 0 4.0121E-6
4-7774698-T-C p.Gln617Arg missense AFAP1 2 82512 2.42389E-5 41256 0 2.50004E-5
4-7774700-C-T p.Lys616Lys synonymous AFAP1 1 82516 1.21189E-5 41258 0 1.66803E-5
4-7774707-T-C p.Lys614Arg missense AFAP1 2 82388 2.42754E-5 41194 0 6.70365E-5
4-7774707-T-A p.Lys614Met missense AFAP1 1 82388 1.21377E-5 41194 0 NA
4-7774708-TCTC-T p.Glu613del conservative_inframe_deletion AFAP1 2 82314 2.42972E-5 41157 0 3.35537E-5
4-7774709-C-G p.Glu613Asp missense AFAP1 5 82308 6.07474E-5 41154 0 1.59236E-4
4-7774717-G-A p.Leu611Leu synonymous AFAP1 1 82076 1.21838E-5 41038 0 4.03223E-6
4-7774722-G-A p.Ala609Val missense AFAP1 12 81824 1.46656E-4 40912 0 1.59266E-4
4-7774727-C-T p.Pro607Pro synonymous AFAP1 13 81680 1.59158E-4 40840 0 2.53634E-4
4-7774728-G-A p.Pro607Leu missense AFAP1 11 81688 1.34659E-4 40844 0 0.001875
4-7774738-C-CGGCG c.1811-2_1811-1insCGCC splice_acceptor AFAP1 1 81458 1.22763E-5 40729 0 NA
4-7776466-C-G p.Gly604Arg missense+splice_region AFAP1 2 83168 2.40477E-5 41584 0 NA
4-7776469-C-T p.Ala603Thr missense AFAP1 2 83182 2.40437E-5 41591 0 1.15802E-4
4-7776470-G-A p.Asn602Asn synonymous AFAP1 8 83204 9.61492E-5 41602 0 1.91046E-4
4-7776475-C-T p.Val601Met missense AFAP1 3 83250 3.6036E-5 41625 0 3.98086E-6
4-7776486-G-A p.Ala597Val missense AFAP1 2 83206 2.40367E-5 41603 0 3.18672E-5
4-7776509-G-A p.Arg589Arg synonymous AFAP1 1 83066 1.20386E-5 41533 0 NA
4-7776510-C-T p.Arg589His missense AFAP1 1 83014 1.20462E-5 41507 0 3.99339E-6
4-7776511-G-A p.Arg589Cys missense AFAP1 1 83004 1.20476E-5 41502 0 1.64747E-5
4-7776512-G-A p.Leu588Leu synonymous AFAP1 3 83006 3.6142E-5 41503 0 8.23737E-6
4-7776514-G-A p.Leu588Phe missense AFAP1 3 82956 3.61638E-5 41478 0 3.18471E-5
4-7776527-A-G p.Asn583Asn synonymous AFAP1 1 82950 1.20555E-5 41475 0 3.9976E-6
4-7776531-C-T p.Arg582Gln missense AFAP1 5 82886 6.03238E-5 41443 0 6.36943E-5
4-7776543-T-A p.Lys578Ile missense AFAP1 1 82864 1.2068E-5 41432 0 NA
4-7776545-C-T p.Arg577Arg synonymous AFAP1 1 82804 1.20767E-5 41402 0 NA
4-7776556-G-A p.Leu574Leu synonymous AFAP1 2 82714 2.41797E-5 41357 0 NA
4-7776562-C-A p.Glu572* stop_gained AFAP1 1 82728 1.20878E-5 41364 0 NA
4-7776579-C-T p.Arg566Gln missense AFAP1 1 82530 1.21168E-5 41265 0 1.20306E-5
4-7776580-G-A p.Arg566Trp missense AFAP1 27 82492 3.27304E-4 41246 0 5.81503E-4
4-7776582-T-C p.Lys565Arg missense AFAP1 2 82510 2.42395E-5 41255 0 3.18512E-5
4-7776601-G-A p.Arg559Trp missense AFAP1 1 82286 1.21527E-5 41143 0 3.18573E-5
4-7776611-A-G p.Tyr555Tyr synonymous AFAP1 2 82126 2.43528E-5 41063 0 NA
4-7776612-T-A p.Tyr555Phe missense AFAP1 2 82118 2.43552E-5 41059 0 NA
4-7776621-T-C p.Gln552Arg missense AFAP1 2 81990 2.43932E-5 40995 0 4.13186E-6
4-7776630-T-TTCGAACCCGTCCTTTTCACAACAGCCGCGGGATC c.1646-1_1646insGATCCCGCGGCTGTTGTGAAAAGGACGGGTTCGA splice_acceptor AFAP1 2 81910 2.4417E-5 40955 1 NA
4-7776630-T-TTCGAACCCGTCCTTTTCACAACAGCCGCGGGATCCG c.1646-1_1646insCGGATCCCGCGGCTGTTGTGAAAAGGACGGGTTCGA splice_acceptor AFAP1 2 81910 2.4417E-5 40955 1 NA
4-7776630-T-TTCGAACCCGTCCTTTTCACAACAGCCGCGGGATCCGCTTTCTTTGG c.1646-1_1646insCCAAAGAAAGCGGATCCCGCGGCTGTTGTGAAAAGGACGGGTTCGA splice_acceptor AFAP1 2 81910 2.4417E-5 40955 1 NA
4-7776636-G-A c.1646-6C>T splice_region AFAP1 20 81802 2.44493E-4 40901 0 3.24317E-5
4-7780490-C-T p.Ser548Ser splice_region+synonymous AFAP1 2 82762 2.41657E-5 41381 0 5.76749E-5
4-7780491-G-A p.Ser548Leu missense+splice_region AFAP1 1 82812 1.20755E-5 41406 0 0.00125
4-7780497-G-A p.Thr546Met missense AFAP1 5 82974 6.02598E-5 41487 0 1.27453E-4
4-7780508-A-C p.Val542Val synonymous AFAP1 10 83148 1.20267E-4 41574 0 3.87201E-4
4-7780509-A-G p.Val542Ala missense AFAP1 1 83174 1.2023E-5 41587 0 NA
4-7780514-C-T p.Ala540Ala synonymous AFAP1 47 83224 5.64741E-4 41612 0 9.87324E-4
4-7780514-C-A p.Ala540Ala synonymous AFAP1 8 83224 9.61261E-5 41612 0 2.38911E-4
4-7780515-G-A p.Ala540Val missense AFAP1 13 83248 1.5616E-4 41624 0 5.04541E-4
4-7780517-G-A p.Pro539Pro synonymous AFAP1 4 83268 4.80377E-5 41634 0 3.29538E-5
4-7780517-G-T p.Pro539Pro synonymous AFAP1 1 83268 1.20094E-5 41634 0 NA
4-7780523-C-T p.Ala537Ala synonymous AFAP1 2 83298 2.40102E-5 41649 0 6.25E-4
4-7780524-G-A p.Ala537Val missense AFAP1 311 83312 0.00373296 41656 1 0.00853503
4-7780528-T-G p.Lys536Gln missense AFAP1 1 83324 1.20013E-5 41662 0 3.18451E-5
4-7780533-G-A p.Pro534Leu missense AFAP1 1 83328 1.20008E-5 41664 0 3.97652E-6
4-7780544-CAG-C p.Leu530fs frameshift AFAP1 1 83362 1.19959E-5 41681 0 7.95342E-6
4-7780546-G-T p.Leu530Met missense AFAP1 1 83360 1.19962E-5 41680 0 NA
4-7780551-T-C p.Lys528Arg missense AFAP1 1 83352 1.19973E-5 41676 0 3.97681E-6
4-7780567-C-T p.Val523Ile missense AFAP1 1 83338 1.19993E-5 41669 0 8.25205E-6
4-7780568-C-T p.Gly522Gly synonymous AFAP1 1 83332 1.20002E-5 41666 0 NA
4-7780575-G-C p.Ser520Cys missense AFAP1 2 83336 2.39992E-5 41668 0 NA
4-7780577-C-T p.Ala519Ala synonymous AFAP1 29 83322 3.48047E-4 41661 0 1.19423E-4
4-7780578-G-A p.Ala519Val missense AFAP1 2 83310 2.40067E-5 41655 0 1.19517E-5
4-7780582-C-T p.Val518Met missense AFAP1 20541 82514 0.24894 41257 2924 0.262336
4-7780583-G-A p.Pro517Pro synonymous AFAP1 1 83292 1.2006E-5 41646 0 1.99308E-5
4-7780585-G-T p.Pro517Thr missense AFAP1 1 83278 1.2008E-5 41639 0 NA
4-7780587-G-T p.Pro516His missense AFAP1 2 83266 2.40194E-5 41633 0 NA
4-7780590-T-C p.Lys515Arg missense AFAP1 1 83274 1.20085E-5 41637 0 NA
4-7780603-G-A p.Leu511Phe missense+splice_region AFAP1 1 83144 1.20273E-5 41572 0 4.032E-6
4-7780605-T-C c.1531-2A>G splice_acceptor AFAP1 1 83126 1.20299E-5 41563 0 NA
4-7783098-C-T c.1782+5G>A splice_region AFAP1 1 82656 1.20983E-5 41328 0 1.4084E-4
4-7783098-C-G c.1782+5G>C splice_region AFAP1 1 82656 1.20983E-5 41328 0 6.4018E-6
4-7783099-G-A c.1782+4C>T splice_region AFAP1 655 82642 0.00792575 41321 5 0.00755258
4-7783106-C-A p.Ser593Ser synonymous AFAP1 5 82694 6.04639E-5 41347 0 3.83563E-5
4-7783107-G-A p.Ser593Leu missense AFAP1 4 82696 4.83699E-5 41348 0 9.56145E-5
4-7783109-G-C p.Asn592Lys missense AFAP1 1 82702 1.20916E-5 41351 0 NA
4-7783117-C-T p.Gly590Arg missense AFAP1 3 82710 3.62713E-5 41355 0 2.55122E-5
4-7783118-G-A p.Leu589Leu synonymous AFAP1 4 82708 4.83629E-5 41354 0 4.60024E-5
4-7783120-G-T p.Leu589Ile missense AFAP1 2 82716 2.41791E-5 41358 0 6.37292E-5
4-7783124-C-T p.Ala587Ala synonymous AFAP1 2 82718 2.41785E-5 41359 0 3.18573E-5
4-7783132-C-T p.Gly585Arg missense AFAP1 2 82732 2.41744E-5 41366 0 NA
4-7783146-T-C p.Asn580Ser missense AFAP1 1 82754 1.2084E-5 41377 0 6.33906E-6
4-7783163-G-A p.Ser574Ser synonymous AFAP1 52482 82542 0.635822 41271 16872 0.661738
4-7783163-GG-AA p.Ser574Phe missense AFAP1 1 82790 1.20788E-5 41395 0 NA
4-7783163-GG-AC p.Ser574Cys missense AFAP1 1 82790 1.20788E-5 41395 0 NA
4-7783166-G-A p.Ala573Ala synonymous AFAP1 1 82788 1.2079E-5 41394 0 6.25E-4
4-7783171-G-A p.Pro572Ser missense AFAP1 1 82792 1.20785E-5 41396 0 4.4245E-5
4-7783172-G-A p.Tyr571Tyr synonymous AFAP1 11838 82680 0.143179 41340 873 0.152265
4-7783174-A-ATT p.Tyr571fs frameshift AFAP1 1 82782 1.20799E-5 41391 0 NA
4-7783178-G-C p.Tyr569* stop_gained AFAP1 1 82798 1.20776E-5 41399 0 NA
4-7783182-T-C p.His568Arg missense AFAP1 1 82806 1.20764E-5 41403 0 NA
4-7783188-G-C p.Ser566Cys missense AFAP1 3 82808 3.62284E-5 41404 0 3.16232E-5
4-7783203-G-A p.Ala561Val missense AFAP1 2 82814 2.41505E-5 41407 0 2.52777E-5
4-7783205-A-C p.Ser560Ser synonymous AFAP1 1 82818 1.20747E-5 41409 0 NA
4-7783228-C-A p.Asp553Tyr missense AFAP1 1 82792 1.20785E-5 41396 0 NA
4-7783232-A-G p.Pro551Pro synonymous AFAP1 1 82788 1.2079E-5 41394 0 4.39097E-5
4-7783235-A-G p.Ser550Ser synonymous AFAP1 4 82790 4.8315E-5 41395 0 2.52328E-5
4-7783237-A-G p.Ser550Pro missense AFAP1 1 82790 1.20788E-5 41395 0 NA
4-7783239-T-G p.Tyr549Ser missense AFAP1 1 82784 1.20796E-5 41392 0 1.26175E-5
4-7783242-C-G p.Arg548Pro missense AFAP1 2 82782 2.41598E-5 41391 0 6.31074E-6
4-7783243-G-A p.Arg548Cys missense AFAP1 13 82778 1.57047E-4 41389 0 7.91905E-4
4-7783252-T-C p.Ile545Val missense AFAP1 3 82762 3.62485E-5 41381 0 1.26307E-5
4-7783256-C-T p.Pro543Pro synonymous AFAP1 2 82756 2.41674E-5 41378 0 1.2006E-4
4-7783256-C-G p.Pro543Pro synonymous AFAP1 1 82756 1.20837E-5 41378 0 NA
4-7783257-G-A p.Pro543Leu missense AFAP1 11 82762 1.32911E-4 41381 0 0.00125
4-7783262-C-T p.Pro541Pro synonymous AFAP1 5 82736 6.04332E-5 41368 0 4.42126E-5
4-7783263-G-A p.Pro541Leu missense AFAP1 2 82736 2.41733E-5 41368 0 1.27413E-4
4-7783273-C-T p.Asp538Asn missense AFAP1 9 82698 1.0883E-4 41349 0 0.00366265
4-7783274-G-A p.Tyr537Tyr synonymous AFAP1 2 82690 2.41867E-5 41345 0 3.18573E-5
4-7783275-T-G p.Tyr537Ser missense AFAP1 2 82692 2.41861E-5 41346 0 NA
4-7783283-T-C p.Ala534Ala synonymous AFAP1 6 82660 7.25865E-5 41330 0 4.44157E-5
4-7783285-C-T p.Ala534Thr missense AFAP1 30 82642 3.63012E-4 41321 0 2.03089E-4
4-7783286-G-A p.Asn533Asn synonymous AFAP1 7706 82316 0.0936148 41158 483 0.181875
4-7783298-C-T p.Val529Val synonymous AFAP1 1 82558 1.21127E-5 41279 0 6.36651E-6
4-7783299-A-C p.Val529Gly missense AFAP1 2 82518 2.42371E-5 41259 0 0.00366748
4-7783304-T-G p.Glu527Asp missense AFAP1 1 82536 1.21159E-5 41268 0 NA
4-7783316-T-A p.Arg523Ser missense AFAP1 1 82478 1.21244E-5 41239 0 NA
4-7783323-C-T p.Cys521Tyr missense AFAP1 2 82396 2.4273E-5 41198 0 4.64598E-5
4-7783325-G-A p.Ser520Ser synonymous AFAP1 1 82376 1.21395E-5 41188 0 6.38545E-6
4-7783339-C-T p.Gly516Ser missense AFAP1 3 82110 3.65364E-5 41055 0 1.27372E-4
4-7783340-G-A p.Asp515Asp synonymous AFAP1 8 82106 9.7435E-5 41053 0 4.69484E-5
4-7783342-C-T p.Asp515Asn missense AFAP1 3 82096 3.65426E-5 41048 0 3.20275E-5
4-7783346-C-T p.Pro513Pro synonymous AFAP1 17 81960 2.07418E-4 40980 0 3.82093E-4
4-7783347-G-A p.Pro513Leu missense AFAP1 6 81896 7.32637E-5 40948 0 1.09065E-4
4-7783356-T-A c.1531-2A>T splice_acceptor AFAP1 1 81706 1.2239E-5 40853 0 4.72858E-5
4-7787921-C-T p.Ser510Ser splice_region+synonymous AFAP1 1 83288 1.20065E-5 41644 0 8.25682E-6
4-7787926-C-T p.Gly509Ser missense AFAP1 1 83324 1.20013E-5 41662 0 0.00100806
4-7787927-G-A p.Asn508Asn synonymous AFAP1 1 83336 1.19996E-5 41668 0 3.18451E-5
4-7787932-T-C p.Ile507Val missense AFAP1 1 83354 1.1997E-5 41677 0 3.97801E-6
4-7787934-C-T p.Cys506Tyr missense AFAP1 1 83364 1.19956E-5 41682 0 3.97864E-6
4-7787936-C-T p.Pro505Pro synonymous AFAP1 13 83358 1.55954E-4 41679 0 1.43214E-4
4-7787937-G-A p.Pro505Leu missense AFAP1 3 83362 3.59876E-5 41681 0 9.06529E-5
4-7787938-G-T p.Pro505Thr missense AFAP1 1 83364 1.19956E-5 41682 0 NA
4-7787945-G-A p.Asp502Asp synonymous AFAP1 4 83360 4.79846E-5 41680 0 3.18471E-5
4-7787951-A-C p.His500Gln missense AFAP1 1 83372 1.19944E-5 41686 0 3.18471E-5
4-7787960-C-T p.Thr497Thr synonymous AFAP1 1 83372 1.19944E-5 41686 0 6.25E-4
4-7787961-G-A p.Thr497Met missense AFAP1 1 83378 1.19936E-5 41689 0 4.11902E-5
4-7787965-C-T p.Gly496Arg missense AFAP1 1 83378 1.19936E-5 41689 0 6.25E-4
4-7787966-G-A p.Ser495Ser synonymous AFAP1 4 83380 4.79731E-5 41690 0 1.98826E-5
4-7787967-C-G p.Ser495Thr missense AFAP1 1 83378 1.19936E-5 41689 0 3.1837E-5
4-7787973-T-C p.His493Arg missense AFAP1 1 83380 1.19933E-5 41690 0 NA
4-7787979-T-C p.Tyr491Cys missense AFAP1 2 83378 2.39871E-5 41689 0 7.95254E-6
4-7787983-C-T p.Gly490Ser missense AFAP1 28 83384 3.35796E-4 41692 0 8.59654E-4
4-7787984-G-A p.Asn489Asn synonymous AFAP1 2 83384 2.39854E-5 41692 0 9.88468E-5
4-7787991-G-A p.Thr487Ile missense AFAP1 10 83384 1.19927E-4 41692 0 0.00100705
4-7788007-G-C p.Pro482Ala missense AFAP1 3 83372 3.59833E-5 41686 0 3.97659E-6
4-7788024-C-T p.Arg476His missense AFAP1 6 83350 7.19856E-5 41675 0 4.12011E-5
4-7788025-G-T p.Arg476Ser missense AFAP1 28 83344 3.35957E-4 41672 0 0.00125
4-7788025-G-A p.Arg476Cys missense AFAP1 3 83344 3.59954E-5 41672 0 4.12031E-5
4-7788028-T-C p.Arg475Gly missense AFAP1 2 83336 2.39992E-5 41668 0 7.58901E-5
4-7788032-C-A p.Met473Ile missense AFAP1 2 83328 2.40015E-5 41664 0 NA
4-7788035-G-A p.Phe472Phe synonymous AFAP1 1 83306 1.20039E-5 41653 0 NA
4-7788038-A-ACAGAAGGTCTGTTTGGCTGT c.1413-1_1413insACAGCCAAACAGACCTTCTG splice_acceptor AFAP1 4 83282 4.80296E-5 41641 2 NA
4-7788039-C-G c.1413-1G>C splice_acceptor AFAP1 1 83278 1.2008E-5 41639 0 3.1841E-5
4-7788045-G-A c.1413-7C>T splice_region AFAP1 2 83232 2.40292E-5 41616 0 1.64967E-5
4-7795408-CAGA-C p.Phe470del disruptive_inframe_deletion AFAP1 1 81802 1.22246E-5 40901 0 NA
4-7795414-G-A p.Thr469Ile missense AFAP1 1 82036 1.21898E-5 41018 0 NA
4-7795439-T-C p.Ser461Gly missense AFAP1 1 82818 1.20747E-5 41409 0 5.03525E-4
4-7795441-G-A p.Ala460Val missense AFAP1 1 82810 1.20758E-5 41405 0 3.99112E-6
4-7795459-A-G p.Ile454Thr missense AFAP1 1 82976 1.20517E-5 41488 0 6.37227E-5
4-7795460-T-C p.Ile454Val missense AFAP1 1 82982 1.20508E-5 41491 0 7.9741E-6
4-7795468-T-C p.Tyr451Cys missense AFAP1 2 82854 2.41388E-5 41427 0 3.18532E-5
4-7795470-G-A p.His450His synonymous AFAP1 1 82910 1.20613E-5 41455 0 3.98829E-6
4-7795482-C-T p.Pro446Pro synonymous AFAP1 2 82972 2.41045E-5 41486 0 6.25E-4
4-7795486-T-C p.Asp445Gly missense AFAP1 2 82964 2.41068E-5 41482 0 2.47341E-5
4-7795494-C-T p.Ser442Ser synonymous AFAP1 1 82902 1.20624E-5 41451 0 3.18431E-5
4-7795494-C-A p.Ser442Ser synonymous AFAP1 1 82902 1.20624E-5 41451 0 6.25E-4
4-7795500-C-T p.Thr440Thr synonymous AFAP1 1 82826 1.20735E-5 41413 0 1.64932E-5
4-7795501-G-A p.Thr440Met missense AFAP1 3 82816 3.62249E-5 41408 0 6.25E-4
4-7795506-T-G p.Ala438Ala synonymous AFAP1 7 82824 8.45166E-5 41412 0 6.36902E-5
4-7795508-C-A p.Ala438Ser missense AFAP1 7 82784 8.45574E-5 41392 0 0.00100705
4-7795508-C-T p.Ala438Thr missense AFAP1 3 82784 3.62389E-5 41392 0 3.18492E-5
4-7795509-G-A p.Leu437Leu synonymous AFAP1 23 82786 2.77825E-4 41393 0 8.49597E-4
4-7795521-A-G p.Ile433Ile synonymous AFAP1 46 82676 5.56389E-4 41338 0 0.005625
4-7795529-T-G p.Arg431Arg synonymous AFAP1 1 82604 1.2106E-5 41302 0 NA
4-7795547-A-C p.Ser425Ala missense AFAP1 2 82124 2.43534E-5 41062 0 NA
4-7795555-T-TCCAATACTGCAACCTCCTGGCC c.1267-3_1267-2insGGCCAGGAGGTTGCAGTATTGG splice_region AFAP1 1 81842 1.22187E-5 40921 0 NA
4-7795556-G-A c.1267-3C>T splice_region AFAP1 2 81728 2.44714E-5 40864 0 1.27397E-4
4-7800628-C-T n.260G>A splice_region AFAP1 1 67370 1.48434E-5 33685 0 3.18654E-5
4-7800629-G-T n.259C>A splice_region AFAP1 5 67318 7.42743E-5 33659 0 1.27584E-4
4-7800629-G-A n.259C>T splice_region AFAP1 2 67318 2.97097E-5 33659 0 3.18959E-5
4-7802192-C-T p.Gly415Ser missense AFAP1 1 83250 1.2012E-5 41625 0 3.18552E-5
4-7802193-G-A p.Asn414Asn synonymous AFAP1 1 83262 1.20103E-5 41631 0 4.9906E-5
4-7802198-G-A p.Arg413Cys missense AFAP1 5 83272 6.00442E-5 41636 0 4.97934E-5
4-7802201-G-A p.Leu412Leu synonymous AFAP1 1 83296 1.20054E-5 41648 0 4.97463E-5
4-7802206-C-T p.Arg410Gln missense AFAP1 8 83326 9.60085E-5 41663 0 7.15905E-5
4-7802207-G-A p.Arg410Trp missense AFAP1 13 83332 1.56002E-4 41666 0 7.44589E-5
4-7802208-G-T p.Phe409Leu missense AFAP1 1 83334 1.19999E-5 41667 0 4.13558E-5
4-7802211-C-T p.Thr408Thr synonymous AFAP1 1 83330 1.20005E-5 41665 0 3.30644E-5
4-7802212-G-A p.Thr408Met missense AFAP1 1 83342 1.19988E-5 41671 0 5.03525E-4
4-7802214-C-G p.Leu407Leu synonymous AFAP1 1 83350 1.19976E-5 41675 0 NA
4-7802217-A-G p.Pro406Pro synonymous AFAP1 9 83358 1.07968E-4 41679 0 9.55049E-5
4-7802221-T-C p.His405Arg missense AFAP1 1 83366 1.19953E-5 41683 0 3.18431E-5
4-7802222-G-A p.His405Tyr missense AFAP1 1 83362 1.19959E-5 41681 0 NA
4-7802227-G-C p.Ser403Cys missense AFAP1 13640 83212 0.163919 41606 1145 0.170191
4-7802230-T-A p.Asp402Val missense AFAP1 1 83366 1.19953E-5 41683 0 NA
4-7802238-C-T p.Pro399Pro synonymous AFAP1 16 83372 1.91911E-4 41686 0 8.24348E-6
4-7802238-C-A p.Pro399Pro synonymous AFAP1 1 83370 1.19947E-5 41685 0 NA
4-7802239-G-A p.Pro399Leu missense AFAP1 1 83376 1.19939E-5 41688 0 3.18471E-5
4-7802249-C-T p.Glu396Lys missense AFAP1 1 83368 1.1995E-5 41684 0 NA
4-7802250-G-A p.Cys395Cys synonymous AFAP1 1 83372 1.19944E-5 41686 0 1.98828E-5
4-7802257-C-T p.Arg393His missense AFAP1 49 83382 5.87657E-4 41691 1 7.96128E-4
4-7802257-C-A p.Arg393Leu missense AFAP1 3 83384 3.59781E-5 41692 0 4.1197E-5
4-7802263-G-A p.Pro391Leu missense AFAP1 8 83386 9.59394E-5 41693 0 5.56695E-5
4-7802266-A-G p.Ile390Thr missense AFAP1 1 83388 1.19921E-5 41694 0 8.23818E-6
4-7802269-G-A p.Ser389Phe missense AFAP1 3 83400 3.59712E-5 41700 0 1.64766E-5
4-7802271-C-T p.Val388Val synonymous AFAP1 4 83396 4.79639E-5 41698 0 8.23805E-6
4-7802280-G-T p.Thr385Thr synonymous AFAP1 3 83406 3.59686E-5 41703 0 2.47129E-5
4-7802283-C-A p.Lys384Asn missense AFAP1 3 83406 3.59686E-5 41703 0 3.18451E-5
4-7802288-G-A p.Leu383Leu synonymous AFAP1 18 83396 2.15838E-4 41698 0 0.0020141
4-7802291-C-A p.Asp382Tyr missense AFAP1 1 83392 1.19916E-5 41696 0 NA
4-7802292-G-A p.Thr381Thr synonymous AFAP1 21243 83188 0.255361 41594 3127 0.266868
4-7802303-T-G p.Lys378Gln missense AFAP1 1 83396 1.1991E-5 41698 0 8.23723E-6
4-7802304-G-A p.His377His synonymous AFAP1 2 83398 2.39814E-5 41699 0 8.23723E-6
4-7802319-G-A p.Asn372Asn synonymous AFAP1 3 83370 3.59842E-5 41685 0 3.97646E-6
4-7802320-T-G p.Asn372Thr missense AFAP1 1 83370 1.19947E-5 41685 0 NA
4-7802322-A-C p.Asp371Glu missense AFAP1 1 83352 1.19973E-5 41676 0 NA
4-7802326-T-C p.Lys370Arg missense AFAP1 1 83342 1.19988E-5 41671 0 NA
4-7802332-C-T p.Arg368Gln missense AFAP1 2 83290 2.40125E-5 41645 0 5.03525E-4
4-7802341-C-T p.Arg365His missense AFAP1 2 83196 2.40396E-5 41598 0 2.78377E-5
4-7802342-G-A p.Arg365Cys missense AFAP1 74 83186 8.89573E-4 41593 0 0.0100705
4-7802346-T-C p.Arg363Arg synonymous AFAP1 1 83168 1.20239E-5 41584 0 NA
4-7802347-C-T p.Arg363Gln missense AFAP1 16 83166 1.92386E-4 41583 0 3.1841E-4
4-7802348-G-A p.Arg363* stop_gained AFAP1 1 83112 1.2032E-5 41556 0 NA
4-7802351-A-G p.Trp362Arg missense AFAP1 1 83104 1.20331E-5 41552 0 NA
4-7802354-G-A p.Arg361Cys missense AFAP1 6 83058 7.22387E-5 41529 0 3.58052E-5
4-7802361-G-A p.Ser358Ser synonymous AFAP1 1 82918 1.20601E-5 41459 0 3.18532E-5
4-7802366-G-T p.Leu357Ile missense AFAP1 1 82728 1.20878E-5 41364 0 NA
4-7802384-C-T c.1055-4G>A splice_region AFAP1 2 82458 2.42548E-5 41229 0 2.49767E-5
4-7802385-G-A c.1055-5C>T splice_region AFAP1 1852 82450 0.0224621 41225 111 0.0449306
4-7802386-G-A c.1055-6C>T splice_region AFAP1 1 82510 1.21197E-5 41255 0 NA
4-7802388-G-C c.1055-8C>G splice_region AFAP1 1 82500 1.21212E-5 41250 0 3.99007E-6
4-7811358-T-A p.Glu346Val missense AFAP1 1 83342 1.19988E-5 41671 0 8.24715E-6
4-7811372-G-C p.Thr341Thr synonymous AFAP1 1 83368 1.1995E-5 41684 0 2.47276E-5
4-7811372-G-A p.Thr341Thr synonymous AFAP1 1 83368 1.1995E-5 41684 0 NA
4-7811381-G-A p.Asp338Asp synonymous AFAP1 2 83370 2.39894E-5 41685 0 3.58121E-5
4-7811387-G-A p.Ser336Ser synonymous AFAP1 1 83382 1.1993E-5 41691 0 NA
4-7811390-C-T p.Pro335Pro synonymous AFAP1 1 83380 1.19933E-5 41690 0 2.7845E-5
4-7811391-G-A p.Pro335Leu missense AFAP1 1 83374 1.19941E-5 41687 0 4.1214E-5
4-7811404-C-T p.Gly331Arg missense AFAP1 2 83378 2.39871E-5 41689 0 3.97801E-6
4-7811409-C-A p.Ser329Ile missense AFAP1 1 83394 1.19913E-5 41697 0 8.24035E-6
4-7811413-T-C p.Ile328Val missense AFAP1 1 83396 1.1991E-5 41698 0 NA
4-7811416-T-G p.Ile327Leu missense AFAP1 1 83400 1.19904E-5 41700 0 NA
4-7811425-T-C p.Ile324Val missense AFAP1 1 83398 1.19907E-5 41699 0 1.59156E-5
4-7811439-A-T p.Val319Asp missense AFAP1 1 83406 1.19895E-5 41703 0 NA
4-7811444-C-T p.Ser317Ser synonymous AFAP1 6 83410 7.19338E-5 41705 0 2.47166E-5
4-7811446-A-G p.Ser317Pro missense AFAP1 1 83408 1.19893E-5 41704 0 8.23859E-6
4-7811466-G-A p.Ser310Leu missense AFAP1 76 83400 9.11271E-4 41700 0 0.0020141
4-7811469-T-A p.Lys309Ile missense AFAP1 1 83392 1.19916E-5 41696 0 NA
4-7811483-C-T p.Arg304Arg synonymous AFAP1 4 83368 4.798E-5 41684 0 NA
4-7811495-CAA-C c.905-7_905-6delTT splice_region AFAP1 1 83338 1.19993E-5 41669 0 NA
4-7817748-G-A p.Gln301* stop_gained AFAP1 1 82960 1.2054E-5 41480 0 3.99278E-6
4-7817755-T-G p.Gly298Gly synonymous AFAP1 2 83042 2.40842E-5 41521 0 3.9875E-6
4-7817758-A-G p.Asn297Asn synonymous AFAP1 1 83050 1.20409E-5 41525 0 3.9861E-6
4-7817764-T-A p.Thr295Thr synonymous AFAP1 1 83084 1.2036E-5 41542 0 NA
4-7817764-T-G p.Thr295Thr synonymous AFAP1 2 83084 2.4072E-5 41542 0 3.98378E-6
4-7817784-C-T p.Val289Met missense AFAP1 1 83144 1.20273E-5 41572 0 NA
4-7817786-A-G p.Val288Ala missense AFAP1 6 83144 7.2164E-5 41572 0 5.04541E-4
4-7817794-C-G p.Gly285Gly synonymous AFAP1 1 83132 1.20291E-5 41566 0 NA
4-7817800-T-C p.Ser283Ser synonymous AFAP1 1 83116 1.20314E-5 41558 0 NA
4-7817807-G-C p.Pro281Arg missense AFAP1 2 83086 2.40714E-5 41543 0 2.47419E-5
4-7817819-GAC-G p.Ser277fs frameshift AFAP1 1 83020 1.20453E-5 41510 0 NA
4-7817823-G-A p.Leu276Leu synonymous AFAP1 214 82938 0.00258024 41469 2 0.006875
4-7820795-G-A c.822+8C>T splice_region AFAP1 15307 82310 0.185968 41155 1607 0.195489
4-7820796-C-G c.822+7G>C splice_region AFAP1 5 82996 6.02439E-5 41498 0 8.43441E-6
4-7820802-C-T c.822+1G>A splice_donor AFAP1 1 83106 1.20328E-5 41553 0 8.4028E-6
4-7820808-C-T p.Glu273Lys missense AFAP1 1 83156 1.20256E-5 41578 0 NA
4-7820823-G-A p.His268Tyr missense AFAP1 2 83270 2.40183E-5 41635 0 8.31794E-6
4-7820827-C-T p.Pro266Pro synonymous AFAP1 14 83288 1.68091E-4 41644 0 0.00303951
4-7820828-G-A p.Pro266Leu missense AFAP1 6 83286 7.20409E-5 41643 0 9.55536E-5
4-7820835-T-A p.Ser264Cys missense AFAP1 1 83322 1.20016E-5 41661 0 NA
4-7820836-T-C p.Pro263Pro synonymous AFAP1 6 83316 7.2015E-5 41658 0 4.78107E-5
4-7820843-G-T p.Pro261His missense AFAP1 1 83326 1.20011E-5 41663 0 NA
4-7820851-C-T p.Glu258Glu synonymous AFAP1 1 83328 1.20008E-5 41664 0 NA
4-7820863-G-A p.Pro254Pro synonymous AFAP1 3 83328 3.60023E-5 41664 0 5.04032E-4
4-7820865-G-A p.Pro254Ser missense AFAP1 1 83320 1.20019E-5 41660 0 8.29724E-6
4-7820873-C-T p.Cys251Tyr missense AFAP1 1 83298 1.20051E-5 41649 0 3.18431E-5
4-7820877-C-T p.Gly250Ser missense AFAP1 1 83294 1.20057E-5 41647 0 9.55171E-5
4-7820886-C-T p.Ala247Thr missense AFAP1 1 83260 1.20106E-5 41630 0 NA
4-7820897-A-G p.Val243Ala missense+splice_region AFAP1 1 83202 1.20189E-5 41601 0 2.53054E-5
4-7820902-T-C c.727-4A>G splice_region AFAP1 1 83110 1.20322E-5 41555 0 8.4641E-6
4-7840245-A-C c.726+6T>G splice_region AFAP1 4 83032 4.81742E-5 41516 0 NA
4-7840251-C-T p.Lys242Lys splice_region+synonymous AFAP1 2 83144 2.40547E-5 41572 0 4.80469E-5
4-7840261-T-C p.Gln239Arg missense AFAP1 1 83234 1.20143E-5 41617 0 NA
4-7840263-C-T p.Glu238Glu synonymous AFAP1 10 83242 1.20132E-4 41621 0 6.25E-4
4-7840263-C-G p.Glu238Asp missense AFAP1 3 83242 3.60395E-5 41621 0 4.12691E-5
4-7840265-C-T p.Glu238Lys missense AFAP1 1 83252 1.20117E-5 41626 0 1.65033E-5
4-7840266-G-A p.Ala237Ala synonymous AFAP1 6 83246 7.20755E-5 41623 0 6.59979E-5
4-7840271-G-C p.Gln236Glu missense AFAP1 1 83262 1.20103E-5 41631 0 3.98343E-6
4-7840279-C-T p.Ser233Asn missense AFAP1 1 83274 1.20085E-5 41637 0 3.18431E-5
4-7840286-C-T p.Val231Ile missense AFAP1 4 83290 4.8025E-5 41645 0 6.36902E-5
4-7840286-C-G p.Val231Leu missense AFAP1 1 83290 1.20062E-5 41645 0 3.97924E-6
4-7840287-G-A p.Ala230Ala synonymous AFAP1 3 83288 3.60196E-5 41644 0 3.1841E-5
4-7840289-C-T p.Ala230Thr missense AFAP1 1 83296 1.20054E-5 41648 0 8.24049E-6
4-7840290-G-A p.Leu229Leu synonymous AFAP1 2 83314 2.40056E-5 41657 0 1.98924E-5
4-7840299-C-T p.Pro226Pro synonymous AFAP1 1 83340 1.1999E-5 41670 0 7.9564E-6
4-7840300-G-A p.Pro226Leu missense AFAP1 3 83342 3.59963E-5 41671 0 NA
4-7840306-G-A p.Thr224Met missense AFAP1 1 83344 1.19985E-5 41672 0 1.98866E-5
4-7840312-T-C p.Gln222Arg missense AFAP1 1 83354 1.1997E-5 41677 0 1.6475E-5
4-7840332-G-A p.His215His synonymous AFAP1 125 83368 0.00149938 41684 1 0.00251528
4-7840334-GCTT-G p.Lys214del conservative_inframe_deletion AFAP1 1 83378 1.19936E-5 41689 0 3.29473E-5
4-7840336-T-G p.Lys214Thr missense AFAP1 1 83380 1.19933E-5 41690 0 5.04541E-4
4-7840345-T-C p.Lys211Arg missense AFAP1 3 83374 3.59824E-5 41687 0 3.29473E-5
4-7840349-T-C p.Ser210Gly missense AFAP1 1 83372 1.19944E-5 41686 0 3.97693E-6
4-7840358-G-C p.Pro207Ala missense AFAP1 1 83354 1.1997E-5 41677 0 NA
4-7840361-T-G p.Ile206Leu missense AFAP1 1 83356 1.19967E-5 41678 0 3.18512E-5
4-7840362-G-A p.Tyr205Tyr synonymous AFAP1 1 83352 1.19973E-5 41676 0 3.29484E-5
4-7840366-G-A p.Thr204Met missense AFAP1 2 83346 2.39964E-5 41673 0 3.29478E-5
4-7840373-T-G p.Asn202His missense AFAP1 1 83336 1.19996E-5 41668 0 NA
4-7840378-C-A p.Gly200Val missense AFAP1 1 83322 1.20016E-5 41661 0 1.6475E-5
4-7840386-T-C p.Pro197Pro synonymous AFAP1 1 83318 1.20022E-5 41659 0 8.2375E-6
4-7840410-G-A p.Asp189Asp synonymous AFAP1 2 83208 2.40361E-5 41604 0 NA
4-7840417-G-A p.Ser187Phe missense AFAP1 1 83174 1.2023E-5 41587 0 NA
4-7840438-C-T c.547-8G>A splice_region AFAP1 68 82994 8.19336E-4 41497 0 0.00326515
4-7844859-G-C c.546+7C>G splice_region AFAP1 1 82908 1.20616E-5 41454 0 NA
4-7844890-G-A p.Cys174Cys synonymous AFAP1 810 83314 0.00972226 41657 6 0.0168961
4-7844896-C-T p.Leu172Leu synonymous AFAP1 1 83338 1.19993E-5 41669 0 NA
4-7844903-G-C p.Thr170Ser missense AFAP1 5 83360 5.99808E-5 41680 0 NA
4-7844913-C-T p.Gly167Ser missense AFAP1 2 83384 2.39854E-5 41692 0 3.18573E-5
4-7844914-G-A p.Phe166Phe synonymous AFAP1 25 83382 2.99825E-4 41691 0 5.73468E-4
4-7844923-C-T p.Lys163Lys synonymous AFAP1 2 83388 2.39843E-5 41694 0 NA
4-7844927-C-T p.Arg162Gln missense AFAP1 1 83388 1.19921E-5 41694 0 3.18532E-5
4-7844929-C-T p.Leu161Leu synonymous AFAP1 2 83394 2.39825E-5 41697 0 NA
4-7844937-A-C p.Phe159Val missense AFAP1 1 83386 1.19924E-5 41693 0 NA
4-7844938-G-T p.Ala158Ala synonymous AFAP1 1 83386 1.19924E-5 41693 0 1.64802E-5
4-7844941-G-A p.Cys157Cys synonymous AFAP1 2 83380 2.39866E-5 41690 0 6.59261E-5
4-7844953-G-A p.Asp153Asp synonymous AFAP1 5520 83316 0.0662538 41658 220 0.0770393
4-7844972-G-A p.Ser147Phe missense AFAP1 1 83372 1.19944E-5 41686 0 NA
4-7844983-G-A p.Ser143Ser synonymous AFAP1 17 83374 2.039E-4 41687 0 9.14702E-5
4-7844999-C-T p.Arg138Gln missense AFAP1 4 83380 4.79731E-5 41690 0 3.57947E-5
4-7845000-G-A p.Arg138Trp missense AFAP1 3 83382 3.5979E-5 41691 0 1.03418E-4
4-7845000-G-C p.Arg138Gly missense AFAP1 3 83382 3.5979E-5 41691 0 8.29366E-6
4-7845001-G-T p.Thr137Thr synonymous AFAP1 1 83382 1.1993E-5 41691 0 NA
4-7845011-C-G p.Gly134Ala missense AFAP1 22 83368 2.6389E-4 41684 0 5.09944E-4
4-7845021-C-G p.Asp131His missense AFAP1 1 83356 1.19967E-5 41678 0 8.34655E-6
4-7845023-T-A p.Glu130Val missense AFAP1 1 83354 1.1997E-5 41677 0 NA
4-7845028-C-G p.Glu128Asp missense AFAP1 1 83360 1.19962E-5 41680 0 3.18281E-5
4-7845028-C-T p.Glu128Glu synonymous AFAP1 1 83360 1.19962E-5 41680 0 1.67543E-5
4-7845037-A-G p.Tyr125Tyr synonymous AFAP1 1 83348 1.19979E-5 41674 0 6.3743E-5
4-7845040-C-A p.Ser124Ser synonymous AFAP1 3 83346 3.59945E-5 41673 0 3.18776E-5
4-7845040-C-T p.Ser124Ser synonymous AFAP1 2 83346 2.39964E-5 41673 0 1.59234E-5
4-7845062-G-A p.Ala117Val missense AFAP1 3 83296 3.60161E-5 41648 0 9.36786E-5
4-7845067-G-A p.Ser115Ser synonymous AFAP1 7586 82960 0.0914417 41480 341 0.140517
4-7845077-T-TTTGATGTGATGTATTCCGGAG c.335-1_335insCTCCGGAATACATCACATCAA splice_acceptor AFAP1 2 83200 2.40385E-5 41600 1 NA
4-7845077-T-TTTGATGTGATGTATTCCGGAGCTTTTCCGGGG c.335-1_335insCCCCGGAAAAGCTCCGGAATACATCACATCAA splice_acceptor AFAP1 2 83200 2.40385E-5 41600 1 NA
4-7845080-G-A c.335-3C>T splice_region AFAP1 1 83166 1.20241E-5 41583 0 2.17134E-4
4-7857203-G-A p.Tyr108Tyr synonymous AFAP1 1 82952 1.20552E-5 41476 0 3.1839E-5
4-7857204-T-C p.Tyr108Cys missense AFAP1 1 82966 1.20531E-5 41483 0 NA
4-7857209-C-T p.Pro106Pro synonymous AFAP1 2 83048 2.40825E-5 41524 0 4.42959E-5
4-7857210-G-A p.Pro106Leu missense AFAP1 5 83058 6.01989E-5 41529 0 1.59266E-4
4-7857212-A-C p.Ala105Ala synonymous AFAP1 2 83080 2.40732E-5 41540 0 3.18654E-5
4-7857218-T-C p.Gly103Gly synonymous AFAP1 1 83114 1.20317E-5 41557 0 NA
4-7857221-G-A p.Pro102Pro synonymous AFAP1 3 83120 3.60924E-5 41560 0 2.79984E-5
4-7857224-GC-G p.Ser101fs frameshift AFAP1 1 83140 1.20279E-5 41570 0 NA
4-7857230-C-T p.Pro99Pro synonymous AFAP1 28997 81434 0.35608 40717 5506 0.359879
4-7857231-G-C p.Pro99Arg missense AFAP1 1 83158 1.20253E-5 41579 0 8.29862E-6
4-7857231-G-A p.Pro99Leu missense AFAP1 1 83158 1.20253E-5 41579 0 8.29862E-6
4-7857232-G-A p.Pro99Ser missense AFAP1 1 83162 1.20247E-5 41581 0 3.18613E-5
4-7857239-T-C p.Glu96Glu synonymous AFAP1 1 83174 1.2023E-5 41587 0 6.37024E-5
4-7857241-C-T p.Glu96Lys missense AFAP1 1 83196 1.20198E-5 41598 0 8.26446E-6
4-7857244-C-G p.Glu95Gln missense AFAP1 18 83208 2.16325E-4 41604 0 1.03519E-4
4-7857253-C-T p.Gly92Ser missense AFAP1 1 83200 1.20192E-5 41600 0 1.19404E-5
4-7857253-C-A p.Gly92Cys missense AFAP1 1 83200 1.20192E-5 41600 0 NA
4-7857253-C-G p.Gly92Arg missense AFAP1 1 83200 1.20192E-5 41600 0 5.04032E-4
4-7857255-T-C p.Glu91Gly missense AFAP1 1 83188 1.2021E-5 41594 0 NA
4-7857259-G-A p.Pro90Ser missense AFAP1 1 83198 1.20195E-5 41599 0 1.98938E-5
4-7857266-G-A p.Ser87Ser synonymous AFAP1 1 83198 1.20195E-5 41599 0 4.77464E-5
4-7857274-G-C p.Pro85Ala missense AFAP1 6 83174 7.21379E-5 41587 0 1.98935E-5
4-7857285-G-A p.Pro81Leu missense AFAP1 3 83134 3.60863E-5 41567 0 NA
4-7857292-T-G p.Ser79Arg missense AFAP1 1 83130 1.20294E-5 41565 0 3.97902E-6
4-7857293-G-C p.Asp78Glu missense AFAP1 80 83124 9.62418E-4 41562 1 0.00157179
4-7857293-G-A p.Asp78Asp synonymous AFAP1 3 83124 3.60907E-5 41562 0 2.38753E-5
4-7857298-G-A p.Pro77Ser missense AFAP1 1 83092 1.20349E-5 41546 0 NA
4-7857299-A-G p.Pro76Pro splice_region+synonymous AFAP1 1 83086 1.20357E-5 41543 0 NA
4-7870358-C-G p.Gln72His missense AFAP1 3 82274 3.64635E-5 41137 0 1.59317E-4
4-7870362-G-T p.Pro71His missense AFAP1 1 82350 1.21433E-5 41175 0 8.44523E-6
4-7870370-C-T p.Pro68Pro synonymous AFAP1 5 82356 6.0712E-5 41178 0 9.5584E-5
4-7870371-G-A p.Pro68Leu missense AFAP1 3 82376 3.64184E-5 41188 0 1.68404E-5
4-7870398-A-AGGC p.Ser58_Leu59insArg conservative_inframe_insertion AFAP1 2 82626 2.42055E-5 41313 0 3.18532E-5
4-7870402-T-C p.Ser58Gly missense AFAP1 2 82624 2.4206E-5 41312 0 3.35514E-5
4-7870408-C-T p.Ala56Thr missense AFAP1 3 82652 3.62968E-5 41326 0 2.51733E-5
4-7870409-G-A p.Thr55Thr synonymous AFAP1 5 82660 6.04888E-5 41330 0 1.59297E-4
4-7870419-T-C p.Lys52Arg missense AFAP1 1 82712 1.20901E-5 41356 0 NA
4-7870426-C-T p.Ala50Thr missense AFAP1 1 82728 1.20878E-5 41364 0 NA
4-7870430-G-C p.Asp48Glu missense AFAP1 3 82772 3.62441E-5 41386 0 1.19915E-5
4-7870434-T-C p.Lys47Arg missense AFAP1 1 82806 1.20764E-5 41403 0 8.44495E-6
4-7870439-A-C p.Asp45Glu missense AFAP1 3 82832 3.62179E-5 41416 0 9.55353E-5
4-7870445-A-G p.Gly43Gly splice_region+synonymous AFAP1 2 82834 2.41447E-5 41417 0 NA
4-7870448-T-C c.128-2A>G splice_acceptor AFAP1 3 82810 3.62275E-5 41405 0 4.00548E-6
4-7873695-T-C p.Arg37Arg synonymous AFAP1 297 83224 0.00356868 41612 3 0.00480708
4-7873700-G-A p.Leu36Leu synonymous AFAP1 2 83240 2.40269E-5 41620 0 NA
4-7873703-G-T p.Leu35Met missense AFAP1 1 83240 1.20135E-5 41620 0 5.03525E-4
4-7873718-C-T p.Val30Met missense AFAP1 1 83234 1.20143E-5 41617 0 3.97725E-6
4-7873718-C-A p.Val30Leu missense AFAP1 1 83234 1.20143E-5 41617 0 NA
4-7873732-C-A p.Arg25Met missense AFAP1 1 83230 1.20149E-5 41615 0 NA
4-7873740-T-G p.Ser22Ser synonymous AFAP1 2 83226 2.4031E-5 41613 0 NA
4-7873750-T-C p.Tyr19Cys missense AFAP1 2 83220 2.40327E-5 41610 0 9.55171E-5
4-7873752-T-C p.Glu18Glu synonymous AFAP1 2 83216 2.40338E-5 41608 0 5.76587E-5
4-7873758-G-T p.Asp16Glu missense AFAP1 1 83210 1.20178E-5 41605 0 NA
4-7873777-A-C p.Leu10Arg missense AFAP1 1 83204 1.20187E-5 41602 0 3.18492E-5
4-7873780-C-T p.Arg9His missense AFAP1 1 83196 1.20198E-5 41598 0 5.57227E-5
4-7873781-G-A p.Arg9Cys missense AFAP1 1 83196 1.20198E-5 41598 0 1.6478E-5
4-7873799-C-A p.Glu3* stop_gained AFAP1 1 83168 1.20239E-5 41584 0 NA
4-7873799-C-G p.Glu3Gln missense AFAP1 2 83168 2.40477E-5 41584 0 8.24321E-6
4-7873809-T-TCAGGCCGCCACCTCGCAGCGCTCGCTCCTCGCCGCGGC c.-2-3_-2-2insGCCGCGGCGAGGAGCGAGCGCTGCGAGGTGGCGGCCTG splice_region AFAP1 2 83134 2.40575E-5 41567 1 NA
4-7873809-T-TCAGGCCGCCACCTCGCAGCGCTCGCTCCTCGCCGCG c.-2-3_-2-2insCGCGGCGAGGAGCGAGCGCTGCGAGGTGGCGGCCTG splice_region AFAP1 2 83134 2.40575E-5 41567 1 NA
4-7873809-T-C c.-2-2A>G splice_acceptor AFAP1 1 83134 1.20288E-5 41567 0 NA
4-7873820-G-C c.-15C>G 5_prime_UTR_premature_start_codon_gain AFAP1 1 83106 1.20328E-5 41553 0 NA
4-7873863-T-C c.-58A>G 5_prime_UTR_premature_start_codon_gain AFAP1 4 82692 4.83723E-5 41346 0 NA
4-7873884-G-A c.-79C>T 5_prime_UTR_premature_start_codon_gain AFAP1 1 81676 1.22435E-5 40838 0 NA
4-7873920-T-C c.-115A>G 5_prime_UTR_premature_start_codon_gain AFAP1 1 77218 1.29503E-5 38609 0 NA
4-7873975-G-A c.-170C>T 5_prime_UTR_premature_start_codon_gain AFAP1 6 64050 9.36768E-5 32025 0 3.18431E-5
4-7941376-G-T c.-3+7C>A splice_region AFAP1 2 29686 6.73718E-5 14843 0 NA
4-7941380-C-T c.-3+3G>A splice_region AFAP1 2 29380 6.80735E-5 14690 0 7.90109E-4
4-7941384-T-G c.-4A>C splice_region AFAP1 1 28782 3.47439E-5 14391 0 NA
4-7941385-C-G c.-5G>C splice_region AFAP1 1 28808 3.47126E-5 14404 0 3.21089E-5
4-7941432-G-A c.-52C>T 5_prime_UTR_premature_start_codon_gain AFAP1 3 25252 1.18802E-4 12626 0 NA
4-7941452-G-A c.-72C>T 5_prime_UTR_premature_start_codon_gain AFAP1 2 24520 8.15661E-5 12260 0 2.25821E-4
4-7941511-C-A c.-131G>T 5_prime_UTR_premature_start_codon_gain AFAP1 2 22256 8.98634E-5 11128 0 6.46454E-5
4-7941527-C-A c.-147G>T 5_prime_UTR_premature_start_codon_gain AFAP1 1 21002 4.76145E-5 10501 0 6.83667E-5
4-7941552-G-C c.-172C>G 5_prime_UTR_premature_start_codon_gain AFAP1 1 19436 5.14509E-5 9718 0 2.28221E-4
4-7941562-C-A c.-182G>T 5_prime_UTR_premature_start_codon_gain AFAP1 1 18710 5.34474E-5 9355 0 6.53937E-5
4-7941580-G-A c.-200C>T 5_prime_UTR_premature_start_codon_gain AFAP1 1 17630 5.67215E-5 8815 0 0.0013624
4-7941590-C-T c.-210G>A 5_prime_UTR_premature_start_codon_gain AFAP1 2 16224 1.23274E-4 8112 0 NA