Variant

Variant ID Consequence Effect Gene AC AN AF NS NHOM maxEAF
7-44143985-C-T c.-280C>T 5_prime_UTR_premature_start_codon_gain AEBP1 1 2806 3.56379E-4 1403 0 3.24612E-5
7-44143988-G-T c.-277G>T 5_prime_UTR_premature_start_codon_gain AEBP1 1 3078 3.24886E-4 1539 0 NA
7-44144150-C-G c.-115C>G 5_prime_UTR_premature_start_codon_gain AEBP1 1 32114 3.11391E-5 16057 0 NA
7-44144201-C-G c.-64C>G 5_prime_UTR_premature_start_codon_gain AEBP1 7083 35518 0.19942 17759 309 0.193492
7-44144204-A-T c.-61A>T 5_prime_UTR_premature_start_codon_gain AEBP1 1 37690 2.65322E-5 18845 0 NA
7-44144261-G-T c.-4G>T 5_prime_UTR_premature_start_codon_gain AEBP1 2 42982 4.65311E-5 21491 0 3.33541E-5
7-44144284-C-A p.Ala7Glu missense AEBP1 839 46006 0.0182368 23003 11 0.0598824
7-44144285-G-A p.Ala7Ala synonymous AEBP1 33 46386 7.11422E-4 23193 0 0.00696777
7-44144285-G-T p.Ala7Ala synonymous AEBP1 1 46386 2.15582E-5 23193 0 NA
7-44144291-G-A p.Leu9Leu synonymous AEBP1 2 48290 4.14164E-5 24145 0 2.67566E-5
7-44144301-C-T p.Leu13Phe missense AEBP1 13 50956 2.55122E-4 25478 0 5.06586E-4
7-44144336-C-T p.Arg24Arg synonymous AEBP1 1 59704 1.67493E-5 29852 0 NA
7-44144344-C-A p.Thr27Lys missense AEBP1 4 61934 6.45849E-5 30967 0 NA
7-44144345-G-T p.Thr27Thr synonymous AEBP1 1 62238 1.60674E-5 31119 0 NA
7-44144361-G-A p.Glu33Lys missense AEBP1 1 64828 1.54254E-5 32414 0 NA
7-44144363-G-A p.Glu33Glu synonymous AEBP1 1 65124 1.53553E-5 32562 0 1.0134E-5
7-44144366-C-T p.Ile34Ile synonymous AEBP1 1 65196 1.53384E-5 32598 0 2.04964E-5
7-44144374-T-G p.Phe37Cys missense AEBP1 1 65768 1.5205E-5 32884 0 4.14938E-6
7-44144396-G-A p.Glu44Glu synonymous AEBP1 1 66708 1.49907E-5 33354 0 1.22468E-5
7-44144398-T-C p.Leu45Pro missense AEBP1 2 66722 2.99751E-5 33361 0 NA
7-44144407-A-G p.Glu48Gly missense AEBP1 21 66044 3.1797E-4 33022 0 2.35862E-4
7-44144409-C-G p.Pro49Ala missense AEBP1 1 65888 1.51773E-5 32944 0 NA
7-44144410-C-CCCG p.Arg50dup disruptive_inframe_insertion AEBP1 1 66002 1.51511E-5 33001 0 1.44797E-5
7-44144415-G-C p.Glu51Gln missense AEBP1 1 65522 1.5262E-5 32761 0 NA
7-44144445-G-A p.Glu61Lys missense AEBP1 3 60008 4.99933E-5 30004 0 0.00305499
7-44144458-G-A p.Arg65Gln missense AEBP1 14 57838 2.42055E-4 28919 0 NA
7-44144465-A-G p.Arg67Arg synonymous AEBP1 1 56262 1.7774E-5 28131 0 8.84095E-5
7-44144477-G-C p.Ala71Ala synonymous AEBP1 1 53984 1.8524E-5 26992 0 1.92441E-5
7-44144477-G-T p.Ala71Ala synonymous AEBP1 2 53984 3.7048E-5 26992 0 8.33911E-5
7-44144478-G-C p.Gly72Arg missense AEBP1 1 53870 1.85632E-5 26935 0 5.54201E-5
7-44144479-G-A p.Gly72Glu missense AEBP1 1 53638 1.86435E-5 26819 0 NA
7-44144506-C-T p.Thr81Met missense AEBP1 1 47052 2.12531E-5 23526 0 NA
7-44144510-C-A p.Ala82Ala synonymous AEBP1 1 46152 2.16675E-5 23076 0 3.18918E-5
7-44144517-G-GTGCCTCCGGAAAAGACCAAAGACAAAGGGAA c.253_253+1insTGCCTCCGGAAAAGACCAAAGACAAAGGGAA splice_donor AEBP1 2 45814 4.36548E-5 22907 1 NA
7-44144524-G-A c.253+7G>A splice_region AEBP1 2 44696 4.47467E-5 22348 0 NA
7-44145833-G-A c.-6G>A 5_prime_UTR_premature_start_codon_gain AEBP1 2 52298 3.82424E-5 26149 0 3.82239E-4
7-44146140-G-A c.254-5G>A splice_region AEBP1 1 82648 1.20995E-5 41324 0 4.03861E-5
7-44146147-C-A p.Pro86Thr missense+splice_region AEBP1 4 82734 4.83477E-5 41367 0 4.58985E-6
7-44146151-C-T p.Pro87Leu missense AEBP1 34 82758 4.10836E-4 41379 0 9.8953E-4
7-44146158-G-C p.Lys89Asn missense AEBP1 13 82874 1.56865E-4 41437 0 6.40777E-4
7-44146167-C-T p.Asp92Asp synonymous AEBP1 2 82932 2.41161E-5 41466 0 NA
7-44146179-A-G p.Lys96Lys synonymous AEBP1 1 83018 1.20456E-5 41509 0 NA
7-44146181-G-A p.Gly97Asp missense AEBP1 1 83004 1.20476E-5 41502 0 NA
7-44146202-A-G p.Lys104Arg missense AEBP1 2 83088 2.40709E-5 41544 0 5.24956E-5
7-44146211-A-G p.Lys107Arg missense AEBP1 2 83082 2.40726E-5 41541 0 3.18959E-5
7-44146222-G-A p.Glu111Lys missense AEBP1 2 83048 2.40825E-5 41524 0 NA
7-44146226-G-A p.Gly112Glu missense AEBP1 1 83042 1.20421E-5 41521 0 6.39918E-5
7-44146227-G-A p.Gly112Gly synonymous AEBP1 2 83042 2.40842E-5 41521 0 2.87797E-4
7-44146228-T-A p.Ser113Thr missense AEBP1 1 83022 1.2045E-5 41511 0 1.36818E-4
7-44146231-C-T p.Pro114Ser missense AEBP1 1 83056 1.20401E-5 41528 0 8.10517E-6
7-44146238-C-T p.Pro116Leu missense AEBP1 10 83034 1.20433E-4 41517 0 1.27714E-4
7-44146239-G-A p.Pro116Pro synonymous AEBP1 25 83034 3.01081E-4 41517 0 0.00100705
7-44146258-A-C p.Lys123Gln missense AEBP1 1 83004 1.20476E-5 41502 0 9.23361E-6
7-44146265-C-A p.Pro125His missense AEBP1 1 82982 1.20508E-5 41491 0 NA
7-44146274-C-T p.Thr128Ile missense AEBP1 1 82946 1.2056E-5 41473 0 2.71793E-5
7-44146275-C-G p.Thr128Thr synonymous AEBP1 12 82950 1.44665E-4 41475 0 6.51596E-4
7-44146281-G-A p.Lys130Lys synonymous AEBP1 2 82930 2.41167E-5 41465 0 NA
7-44146291-A-G p.Lys134Glu missense AEBP1 1 82866 1.20677E-5 41433 0 4.01813E-6
7-44146299-T-C p.Pro136Pro synonymous AEBP1 16 82830 1.93167E-4 41415 0 2.22651E-4
7-44146300-A-G p.Lys137Glu missense AEBP1 3 82858 3.62065E-5 41429 0 NA
7-44146302-G-A p.Lys137Lys synonymous AEBP1 2 82848 2.41406E-5 41424 0 1.0633E-4
7-44146320-GGAGAAGCCACCCAAGGCCACCAAGAAGCCCAAA-G p.Lys154_Pro164del conservative_inframe_deletion AEBP1 1 82840 1.20715E-5 41420 0 1.6056E-5
7-44146325-A-C p.Lys145Thr missense AEBP1 1 82820 1.20744E-5 41410 0 4.0141E-6
7-44146334-A-C p.Lys148Thr missense AEBP1 3 82804 3.62301E-5 41402 0 NA
7-44146353-A-G p.Lys154Lys synonymous AEBP1 2 82724 2.41768E-5 41362 0 2.42039E-5
7-44146356-G-A p.Glu155Glu synonymous AEBP1 44 82690 5.32108E-4 41345 1 9.62336E-4
7-44146359-G-A p.Lys156Lys synonymous AEBP1 2 82644 2.42002E-5 41322 0 NA
7-44146385-C-T p.Pro165Leu missense AEBP1 5 82440 6.06502E-5 41220 0 6.25E-4
7-44146386-G-A p.Pro165Pro synonymous AEBP1 18 82402 2.18441E-4 41201 0 1.85805E-4
7-44146398-G-A p.Arg169Arg synonymous AEBP1 15 82160 1.82571E-4 41080 0 6.50266E-5
7-44146400-C-T p.Pro170Leu missense AEBP1 2 82170 2.43398E-5 41085 0 2.18972E-5
7-44146408-C-G p.Leu173Val missense AEBP1 1 81926 1.22061E-5 40963 0 NA
7-44146430-A-G p.Glu180Gly missense AEBP1 1 81182 1.2318E-5 40591 0 NA
7-44146447-C-T p.Pro186Ser missense AEBP1 3 80514 3.72606E-5 40257 0 NA
7-44146448-C-A p.Pro186His missense AEBP1 23 80534 2.85594E-4 40267 0 4.14726E-4
7-44146451-C-G p.Pro187Arg missense AEBP1 122 80484 0.00151583 40242 0 0.00507947
7-44146452-C-T p.Pro187Pro synonymous AEBP1 1 80478 1.24258E-5 40239 0 NA
7-44146464-C-T p.Pro191Pro synonymous AEBP1 2 79900 2.50313E-5 39950 0 3.87687E-5
7-44146465-G-A p.Glu192Lys missense AEBP1 13 79838 1.6283E-4 39919 0 6.69728E-4
7-44146478-A-C p.Gln196Pro missense AEBP1 4 79220 5.04923E-5 39610 0 0.00304878
7-44146486-G-A p.Gly199Arg missense+splice_region AEBP1 3 78864 3.80402E-5 39432 0 1.2442E-5
7-44146487-G-GGGCGCCCCTCTCAAATAAC c.595+1_595+2insGGCGCCCCTCTCAAATAAC splice_donor AEBP1 1 78804 1.26897E-5 39402 0 NA
7-44146492-T-C c.595+6T>C splice_region AEBP1 1 78482 1.27418E-5 39241 0 3.18654E-5
7-44146494-C-A c.595+8C>A splice_region AEBP1 1 78282 1.27743E-5 39141 0 NA
7-44147041-C-T p.Ala200Val missense AEBP1 353 81904 0.00430992 40952 1 0.00515974
7-44147042-G-A p.Ala200Ala synonymous AEBP1 3 81954 3.66059E-5 40977 0 3.18796E-5
7-44147046-C-G p.Leu202Val missense AEBP1 2 82102 2.43599E-5 41051 0 1.67518E-5
7-44147066-T-G p.Asn208Lys missense AEBP1 1 82434 1.21309E-5 41217 0 2.50555E-5
7-44147069-A-T p.Pro209Pro synonymous AEBP1 1 82498 1.21215E-5 41249 0 6.37918E-5
7-44147093-A-T p.Ala217Ala synonymous AEBP1 14 82586 1.6952E-4 41293 0 6.7918E-5
7-44147094-C-T p.Arg218Trp missense AEBP1 1 82580 1.21095E-5 41290 0 2.5038E-5
7-44147095-G-A p.Arg218Gln missense AEBP1 2 82590 2.4216E-5 41295 0 3.19E-5
7-44147108-TGGTGAGTGGCCGTCATCCGCCTGGCCTTGGGGCCAGCTGCCCTGGCTGGTTGGACTGAGGGCTTCCCCAGAGTAGGCCTGGGTGGGGTTGTCAGGCAGCTACCAGCGCTTTCCCCTCA-T p.Glu223fs frameshift AEBP1 4 82616 4.84168E-5 41308 0 NA
7-44147109-G-A p.Glu223Lys missense+splice_region AEBP1 1 82624 1.2103E-5 41312 0 8.34683E-6
7-44147224-T-G c.668-4T>G splice_region AEBP1 24 82890 2.8954E-4 41445 0 7.35482E-4
7-44147230-C-G p.Pro224Ala missense+splice_region AEBP1 1 82888 1.20645E-5 41444 0 3.19693E-5
7-44147231-CGGA-C p.Glu227del conservative_inframe_deletion AEBP1 1 82894 1.20636E-5 41447 0 NA
7-44147231-C-G p.Pro224Arg missense AEBP1 1 82894 1.20636E-5 41447 0 3.1886E-5
7-44147232-G-A p.Pro224Pro synonymous AEBP1 2 82910 2.41225E-5 41455 0 1.66121E-5
7-44147238-G-C p.Glu226Asp missense AEBP1 1 82938 1.20572E-5 41469 0 1.66074E-5
7-44147244-C-T p.Thr228Thr synonymous AEBP1 9 82930 1.08525E-4 41465 0 2.55836E-4
7-44147259-G-A p.Leu233Leu synonymous AEBP1 1 82944 1.20563E-5 41472 0 NA
7-44147260-G-T p.Asp234Tyr missense AEBP1 1 82940 1.20569E-5 41470 0 4.98206E-5
7-44147267-A-G p.Asn236Ser missense AEBP1 2 82958 2.41086E-5 41479 0 9.13394E-5
7-44147271-C-A p.Asp237Glu missense AEBP1 5 82958 6.02715E-5 41479 0 3.19407E-5
7-44147272-C-A p.Gln238Lys missense AEBP1 1 82968 1.20528E-5 41484 0 1.66107E-5
7-44147278-G-A p.Glu240Lys missense AEBP1 6 82946 7.23362E-5 41473 0 8.3073E-6
7-44147280-G-C p.Glu240Asp missense AEBP1 1 82970 1.20525E-5 41485 0 8.30786E-6
7-44147282-G-A p.Arg241Lys missense AEBP1 2 82974 2.41039E-5 41487 0 5.03525E-4
7-44147283-G-C p.Arg241Ser missense AEBP1 4 82964 4.82137E-5 41482 0 1.19609E-5
7-44147293-G-A p.Glu245Lys missense AEBP1 5 82946 6.02802E-5 41473 0 1.99473E-4
7-44147299-TGTGAGTAGGGTCCTGCCAGCCCCACCTGGGTCGGACCCCTGGCCTGGGGGATGTGCCAATGGGCCCATCCCAGCCTTGGGCCCCACTCTGAGCCAGCCTCCCCCTCAG-T c.739+1_740-1del splice_acceptor AEBP1 4 82920 4.82393E-5 41460 0 NA
7-44147299-T-C p.Phe247Leu missense+splice_region AEBP1 20 82920 2.41196E-4 41460 0 1.91963E-4
7-44147403-C-G c.740-5C>G splice_region AEBP1 1 82412 1.21342E-5 41206 0 NA
7-44147419-C-T p.Arg251Trp missense AEBP1 4 82248 4.86334E-5 41124 0 5.04032E-4
7-44147420-G-A p.Arg251Gln missense AEBP1 1 82194 1.21663E-5 41097 0 5.35877E-5
7-44147422-C-T p.Arg252Cys missense AEBP1 1 82154 1.21723E-5 41077 0 8.96105E-6
7-44147423-G-A p.Arg252His missense AEBP1 2 82118 2.43552E-5 41059 0 1.61725E-4
7-44147454-AAGG-A p.Arg265del conservative_inframe_deletion AEBP1 2 81952 2.44045E-5 40976 0 3.21481E-5
7-44147458-A-G p.Arg264Gly missense AEBP1 2 81926 2.44123E-5 40963 0 7.14125E-5
7-44147466-C-A p.Pro266Pro synonymous AEBP1 2 81774 2.44577E-5 40887 0 3.20986E-5
7-44147466-C-T p.Pro266Pro synonymous AEBP1 4 81774 4.89153E-5 40887 0 5.34257E-5
7-44147470-C-T p.Arg268Trp missense AEBP1 2 81800 2.44499E-5 40900 0 2.19993E-5
7-44147471-G-A p.Arg268Gln missense AEBP1 2 81836 2.44391E-5 40918 0 3.20945E-5
7-44147475-C-T p.Val269Val synonymous AEBP1 1 81800 1.22249E-5 40900 0 NA
7-44147485-C-A p.Pro273Thr missense AEBP1 29064 80748 0.359935 40374 5334 0.46625
7-44147485-CCC-ACT p.Pro273Thr missense AEBP1 1 81684 1.22423E-5 40842 0 NA
7-44147487-C-A p.Pro273Pro synonymous AEBP1 1 81712 1.22381E-5 40856 0 NA
7-44147490-T-A p.Pro274Pro synonymous AEBP1 1 81668 1.22447E-5 40834 0 NA
7-44147499-GGCCCCGGCCCCA-G p.Ala280_Pro283del disruptive_inframe_deletion AEBP1 1 81608 1.22537E-5 40804 0 NA
7-44147500-G-A p.Ala278Thr missense AEBP1 2 81574 2.45176E-5 40787 0 6.4082E-5
7-44147504-C-T p.Pro279Leu missense AEBP1 3 81516 3.68026E-5 40758 0 6.4191E-5
7-44147505-G-A p.Pro279Pro synonymous AEBP1 8 81516 9.81402E-5 40758 0 9.60615E-5
7-44147507-C-T p.Ala280Val missense AEBP1 1 81472 1.22742E-5 40736 0 1.62559E-5
7-44147510-C-T p.Pro281Leu missense AEBP1 1 81468 1.22748E-5 40734 0 4.79235E-6
7-44147513-C-T p.Ala282Val missense AEBP1 10 81416 1.22826E-4 40708 0 0.00146712
7-44147516-C-T p.Pro283Leu missense AEBP1 5 81394 6.14296E-5 40697 0 3.88327E-5
7-44147520-G-A p.Glu284Glu synonymous AEBP1 5 81428 6.14039E-5 40714 0 6.9718E-5
7-44147529-TGGTAGGATGGGGGGCAGGAGAGGAGGTGCCATGGCCACGGCGCTCTGGCCCCCTCCTAACCTCCCCGCCTCCCCA-T p.Glu288fs frameshift AEBP1 6 81352 7.37536E-5 40676 0 NA
7-44147608-C-T p.Pro289Ser missense+splice_region AEBP1 3 81220 3.69367E-5 40610 0 4.81501E-6
7-44147609-C-A p.Pro289His missense AEBP1 1 81296 1.23007E-5 40648 0 NA
7-44147624-T-TGCTGCCCCC p.Pro300_Asp301insLeuProPro disruptive_inframe_insertion AEBP1 3 81442 3.6836E-5 40721 0 4.5412E-6
7-44147633-C-T p.Pro297Leu missense AEBP1 6 81480 7.36377E-5 40740 0 7.81525E-5
7-44147634-G-A p.Pro297Pro synonymous AEBP1 6 81420 7.3692E-5 40710 0 3.21688E-5
7-44147636-T-C p.Leu298Pro missense AEBP1 1 81480 1.2273E-5 40740 0 NA
7-44147638-C-T p.Pro299Ser missense AEBP1 13 81502 1.59505E-4 40751 0 0.0010142
7-44147641-CCT-C p.Pro300fs frameshift AEBP1 1 81540 1.22639E-5 40770 0 4.36677E-6
7-44147649-T-C p.Tyr302Tyr synonymous AEBP1 2 81520 2.45339E-5 40760 0 5.06586E-4
7-44147659-T-TA p.Tyr306fs frameshift AEBP1 5 81580 6.12895E-5 40790 0 1.28014E-5
7-44147661-C-T p.Tyr306Tyr synonymous AEBP1 1 81560 1.22609E-5 40780 0 1.70801E-5
7-44147662-G-A p.Val307Met missense AEBP1 43 81570 5.27155E-4 40785 0 0.00151976
7-44147663-T-G p.Val307Gly missense AEBP1 1 81576 1.22585E-5 40788 0 3.34997E-5
7-44147667-C-A p.Ile308Ile synonymous AEBP1 1 81574 1.22588E-5 40787 0 NA
7-44147670-C-G p.Pro309Pro synonymous AEBP1 1 81572 1.22591E-5 40786 0 NA
7-44147676-C-T p.Tyr311Tyr synonymous AEBP1 2 81532 2.45302E-5 40766 0 3.46729E-5
7-44147677-G-A p.Asp312Asn missense AEBP1 4 81520 4.90677E-5 40760 0 3.49174E-5
7-44148495-T-C c.941-3T>C splice_region AEBP1 1 80944 1.23542E-5 40472 0 NA
7-44148496-A-G c.941-2A>G splice_acceptor AEBP1 1 80938 1.23551E-5 40469 0 NA
7-44148500-G-A p.Asp315Asn missense+splice_region AEBP1 1 81058 1.23368E-5 40529 0 5.14424E-6
7-44148503-T-A p.Tyr316Asn missense AEBP1 1 81170 1.23198E-5 40585 0 NA
7-44148516-C-A p.Pro320His missense AEBP1 1 81410 1.22835E-5 40705 0 NA
7-44148522-C-T p.Pro322Leu missense AEBP1 4 81568 4.90388E-5 40784 0 1.91253E-4
7-44148523-G-A p.Pro322Pro synonymous AEBP1 1 81546 1.2263E-5 40773 0 3.18756E-5
7-44148524-C-T p.Pro323Ser missense AEBP1 1 81600 1.22549E-5 40800 0 NA
7-44148535-C-T p.Pro326Pro synonymous AEBP1 4 81776 4.89141E-5 40888 0 8.66288E-5
7-44148536-G-A p.Asp327Asn missense AEBP1 3 81776 3.66856E-5 40888 0 0.00151515
7-44148540-C-T p.Ala328Val missense AEBP1 1 81858 1.22163E-5 40929 0 4.3892E-6
7-44148542-G-A p.Glu329Lys missense AEBP1 2 81904 2.44188E-5 40952 0 4.37748E-6
7-44148546-G-A p.Arg330His missense AEBP1 1 81884 1.22124E-5 40942 0 3.82555E-5
7-44148546-G-C p.Arg330Pro missense AEBP1 1 81884 1.22124E-5 40942 0 NA
7-44148552-C-A p.Thr332Lys missense AEBP1 1 81956 1.22017E-5 40978 0 4.31969E-6
7-44148553-A-G p.Thr332Thr synonymous AEBP1 57474 81206 0.707756 40603 20538 0.741732
7-44148557-G-A p.Glu334Lys missense AEBP1 20 81988 2.43938E-4 40994 2 2.4553E-4
7-44148559-A-T p.Glu334Asp missense AEBP1 2 82002 2.43896E-5 41001 0 NA
7-44148562-G-T p.Glu335Asp missense AEBP1 2 82028 2.43819E-5 41014 0 4.4618E-5
7-44148563-A-G p.Lys336Glu missense AEBP1 1 82030 1.21907E-5 41015 0 1.11537E-5
7-44148565-G-A p.Lys336Lys synonymous AEBP1 1 82056 1.21868E-5 41028 0 NA
7-44148572-CTGAG-C p.Leu339_Lys340delinsGln splice_donor AEBP1 547 82008 0.00667008 41004 2 0.00672574
7-44148573-T-TGAAGAAACCCAAAAAGGAGGACAGCAGCCCCAAGGAG c.1018_1018+1insAGAAACCCAAAAAGGAGGACAGCAGCCCCAAGGAGGA splice_donor AEBP1 2 82008 2.43879E-5 41004 1 NA
7-44148576-G-A c.1018+1G>A splice_donor AEBP1 1 82000 1.21951E-5 41000 0 NA
7-44148582-G-A c.1018+7G>A splice_region AEBP1 1 82024 1.21916E-5 41012 0 1.12473E-5
7-44148698-C-T c.1019-8C>T splice_region AEBP1 2 81748 2.44654E-5 40874 0 6.37592E-5
7-44148712-C-G p.Pro342Arg missense AEBP1 2 81620 2.45038E-5 40810 0 NA
7-44148719-G-A p.Lys344Lys synonymous AEBP1 1 81602 1.22546E-5 40801 0 3.18715E-5
7-44148731-C-T p.Ser348Ser synonymous AEBP1 3 81472 3.68225E-5 40736 0 NA
7-44148734-C-T p.Pro349Pro synonymous AEBP1 2 81460 2.45519E-5 40730 0 3.18654E-5
7-44148735-AAGG-A p.Glu352del conservative_inframe_deletion AEBP1 59 81502 7.23909E-4 40751 0 0.00453172
7-44148735-A-C p.Lys350Gln missense AEBP1 1 81504 1.22693E-5 40752 0 NA
7-44148746-C-T p.Thr353Thr synonymous AEBP1 1 81368 1.22898E-5 40684 0 NA
7-44148747-G-A p.Asp354Asn missense AEBP1 4 81396 4.91425E-5 40698 0 0.00100705
7-44148781-AAGGTGTGTGGCTGGGGCTTGGGGCCTGGGTCCCTGTGGGGCAGCATCTGGACTCCTGATTGCCTCCCGGGCCCTTGGTGCCATGTCCTCCCTTCATTGTCCCT-A p.Glu366fs frameshift AEBP1 11 81680 1.34672E-4 40840 5 NA
7-44148890-C-G p.Pro367Arg missense AEBP1 2 81300 2.46002E-5 40650 0 5.04541E-4
7-44148892-C-T p.Arg368* stop_gained AEBP1 2 81132 2.46512E-5 40566 0 4.07222E-6
7-44148893-G-A p.Arg368Gln missense AEBP1 13 81220 1.60059E-4 40610 0 2.73548E-4
7-44148894-A-C p.Arg368Arg synonymous AEBP1 1 81226 1.23113E-5 40613 0 9.10581E-6
7-44148898-G-A p.Gly370Ser missense AEBP1 5 81178 6.1593E-5 40589 0 1.09604E-4
7-44148900-C-T p.Gly370Gly synonymous AEBP1 1 80968 1.23506E-5 40484 0 0.00100908
7-44148908-TGGA-T p.Glu376del conservative_inframe_deletion AEBP1 1 80726 1.23876E-5 40363 0 1.83895E-5
7-44148915-G-A p.Glu375Glu synonymous AEBP1 3 80454 3.72884E-5 40227 0 5.60423E-5
7-44148931-G-C p.Glu381Gln missense AEBP1 1 78940 1.26678E-5 39470 0 1.28245E-5
7-44148939-CAGTA-C p.Lys384fs frameshift AEBP1 1 77918 1.2834E-5 38959 0 NA
7-44148944-A-C c.1150+4A>C splice_region AEBP1 1 77108 1.29688E-5 38554 0 NA
7-44148944-AGT-GGG c.1150+4_1150+6delAGTinsGGG splice_region AEBP1 1 77106 1.29692E-5 38553 0 NA
7-44148946-T-G c.1150+6T>G splice_region AEBP1 3 76832 3.90462E-5 38416 0 0.00571405
7-44149242-A-T n.133-2A>T splice_acceptor AEBP1 48 58512 8.20345E-4 29256 0 0.00127714
7-44149270-C-T p.Arg65Trp missense AEBP1 328 56526 0.00580264 28263 3 0.0115812
7-44149270-C-G p.Arg65Gly missense AEBP1 1 56552 1.76828E-5 28276 0 NA
7-44149271-G-C p.Arg65Pro missense AEBP1 31 56504 5.48634E-4 28252 0 6.36132E-4
7-44149281-T-C p.Ser68Ser synonymous AEBP1 3 56198 5.33827E-5 28099 0 5.34474E-5
7-44149606-G-A c.1151-8G>A splice_region AEBP1 98 81354 0.00120461 40677 0 0.00125
7-44149631-A-T p.Met390Leu missense AEBP1 1 82356 1.21424E-5 41178 0 1.68791E-5
7-44149638-C-T p.Ser392Leu missense AEBP1 4 82420 4.85319E-5 41210 0 1.99878E-5
7-44149652-G-A p.Asp397Asn missense AEBP1 2 82600 2.42131E-5 41300 0 1.67577E-5
7-44149682-C-T p.Arg407Cys missense AEBP1 2 82748 2.41698E-5 41374 0 3.19183E-5
7-44149683-G-A p.Arg407His missense AEBP1 3 82742 3.62573E-5 41371 0 2.87228E-4
7-44149687-C-T p.His408His synonymous AEBP1 2 82746 2.41704E-5 41373 0 6.25E-4
7-44149688-G-A p.Gly409Ser missense AEBP1 5 82734 6.04346E-5 41367 0 3.59554E-5
7-44149690-C-T p.Gly409Gly synonymous AEBP1 2 82744 2.41709E-5 41372 0 NA
7-44149698-C-T p.Ala412Val missense AEBP1 1 82744 1.20855E-5 41372 0 NA
7-44149703-C-T p.Arg414Cys missense AEBP1 5 82718 6.04463E-5 41359 0 6.38284E-5
7-44149704-G-A p.Arg414His missense AEBP1 4 82700 4.83676E-5 41350 0 8.36596E-6
7-44149705-C-T p.Arg414Arg synonymous AEBP1 1 82694 1.20928E-5 41347 0 3.19122E-5
7-44149706-G-A p.Gly415Ser missense AEBP1 5 82674 6.04785E-5 41337 0 3.19142E-5
7-44149711-G-A p.Arg416Arg synonymous AEBP1 2 82692 2.41861E-5 41346 0 8.36554E-6
7-44149716-A-G p.Asn418Ser missense AEBP1 2 82692 2.41861E-5 41346 0 NA
7-44149720-GCAGGTGGGCATTGGGATGGGCCCATCTCCCAACTGGGATAAGGGACTCCTCCGCCCATGCTCAGCCTCCCCTGCCCCCTGGA-G p.Gln420del splice_donor AEBP1 6 82688 7.25619E-5 41344 1 NA
7-44149798-C-G c.1261-8C>G splice_region AEBP1 1 82808 1.20761E-5 41404 0 NA
7-44149799-T-C c.1261-7T>C splice_region AEBP1 2 82818 2.41493E-5 41409 0 1.91388E-4
7-44149808-C-T p.Thr421Thr splice_region+synonymous AEBP1 2 82820 2.41488E-5 41410 0 3.1927E-5
7-44149809-G-A p.Gly422Ser missense AEBP1 4 82808 4.83045E-5 41404 0 8.32612E-6
7-44149831-A-C p.Tyr429Ser missense AEBP1 2 82926 2.41179E-5 41463 0 8.30924E-6
7-44149834-A-G p.Asp430Gly missense AEBP1 9 82932 1.08523E-4 41466 0 1.59479E-4
7-44149841-G-A p.Ala432Ala synonymous AEBP1 2 82948 2.41115E-5 41474 0 2.49182E-5
7-44149851-G-A p.Glu436Lys missense AEBP1 3 82980 3.61533E-5 41490 0 1.59357E-4
7-44149856-C-T p.Asp437Asp synonymous AEBP1 14 83008 1.68658E-4 41504 0 2.23172E-4
7-44149857-G-A p.Asp438Asn missense AEBP1 1 83004 1.20476E-5 41502 0 1.82594E-4
7-44149859-T-C p.Asp438Asp synonymous AEBP1 7 83010 8.43272E-5 41505 0 3.98533E-5
7-44149869-C-G p.Gln442Glu missense AEBP1 5 83006 6.02366E-5 41503 0 3.18817E-5
7-44149875-A-T p.Ile444Leu missense AEBP1 785 82972 0.00946102 41486 22 0.0188481
7-44149880-G-A p.Glu445Glu synonymous AEBP1 13 82964 1.56694E-4 41482 0 2.23157E-4
7-44149902-C-T p.Arg453Trp missense AEBP1 1 82934 1.20578E-5 41467 0 3.98616E-6
7-44149903-G-A p.Arg453Gln missense AEBP1 9 82946 1.08504E-4 41473 0 9.56732E-5
7-44149907-C-G p.Phe454Leu missense AEBP1 1 82938 1.20572E-5 41469 0 NA
7-44149914-G-A p.Val457Ile missense AEBP1 1 82898 1.2063E-5 41449 0 1.99343E-5
7-44149914-G-C p.Val457Leu missense AEBP1 1 82898 1.2063E-5 41449 0 3.98686E-6
7-44149940-C-T p.Ser465Ser synonymous AEBP1 1 82810 1.20758E-5 41405 0 1.66246E-5
7-44149945-A-G p.His467Arg missense+splice_region AEBP1 1 82760 1.20831E-5 41380 0 6.3743E-5
7-44150327-C-T p.Asp468Asp synonymous AEBP1 1 82492 1.21224E-5 41246 0 6.37308E-5
7-44150337-AC-A p.Thr473fs frameshift AEBP1 1 82654 1.20986E-5 41327 0 NA
7-44150341-C-G p.Thr473Ser missense AEBP1 11 82730 1.32963E-4 41365 0 0.00100705
7-44150347-T-C p.Phe475Ser missense AEBP1 6 82774 7.24865E-5 41387 0 NA
7-44150373-A-T p.Thr484Ser missense AEBP1 3 82816 3.62249E-5 41408 0 3.18654E-5
7-44150387-C-T p.Tyr488Tyr synonymous AEBP1 1 82820 1.20744E-5 41410 0 8.99912E-6
7-44150389-C-T p.Thr489Ile missense AEBP1 1 82796 1.20779E-5 41398 0 NA
7-44150393-C-T c.-5C>T 5_prime_UTR_premature_start_codon_gain AEBP1 2 82764 2.41651E-5 41382 0 3.18552E-5
7-44150394-G-C p.Gly491Arg missense AEBP1 1 82762 1.20828E-5 41381 0 NA
7-44150403-G-A p.Glu494Lys missense AEBP1 1 82754 1.2084E-5 41377 0 NA
7-44150410-T-G c.1485+2T>G splice_donor AEBP1 1 82664 1.20972E-5 41332 0 NA
7-44150426-G-A p.Gly10Asp missense AEBP1 1 82492 1.21224E-5 41246 0 NA
7-44150454-C-T p.Arg72* stop_gained AEBP1 4 82134 4.87009E-5 41067 0 1.20652E-5
7-44150457-G-A p.Gly73Arg missense AEBP1 1 82214 1.21634E-5 41107 0 4.00538E-6
7-44150476-G-C p.Gly79Ala missense AEBP1 2 82292 2.43037E-5 41146 0 NA
7-44150497-C-A p.Ala86Asp missense AEBP1 2 82492 2.42448E-5 41246 0 8.26774E-6
7-44150504-C-G p.Ser36Cys missense AEBP1 189 82632 0.00228725 41316 2 0.00455588
7-44150508-C-G p.Pro90Ala missense AEBP1 1 82656 1.20983E-5 41328 0 NA
7-44150512-A-G p.Thr496Ala missense+splice_region AEBP1 4 82674 4.83828E-5 41337 0 8.26255E-6
7-44150520-T-C p.Trp94Arg missense AEBP1 9 82778 1.08725E-4 41389 0 NA
7-44150526-C-T p.Arg96Cys missense AEBP1 3 82794 3.62345E-5 41397 0 6.37186E-5
7-44150527-G-A p.Val501Met missense AEBP1 2 82836 2.41441E-5 41418 0 2.47782E-5
7-44150532-C-G p.Asp502Glu missense AEBP1 1 82858 1.20688E-5 41429 0 NA
7-44150542-C-A p.Pro506Thr missense AEBP1 1 82870 1.20671E-5 41435 0 NA
7-44150542-C-T p.Pro506Ser missense AEBP1 2 82870 2.41342E-5 41435 0 1.19405E-5
7-44150544-C-T p.Arg102Cys missense AEBP1 2 82876 2.41324E-5 41438 0 7.95988E-6
7-44150545-G-A p.Val507Met missense AEBP1 8 82896 9.65065E-5 41448 0 5.78111E-5
7-44150567-C-T p.Pro514Leu missense AEBP1 8 82956 9.64367E-5 41478 0 4.95802E-5
7-44150568-G-A p.Pro514Pro synonymous AEBP1 1 82970 1.20525E-5 41485 0 1.65276E-5
7-44150569-G-C p.Val515Leu missense AEBP1 2 82972 2.41045E-5 41486 0 1.65311E-5
7-44150583-C-T p.Phe519Phe synonymous AEBP1 2 82918 2.41202E-5 41459 0 3.18573E-5
7-44150588-G-GC p.Ile522fs frameshift AEBP1 1 82938 1.20572E-5 41469 0 NA
7-44150601-C-G p.Leu525Leu synonymous AEBP1 78 82964 9.40167E-4 41482 0 0.00200688
7-44150616-C-G p.Ser530Arg missense AEBP1 2 82976 2.41034E-5 41488 0 7.98582E-6
7-44150628-C-T p.Arg534Arg synonymous AEBP1 2 82926 2.41179E-5 41463 0 NA
7-44150639-T-C p.Leu538Pro missense AEBP1 3 82904 3.61864E-5 41452 0 NA
7-44150656-CGTGAGTGTGGAGGGCTGGCAGGGGCTCTGAGTGGAGGTGGGGTGCTAGGGTGGGCCAGCCGGCACCCAGCTAAAGACAACCCCGCCTCCCTTGCAG-C c.1630+1_1631-1delGTGAGTGTGGAGGGCTGGCAGGGGCTCTGAGTGGAGGTGGGGTGCTAGGGTGGGCCAGCCGGCACCCAGCTAAAGACAACCCCGCCTCCCTTGCAG splice_acceptor AEBP1 9 82830 1.08656E-4 41415 2 NA
7-44150656-C-T p.Pro544Ser missense+splice_region AEBP1 4 82830 4.82917E-5 41415 0 6.25E-4
7-44150657-G-A c.1630+1G>A splice_donor AEBP1 6 82822 7.24445E-5 41411 0 4.30841E-5
7-44150658-T-A c.1630+2T>A splice_donor AEBP1 1 82830 1.20729E-5 41415 0 NA
7-44150658-T-C c.1630+2T>C splice_donor AEBP1 1 82830 1.20729E-5 41415 0 NA
7-44150669-G-A p.Gly91Glu missense AEBP1 3 82796 3.62336E-5 41398 0 6.37349E-5
7-44150670-G-C p.Gly91Gly synonymous AEBP1 4 82754 4.8336E-5 41377 0 4.12432E-6
7-44150674-G-T p.Ala93Ser missense AEBP1 1 82732 1.20872E-5 41366 0 3.71348E-5
7-44150681-C-A p.Ala95Asp missense AEBP1 1 82630 1.21021E-5 41315 0 NA
7-44150689-G-T p.Gly98* stop_gained AEBP1 1 82608 1.21054E-5 41304 0 NA
7-44150709-G-A p.Trp104* stop_gained AEBP1 1 82530 1.21168E-5 41265 0 8.9316E-6
7-44150710-G-A p.Ala105Thr missense AEBP1 1 82476 1.21247E-5 41238 0 6.37836E-5
7-44150716-C-T p.Arg107Trp missense AEBP1 3 82558 3.63381E-5 41279 0 3.59557E-5
7-44150717-G-A p.Arg107Gln missense AEBP1 28 82558 3.39155E-4 41279 0 0.00375
7-44150725-G-T p.Ala110Ser missense AEBP1 1 82606 1.21057E-5 41303 0 9.08174E-6
7-44150728-A-G p.Lys111Glu missense AEBP1 2 82630 2.42043E-5 41315 0 6.3804E-5
7-44150739-C-T p.Pro114Pro synonymous AEBP1 17 82706 2.05547E-4 41353 0 1.59388E-4
7-44150740-G-A p.Ala115Thr missense AEBP1 5 82704 6.04566E-5 41352 0 1.18089E-4
7-44150748-T-C c.1631-5T>C splice_region AEBP1 1 82804 1.20767E-5 41402 0 NA
7-44150755-G-C p.Val545Leu missense+splice_region AEBP1 3 82832 3.62179E-5 41416 0 6.37105E-5
7-44150760-C-T p.Tyr546Tyr synonymous AEBP1 3 82866 3.6203E-5 41433 0 5.0157E-6
7-44150769-C-T p.Tyr549Tyr synonymous AEBP1 5 82840 6.03573E-5 41420 0 4.57206E-5
7-44150770-G-A p.Ala550Thr missense AEBP1 5 82844 6.03544E-5 41422 0 9.14562E-5
7-44150780-A-T p.Glu553Val missense AEBP1 1 82822 1.20741E-5 41411 0 NA
7-44150784-G-C p.Val554Val synonymous AEBP1 1 82778 1.20805E-5 41389 0 NA
7-44150793-C-T p.Thr557Thr synonymous AEBP1 3 82696 3.62775E-5 41348 0 4.60261E-5
7-44150794-G-A p.Asp558Asn missense AEBP1 1 82698 1.20922E-5 41349 0 3.18593E-5
7-44150795-A-G p.Asp558Gly missense AEBP1 1 82694 1.20928E-5 41347 0 NA
7-44150803-G-A p.Asp561Asn missense AEBP1 2 82628 2.42049E-5 41314 0 3.18796E-5
7-44150806-T-A p.Phe562Ile missense AEBP1 2 82598 2.42137E-5 41299 0 NA
7-44150808-C-G p.Phe562Leu missense AEBP1 1 82564 1.21118E-5 41282 0 NA
7-44150809-C-T p.Arg563Trp missense AEBP1 5 82532 6.05826E-5 41266 0 9.56206E-5
7-44150818-A-G p.Ser566Gly missense AEBP1 6 82346 7.28633E-5 41173 0 2.78387E-5
7-44150830-A-G p.Met570Val missense AEBP1 1 81988 1.21969E-5 40994 0 9.56084E-5
7-44150833-C-T p.Arg571Cys missense AEBP1 1 81746 1.2233E-5 40873 0 NA
7-44150839-G-A c.1716+1G>A splice_donor AEBP1 1 81534 1.22648E-5 40767 0 NA
7-44150843-G-A c.1716+5G>A splice_region AEBP1 1 81212 1.23135E-5 40606 0 NA
7-44151108-C-T p.Leu573Leu splice_region+synonymous AEBP1 66 81522 8.09597E-4 40761 0 0.00162586
7-44151116-TG-T p.Val577fs frameshift AEBP1 2 81580 2.45158E-5 40790 0 NA
7-44151118-G-A p.Val577Met missense AEBP1 1 81600 1.22549E-5 40800 0 4.28013E-6
7-44151123-C-T p.Asn578Asn synonymous AEBP1 1 81636 1.22495E-5 40818 0 3.5832E-5
7-44151124-G-A p.Glu579Lys missense AEBP1 2 81684 2.44846E-5 40842 0 3.18939E-5
7-44151141-C-T p.Ile584Ile synonymous AEBP1 1 81884 1.22124E-5 40942 0 8.62411E-6
7-44151149-C-T p.Thr587Ile missense AEBP1 1 81980 1.21981E-5 40990 0 4.05443E-6
7-44151168-C-T p.Ser593Ser synonymous AEBP1 13 82032 1.58475E-4 41016 0 0.001875
7-44151172-C-T p.Arg595* stop_gained AEBP1 1 81984 1.21975E-5 40992 0 4.02256E-6
7-44151173-G-A p.Arg595Gln missense AEBP1 1 81986 1.21972E-5 40993 0 1.67757E-5
7-44151173-G-C p.Arg595Pro missense AEBP1 1 81986 1.21972E-5 40993 0 4.02191E-6
7-44151178-C-T p.Leu597Phe missense AEBP1 2 82062 2.43718E-5 41031 0 8.37114E-5
7-44151185-T-G p.Ile599Ser missense AEBP1 15 82076 1.82757E-4 41038 0 8.84529E-5
7-44151191-C-T p.Ala601Val missense AEBP1 7 81984 8.53825E-5 40992 0 5.01396E-5
7-44151192-C-T p.Ala601Ala synonymous AEBP1 1 82020 1.21921E-5 41010 0 8.04551E-6
7-44151219-G-A c.*301G>A splice_region AEBP1 8 81726 9.78881E-5 40863 0 6.06516E-5
7-44151235-G-T p.Gly55Cys missense AEBP1 3 81506 3.68071E-5 40753 0 3.19224E-5
7-44151246-G-A p.Gly58Gly synonymous AEBP1 2 81136 2.465E-5 40568 0 4.10442E-6
7-44151246-GC-G p.Pro59fs frameshift AEBP1 1 81136 1.2325E-5 40568 0 NA
7-44151252-AGCTGGCCTCTGCT-A p.Gly62fs frameshift AEBP1 1 81012 1.23439E-5 40506 0 NA
7-44151257-G-C p.Gly62Ala missense AEBP1 1 80648 1.23996E-5 40324 0 NA
7-44151259-C-T p.Leu63Phe missense AEBP1 2 80682 2.47887E-5 40341 0 2.05188E-4
7-44151265-T-G p.Cys65Gly missense AEBP1 1 80342 1.24468E-5 40171 0 4.13647E-6
7-44151369-C-T c.*99C>T splice_region AEBP1 1 68830 1.45285E-5 34415 0 6.38366E-5
7-44151370-G-A c.*100G>A splice_region AEBP1 1 68606 1.4576E-5 34303 0 NA
7-44151375-T-C c.*101+4T>C splice_region AEBP1 1 69044 1.44835E-5 34522 0 NA
7-44151450-C-T c.1841-3C>T splice_region AEBP1 1 76804 1.30202E-5 38402 0 NA
7-44151452-G-T c.1841-1G>T splice_acceptor AEBP1 4 77070 5.19009E-5 38535 0 NA
7-44151469-C-G p.Arg619Arg synonymous AEBP1 2 79066 2.52953E-5 39533 0 NA
7-44151476-G-A p.Ala622Thr missense AEBP1 1 79680 1.25502E-5 39840 0 4.01146E-6
7-44151496-G-C p.Glu628Asp missense AEBP1 1 80768 1.23811E-5 40384 0 NA
7-44151506-C-G p.Arg632Gly missense AEBP1 2 81020 2.46853E-5 40510 0 1.68373E-5
7-44151507-G-C p.Arg632Pro missense AEBP1 9 81078 1.11004E-4 40539 0 6.37186E-5
7-44151507-G-A p.Arg632Gln missense AEBP1 2 81078 2.46676E-5 40539 0 8.411E-6
7-44151509-G-A p.Glu633Lys missense AEBP1 2 81258 2.4613E-5 40629 0 NA
7-44151542-C-G p.Arg644Gly missense AEBP1 1 81940 1.22041E-5 40970 0 6.37471E-5
7-44151555-A-T p.Asp648Val missense AEBP1 1 82308 1.21495E-5 41154 0 8.3167E-6
7-44151567-G-A p.Arg652His missense AEBP1 2 82444 2.42589E-5 41222 0 8.31048E-6
7-44151572-C-CTA p.Arg654fs frameshift AEBP1 1 82480 1.21242E-5 41240 0 7.97213E-6
7-44151573-GCA-G p.Ser655fs frameshift AEBP1 1 82466 1.21262E-5 41233 0 7.97448E-6
7-44151573-G-A p.Arg654His missense AEBP1 2 82466 2.42524E-5 41233 0 1.66182E-5
7-44151573-G-C p.Arg654Pro missense AEBP1 1 82466 1.21262E-5 41233 0 NA
7-44151594-G-A p.Arg661His missense AEBP1 4 82644 4.84004E-5 41322 0 5.03525E-4
7-44151614-C-T p.Leu668Leu synonymous AEBP1 11 82752 1.32927E-4 41376 0 2.54858E-4
7-44151628-C-G p.Gly672Gly synonymous AEBP1 1 82762 1.20828E-5 41381 0 NA
7-44151631-C-T p.Tyr673Tyr synonymous AEBP1 1 82756 1.20837E-5 41378 0 8.3167E-6
7-44151632-G-A p.Glu674Lys missense AEBP1 2 82790 2.41575E-5 41395 0 3.32613E-5
7-44151647-ATGG-A p.Met679fs frameshift AEBP1 1 82802 1.2077E-5 41401 0 NA
7-44151648-TGGTGGGTTGAAGGGTGAGGCTGGCCAGGGTCCAGGCAGCTGGGGGTTGTGGGGGTGTGGGTAGCCGATGCCTACCCTGCTGGCTCCCCACA-T p.Gly680fs frameshift AEBP1 6 82806 7.24585E-5 41403 1 NA
7-44151739-A-G c.2038-2A>G splice_acceptor AEBP1 1 83152 1.20262E-5 41576 0 NA
7-44151763-C-CGCA p.Ala687_Leu688insGln disruptive_inframe_insertion AEBP1 1 83238 1.20137E-5 41619 0 NA
7-44151764-G-C p.Ala687Ala synonymous AEBP1 1 83240 1.20135E-5 41620 0 1.69093E-5
7-44151797-C-A c.*299-8C>A splice_region AEBP1 1 83304 1.20042E-5 41652 0 NA
7-44151801-G-A p.Glu700Lys missense AEBP1 1 83308 1.20036E-5 41654 0 NA
7-44151812-G-C p.Pro703Pro synonymous AEBP1 2 83298 2.40102E-5 41649 0 8.32806E-6
7-44151812-G-A p.Pro703Pro synonymous AEBP1 1 83298 1.20051E-5 41649 0 3.98797E-6
7-44151813-G-A p.Asp704Asn missense AEBP1 1 83294 1.20057E-5 41647 0 NA
7-44151815-T-A p.Asp704Glu missense AEBP1 1 83290 1.20062E-5 41645 0 NA
7-44151816-C-A p.Leu705Ile missense AEBP1 1 83290 1.20062E-5 41645 0 NA
7-44151820-A-T p.Asn706Ile missense AEBP1 2 83290 2.40125E-5 41645 0 0.001875
7-44151825-G-A p.Val708Met missense AEBP1 5 83300 6.0024E-5 41650 0 NA
7-44151831-T-G p.Trp710Gly missense AEBP1 2 83304 2.40085E-5 41652 0 8.33264E-6
7-44151835-G-A p.Gly711Glu missense AEBP1 1 83302 1.20045E-5 41651 0 NA
7-44151839-TGAG-T p.Glu714del conservative_inframe_deletion AEBP1 2 83302 2.4009E-5 41651 0 8.34418E-6
7-44151840-G-A p.Glu713Lys missense AEBP1 2 83300 2.40096E-5 41650 0 4.00045E-6
7-44151866-G-A p.Arg721Arg synonymous AEBP1 1 83238 1.20137E-5 41619 0 6.25E-4
7-44151868-T-C p.Val722Ala missense AEBP1 1 83230 1.20149E-5 41615 0 NA
7-44151870-C-T p.Pro723Ser missense AEBP1 1 83226 1.20155E-5 41613 0 8.55286E-6
7-44151875-C-CA p.Asn725fs frameshift AEBP1 1 83212 1.20175E-5 41606 0 NA
7-44151886-C-T p.Pro728Leu missense AEBP1 9 83164 1.0822E-4 41582 0 0.00125156
7-44151893-T-G p.Pro730Pro synonymous AEBP1 2 83152 2.40523E-5 41576 0 4.44642E-6
7-44151897-C-T p.Arg732Cys missense AEBP1 1 83122 1.20305E-5 41561 0 1.38503E-5
7-44151915-G-A p.Ala738Thr missense AEBP1 1 82918 1.20601E-5 41459 0 NA
7-44151922-T-TATCCACGGAGGTCCGGGCCATCATTGCCTGGATGGA c.2217+2_2217+3insATCCACGGAGGTCCGGGCCATCATTGCCTGGATGGA splice_region AEBP1 2 82782 2.41598E-5 41391 1 NA
7-44151922-T-TATCCACGGAGGTCCGGGCCATCATTGCCTGGATG c.2217+2_2217+3insATCCACGGAGGTCCGGGCCATCATTGCCTGGATG splice_region AEBP1 2 82782 2.41598E-5 41391 1 NA
7-44151928-T-C c.2217+8T>C splice_region AEBP1 1 82674 1.20957E-5 41337 0 9.16355E-6
7-44152150-ACT-A c.2218-6_2218-5delCT splice_region AEBP1 1 82110 1.21788E-5 41055 0 3.19468E-5
7-44152164-C-A p.Thr742Lys missense AEBP1 1 82412 1.21342E-5 41206 0 4.25224E-6
7-44152173-G-A p.Arg745Gln missense AEBP1 7 82570 8.47766E-5 41285 0 3.49068E-4
7-44152176-C-T p.Ala746Val missense AEBP1 3 82606 3.6317E-5 41303 0 3.19E-5
7-44152201-C-A p.Asn754Lys missense AEBP1 1 82852 1.20697E-5 41426 0 NA
7-44152202-C-G p.Pro755Ala missense AEBP1 8 82862 9.65461E-5 41431 0 5.21795E-5
7-44152207-C-A p.Phe756Leu missense AEBP1 1 82880 1.20656E-5 41440 0 NA
7-44152218-C-T p.Ala760Val missense AEBP1 1 82940 1.20569E-5 41470 0 NA
7-44152223-C-G p.Leu762Val missense AEBP1 7 82952 8.43861E-5 41476 0 6.37877E-5
7-44152228-C-T p.Asn763Asn synonymous AEBP1 25 82928 3.01466E-4 41464 0 5.03525E-4
7-44152231-C-T p.Gly764Gly synonymous AEBP1 3 82882 3.6196E-5 41441 0 3.19882E-5
7-44152235-G-A p.Glu766Lys missense AEBP1 1 82834 1.20723E-5 41417 0 NA
7-44152245-T-C p.Val769Ala missense AEBP1 1 82776 1.20808E-5 41388 0 6.38488E-5
7-44152258-C-T p.Tyr773Tyr synonymous AEBP1 5 82704 6.04566E-5 41352 0 5.86314E-5
7-44152263-T-C p.Met775Thr missense AEBP1 1 82636 1.21013E-5 41318 0 3.99978E-6
7-44152266-C-T p.Ala776Val missense AEBP1 194 82582 0.00234918 41291 0 0.008125
7-44152272-C-A p.Thr778Lys missense AEBP1 3 82308 3.64485E-5 41154 0 1.20216E-5
7-44152277-A-G p.Thr780Ala missense AEBP1 2 82232 2.43214E-5 41116 0 8.40322E-6
7-44152280-C-T p.Gln781* stop_gained AEBP1 1 82324 1.21471E-5 41162 0 NA
7-44152280-C-G p.Gln781Glu missense AEBP1 1 82324 1.21471E-5 41162 0 8.39616E-6
7-44152285-G-A p.Glu782Glu synonymous AEBP1 2 82258 2.43137E-5 41129 0 8.01552E-5
7-44152295-G-T p.Ala786Ser missense AEBP1 1 82148 1.21732E-5 41074 0 8.4028E-6
7-44152302-C-T p.Ala788Val missense AEBP1 1 82128 1.21761E-5 41064 0 2.52177E-5
7-44152305-T-C p.Met789Thr missense AEBP1 2 82122 2.4354E-5 41061 0 NA
7-44152315-C-CCGGGG p.Glu795fs frameshift AEBP1 1 82036 1.21898E-5 41018 0 NA
7-44152317-G-C p.Arg793Pro missense AEBP1 3 82090 3.65453E-5 41045 0 2.81303E-5
7-44152318-G-C p.Arg793Arg synonymous AEBP1 16 82182 1.9469E-4 41091 0 6.71919E-5
7-44152318-G-T p.Arg793Arg synonymous AEBP1 2 82182 2.43362E-5 41091 0 4.19949E-5
7-44152318-G-A p.Arg793Arg synonymous AEBP1 1 82182 1.21681E-5 41091 0 3.19163E-5
7-44152319-G-C p.Gly794Arg missense AEBP1 5 82218 6.08139E-5 41109 0 1.67887E-5
7-44152325-G-A p.Asp796Asn missense AEBP1 2 82202 2.43303E-5 41101 0 3.19244E-5
7-44152327-T-G p.Asp796Glu missense AEBP1 1 82242 1.21592E-5 41121 0 4.01023E-6
7-44152328-G-A p.Glu797Lys missense AEBP1 5 82254 6.07873E-5 41127 0 3.19244E-5
7-44152331-G-A p.Asp798Asn missense AEBP1 2 82278 2.43078E-5 41139 0 8.38968E-6
7-44152331-G-C p.Asp798His missense AEBP1 1 82278 1.21539E-5 41139 0 NA
7-44152334-G-C p.Glu799Gln missense AEBP1 1 82216 1.21631E-5 41108 0 8.39278E-6
7-44152382-C-G p.Leu815Val missense AEBP1 1 82120 1.21773E-5 41060 0 1.20898E-5
7-44152390-C-T p.Ile817Ile synonymous AEBP1 1 82084 1.21826E-5 41042 0 NA
7-44152394-T-G p.Phe819Val missense AEBP1 1 82038 1.21895E-5 41019 0 1.67098E-5
7-44152397-G-T p.Ala820Ser missense AEBP1 2 81900 2.442E-5 40950 0 NA
7-44152398-C-T p.Ala820Val missense AEBP1 1 81942 1.22038E-5 40971 0 NA
7-44152405-A-C p.Ala822Ala synonymous AEBP1 2 81916 2.44153E-5 40958 0 1.21193E-5
7-44152421-G-A p.Glu828Lys missense AEBP1 2 81760 2.44618E-5 40880 0 5.03525E-4
7-44152424-C-A p.Pro829Thr missense AEBP1 26 81770 3.17965E-4 40885 0 0.00251762
7-44152442-C-T p.Gln835* stop_gained AEBP1 1 81760 1.22309E-5 40880 0 NA
7-44152455-A-G p.Tyr839Cys missense AEBP1 2 81712 2.44762E-5 40856 0 8.34098E-6
7-44152459-C-T p.Thr840Thr synonymous AEBP1 3 81656 3.67395E-5 40828 0 2.01983E-5
7-44152463-G-A p.Gly842Ser missense AEBP1 2 81606 2.4508E-5 40803 0 8.34195E-6
7-44152464-G-A p.Gly842Asp missense AEBP1 1 81594 1.22558E-5 40797 0 NA
7-44152467-T-C p.Met843Thr missense AEBP1 3 81670 3.67332E-5 40835 0 NA
7-44152475-G-A p.Val846Ile missense AEBP1 13 81624 1.59267E-4 40812 0 2.50146E-5
7-44152495-C-T p.Asn852Asn synonymous AEBP1 1 81628 1.22507E-5 40814 0 NA
7-44152500-G-T p.Arg854Leu missense AEBP1 4 81578 4.90328E-5 40789 0 3.33294E-5
7-44152501-G-A p.Arg854Arg synonymous AEBP1 1 81586 1.2257E-5 40793 0 1.66683E-5
7-44152503-C-T p.Thr855Ile missense AEBP1 3 81596 3.67665E-5 40798 0 8.33806E-6
7-44152505-G-A p.Gly856Arg missense AEBP1 1 81668 1.22447E-5 40834 0 6.42343E-5
7-44152508-AGTGAGTCAGCCTGGGAGGGGCTGTGGGCGGGGCCTGGTCCGGAGAGGGGCTGACTTTGGGTCTGTATCTGTCCCCGGCCAG-A c.2569+1_2570-1delGTGAGTCAGCCTGGGAGGGGCTGTGGGCGGGGCCTGGTCCGGAGAGGGGCTGACTTTGGGTCTGTATCTGTCCCCGGCCAG splice_acceptor AEBP1 6 81652 7.34826E-5 40826 0 NA
7-44152582-C-G c.2570-8C>G splice_region AEBP1 1 83032 1.20435E-5 41516 0 NA
7-44152583-C-T c.2570-7C>T splice_region AEBP1 1 83040 1.20424E-5 41520 0 NA
7-44152584-G-A c.2570-6G>A splice_region AEBP1 1 83048 1.20412E-5 41524 0 NA
7-44152584-G-T c.2570-6G>T splice_region AEBP1 1 83048 1.20412E-5 41524 0 7.16652E-5
7-44152585-G-A c.2570-5G>A splice_region AEBP1 3 83050 3.61228E-5 41525 0 1.56657E-4
7-44152602-TCA-T p.Phe861fs frameshift AEBP1 1 83180 1.20221E-5 41590 0 5.03525E-4
7-44152609-C-T p.Tyr863Tyr synonymous AEBP1 24 83178 2.88538E-4 41589 0 2.23229E-4
7-44152610-C-A p.Leu864Met missense AEBP1 6 83190 7.21241E-5 41595 0 9.56633E-5
7-44152615-T-C p.His865His synonymous AEBP1 1 83198 1.20195E-5 41599 0 NA
7-44152624-C-T p.Cys868Cys synonymous AEBP1 60 83194 7.21206E-4 41597 0 0.00108418
7-44152640-T-C p.Tyr874His missense AEBP1 1 83188 1.2021E-5 41594 0 8.2371E-6
7-44152678-G-A p.Leu886Leu synonymous AEBP1 1 83030 1.20438E-5 41515 0 NA
7-44152687-G-A p.Glu889Glu synonymous AEBP1 1 83016 1.20459E-5 41508 0 3.97798E-6
7-44152693-GAAC-G p.Asn893del disruptive_inframe_deletion AEBP1 4 82954 4.82195E-5 41477 0 1.19351E-5
7-44152698-A-G p.Asn893Ser missense AEBP1 2 82898 2.4126E-5 41449 0 NA
7-44152699-C-G p.Asn893Lys missense AEBP1 1 82886 1.20648E-5 41443 0 3.97871E-6
7-44152704-A-G p.Glu895Gly missense AEBP1 2 82856 2.41383E-5 41428 0 8.24171E-6
7-44152708-G-A p.Ala896Ala synonymous AEBP1 2 82764 2.41651E-5 41382 0 8.2428E-6
7-44152711-G-T p.Leu897Leu synonymous AEBP1 6 82738 7.25181E-5 41369 0 NA
7-44152712-C-T p.Leu898Phe missense AEBP1 1 82712 1.20901E-5 41356 0 NA
7-44152714-C-T p.Leu898Leu synonymous AEBP1 1 82692 1.20931E-5 41346 0 NA
7-44152727-CAGGTGGGGTGGCTAGGGCAATGCCTGGGGAGAGGAGGCTGCACAGGCTCCTGGATGGGCGGGAGGGAGCAGCGGACCACATTGGACCTTCCTGAGGACCAGCAGCCCTCACCTGCTTCCCT-C p.Gln903fs frameshift AEBP1 2 82564 2.42236E-5 41282 1 NA
7-44152868-G-A p.Lys909Lys synonymous AEBP1 2 82348 2.42872E-5 41174 0 5.03525E-4
7-44152872-G-C p.Val911Leu missense AEBP1 5 82358 6.07106E-5 41179 0 8.58045E-6
7-44152879-C-A p.Thr913Lys missense AEBP1 1 82270 1.21551E-5 41135 0 NA
7-44152883-C-G p.Asp914Glu missense AEBP1 1 82246 1.21586E-5 41123 0 NA
7-44152883-C-A p.Asp914Glu missense AEBP1 2 82246 2.43173E-5 41123 0 NA
7-44152884-G-A p.Glu915Lys missense AEBP1 1 82274 1.21545E-5 41137 0 NA
7-44152900-T-C p.Ile920Thr missense AEBP1 1 82170 1.21699E-5 41085 0 0.00159704
7-44152906-A-G p.Asn922Ser missense AEBP1 1 82046 1.21883E-5 41023 0 NA
7-44152907-C-A p.Asn922Lys missense AEBP1 1 81986 1.21972E-5 40993 0 NA
7-44152950-G-GCCAGTGGTGGTGATTACTGGCGAATCTTGAACCCGGGTGA c.2809_2809+1insCCAGTGGTGGTGATTACTGGCGAATCTTGAACCCGGGTGA splice_donor AEBP1 1 79854 1.25229E-5 39927 0 NA
7-44152954-C-G c.2809+4C>G splice_region AEBP1 1 79438 1.25884E-5 39719 0 1.15136E-5
7-44153185-C-T c.2810-8C>T splice_region AEBP1 2 79254 2.52353E-5 39627 0 3.20307E-5
7-44153188-C-T c.2810-5C>T splice_region AEBP1 1 79292 1.26116E-5 39646 0 3.57168E-5
7-44153190-C-T c.2810-3C>T splice_region AEBP1 1 79388 1.25964E-5 39694 0 3.20143E-5
7-44153237-C-A p.Arg952Ser missense AEBP1 1 81436 1.22796E-5 40718 0 NA
7-44153239-C-T p.Arg952Arg synonymous AEBP1 1 81474 1.22739E-5 40737 0 1.20082E-5
7-44153240-G-A p.Val953Met missense AEBP1 2 81622 2.45032E-5 40811 0 8.3102E-6
7-44153244-C-G p.Thr954Arg missense AEBP1 2 81782 2.44553E-5 40891 0 4.9824E-5
7-44153247-C-G p.Ala955Gly missense AEBP1 10 81782 1.22276E-4 40891 0 8.29986E-6
7-44153265-C-T p.Thr961Ile missense AEBP1 1 82400 1.21359E-5 41200 0 1.65522E-5
7-44153291-G-T p.Asp970Tyr missense AEBP1 1 82846 1.20706E-5 41423 0 6.38488E-5
7-44153293-CTA-C p.Tyr971fs frameshift AEBP1 2 82878 2.41319E-5 41439 0 NA
7-44153302-C-T p.Ile973Ile synonymous AEBP1 5 82926 6.02947E-5 41463 0 3.13671E-4
7-44153306-G-A p.Ala975Thr missense AEBP1 2 82914 2.41214E-5 41457 0 NA
7-44153313-A-T p.Gln977Leu missense AEBP1 1 82966 1.20531E-5 41483 0 NA
7-44153323-C-T p.Phe980Phe synonymous AEBP1 2 82980 2.41022E-5 41490 0 3.29984E-5
7-44153326-C-T p.Ile981Ile synonymous AEBP1 3 82996 3.61463E-5 41498 0 8.24919E-6
7-44153335-C-T p.Arg984Arg synonymous AEBP1 20 82986 2.41005E-4 41493 0 5.42472E-4
7-44153341-C-G p.Asn986Lys missense AEBP1 1 83002 1.20479E-5 41501 0 NA
7-44153346-A-C p.Lys988Thr missense AEBP1 1 83016 1.20459E-5 41508 0 NA
7-44153366-G-A p.Ala995Thr missense AEBP1 1 83028 1.20441E-5 41514 0 NA
7-44153370-T-C p.Met996Thr missense AEBP1 28 83040 3.37187E-4 41520 2 0.00115432
7-44153374-CG-C p.Asn999fs frameshift AEBP1 3 83020 3.61359E-5 41510 0 1.59167E-5
7-44153375-G-A p.Gly998Arg missense AEBP1 2 83026 2.40888E-5 41513 0 1.98954E-5
7-44153376-G-A p.Gly998Glu missense AEBP1 2 83016 2.40917E-5 41508 0 2.47366E-5
7-44153378-A-T p.Asn999Tyr missense AEBP1 2 83008 2.40941E-5 41504 0 NA
7-44153412-C-T p.Pro1010Leu missense AEBP1 1 82800 1.20773E-5 41400 0 NA
7-44153413-T-C p.Pro1010Pro synonymous AEBP1 1 82768 1.2082E-5 41384 0 8.24919E-6
7-44153415-T-G p.Met1011Arg missense AEBP1 1 82748 1.20849E-5 41374 0 8.25055E-6
7-44153417-A-AC p.Gln1014fs frameshift AEBP1 2 82606 2.42113E-5 41303 0 4.95295E-5
7-44153418-C-A p.Thr1012Asn missense AEBP1 1 82758 1.20834E-5 41379 0 3.98591E-6
7-44153418-C-T p.Thr1012Ile missense AEBP1 1 82758 1.20834E-5 41379 0 3.18918E-5
7-44153425-A-G p.Gln1014Gln synonymous AEBP1 2 82674 2.41914E-5 41337 0 3.98559E-6
7-44153427-A-T p.Gln1015Leu missense AEBP1 9 82650 1.08893E-4 41325 0 1.98085E-4
7-44153432-C-G p.Arg1017Gly missense AEBP1 2 82582 2.42184E-5 41291 0 NA
7-44153433-G-T p.Arg1017Leu missense AEBP1 1 82596 1.21071E-5 41298 0 3.98909E-6
7-44153440-G-A p.Gln1019Gln synonymous AEBP1 1 82666 1.20969E-5 41333 0 1.65191E-5
7-44153441-C-G p.Gln1020Glu missense AEBP1 3 82664 3.62915E-5 41332 0 2.47811E-5
7-44153447-C-T p.Arg1022Cys missense AEBP1 1 82656 1.20983E-5 41328 0 NA
7-44153450-C-G p.Leu1023Val missense AEBP1 1 82704 1.20913E-5 41352 0 NA
7-44153454-A-G p.Gln1024Arg missense AEBP1 2 82752 2.41686E-5 41376 0 7.98346E-6
7-44153459-C-T p.Arg1026Cys missense AEBP1 2 82748 2.41698E-5 41374 0 NA
7-44153465-C-A p.Arg1028Arg synonymous AEBP1 1 82778 1.20805E-5 41389 0 1.19967E-5
7-44153466-G-A p.Arg1028Gln missense AEBP1 7 82808 8.45329E-5 41404 0 0.00100705
7-44153474-G-A p.Ala1031Thr missense AEBP1 220 82762 0.00265822 41381 0 0.00250276
7-44153475-C-G p.Ala1031Gly missense AEBP1 1 82790 1.20788E-5 41395 0 8.31186E-6
7-44153484-G-A p.Arg1034Gln missense AEBP1 1 82768 1.2082E-5 41384 0 5.03525E-4
7-44153489-C-T p.Arg1036Trp missense AEBP1 2 82670 2.41926E-5 41335 0 2.50798E-5
7-44153490-G-A p.Arg1036Gln missense AEBP1 2 82672 2.4192E-5 41336 0 1.91473E-4
7-44153490-G-T p.Arg1036Leu missense AEBP1 1 82672 1.2096E-5 41336 0 4.01626E-6
7-44153493-G-A p.Arg1037His missense AEBP1 1 82604 1.2106E-5 41302 0 4.02075E-6
7-44153501-G-A p.Ala1040Thr missense AEBP1 1 82644 1.21001E-5 41322 0 9.57182E-5
7-44153503-CACCACCACCCTAG-C p.Thr1041fs frameshift AEBP1 1 82678 1.20951E-5 41339 0 NA
7-44153510-A-C p.Thr1043Pro missense AEBP1 1 82670 1.20963E-5 41335 0 4.01713E-6
7-44153525-A-T p.Thr1048Ser missense AEBP1 2 82808 2.41523E-5 41404 0 2.00706E-5
7-44153538-C-G p.Thr1052Arg missense AEBP1 1 82832 1.20726E-5 41416 0 NA
7-44153563-C-T p.Thr1060Thr synonymous AEBP1 1 82926 1.20589E-5 41463 0 NA
7-44153565-T-A p.Leu1061Gln missense AEBP1 2 82912 2.4122E-5 41456 0 NA
7-44153574-C-T p.Thr1064Ile missense AEBP1 1 82986 1.20502E-5 41493 0 8.56355E-6
7-44153581-G-A p.Glu1066Glu synonymous AEBP1 3 83002 3.61437E-5 41501 0 5.03525E-4
7-44153586-G-A p.Trp1068* stop_gained AEBP1 1 83030 1.20438E-5 41515 0 NA
7-44153608-C-T p.Thr1075Thr synonymous AEBP1 2 83104 2.40662E-5 41552 0 NA
7-44153614-C-G p.Gly1077Gly synonymous AEBP1 3995 83100 0.0480746 41550 130 0.115625
7-44153618-G-A p.Glu1079Lys missense AEBP1 28 83152 3.36733E-4 41576 0 4.46542E-4
7-44153620-G-A p.Glu1079Glu synonymous AEBP1 1 83134 1.20288E-5 41567 0 9.56191E-5
7-44153626-G-C p.Ser1081Ser synonymous AEBP1 3 83134 3.60863E-5 41567 1 NA
7-44153644-A-AGAGGTGGTGACAGAGTTTGGGACC p.Val1090_Val1097dup disruptive_inframe_insertion AEBP1 14 83156 1.68358E-4 41578 0 5.10139E-4
7-44153651-G-A p.Val1090Met missense AEBP1 1 83152 1.20262E-5 41576 0 NA
7-44153654-A-G p.Thr1091Ala missense AEBP1 1 83154 1.20259E-5 41577 0 NA
7-44153656-AGAGTTTGGGACCGAGGTGGAGCCC-A p.Glu1096_Thr1103del conservative_inframe_deletion AEBP1 2 83164 2.40489E-5 41582 0 NA
7-44153658-A-T p.Glu1092Val missense AEBP1 1 83166 1.20241E-5 41583 0 8.25764E-6
7-44153665-GACC-G p.Thr1095del conservative_inframe_deletion AEBP1 1 83158 1.20253E-5 41579 0 NA
7-44153669-G-GAGGTGGAGCCCGAGTTTGGGACCA p.Gly1102_Phe1109dup disruptive_inframe_insertion AEBP1 4 83108 4.81301E-5 41554 0 9.56755E-5
7-44153669-G-A p.Glu1096Lys missense AEBP1 1 83108 1.20325E-5 41554 0 1.19432E-5
7-44153669-GAGGTGGAGCCCGAGTTTGGGACCA-G p.Gly1102_Phe1109del disruptive_inframe_deletion AEBP1 15 83104 1.80497E-4 41552 0 1.59459E-4
7-44153674-G-T p.Val1097Val synonymous AEBP1 1 83060 1.20395E-5 41530 0 NA
7-44153681-G-A p.Glu1100Lys missense AEBP1 1 82996 1.20488E-5 41498 0 8.25287E-6
7-44153693-A-G p.Lys1104Glu missense AEBP1 2 83002 2.40958E-5 41501 0 NA
7-44153694-A-T p.Lys1104Met missense AEBP1 1 83008 1.2047E-5 41504 0 3.98042E-6
7-44153696-GTGGAGCCCGAGTTTGAGACCCAGT-G p.Glu1108_Pro1115del disruptive_inframe_deletion AEBP1 3 83010 3.61402E-5 41505 0 1.40252E-4
7-44153704-CGAGTTTGAGACCCAGTTGGAGCCT-C p.Leu1113_Gln1120del conservative_inframe_deletion AEBP1 2 82938 2.41144E-5 41469 0 3.18674E-5
7-44153719-G-A p.Gln1112Gln synonymous AEBP1 2 82960 2.4108E-5 41480 0 1.27421E-4
7-44153724-A-G p.Glu1114Gly missense AEBP1 1 82956 1.20546E-5 41478 0 NA
7-44153726-C-G p.Pro1115Ala missense AEBP1 1 82942 1.20566E-5 41471 0 NA
7-44153729-G-A p.Glu1116Lys missense AEBP1 1 82960 1.2054E-5 41480 0 NA
7-44153731-G-A p.Glu1116Glu synonymous AEBP1 2 82962 2.41074E-5 41481 0 7.96121E-6
7-44153731-G-GT p.Glu1118fs frameshift AEBP1 1 82962 1.20537E-5 41481 0 NA
7-44153732-T-C p.Phe1117Leu missense AEBP1 5 82962 6.02686E-5 41481 0 9.95247E-5
7-44153752-C-T p.Pro1123Pro synonymous AEBP1 10 83010 1.20467E-4 41505 0 1.07243E-4
7-44153753-G-C p.Glu1124Gln missense AEBP1 1 83016 1.20459E-5 41508 0 NA
7-44153753-G-A p.Glu1124Lys missense AEBP1 1 83016 1.20459E-5 41508 0 8.24878E-6
7-44153764-AGAG-A p.Glu1132del conservative_inframe_deletion AEBP1 8 82942 9.64529E-5 41471 0 1.98203E-4
7-44153767-G-A p.Glu1128Glu synonymous AEBP1 1 83068 1.20383E-5 41534 0 NA
7-44153771-GAGGAGGAGA-G p.Glu1131_Lys1133del disruptive_inframe_deletion AEBP1 34 83074 4.09274E-4 41537 0 2.8866E-4
7-44153772-A-G p.Glu1130Gly missense AEBP1 6 83080 7.22195E-5 41540 0 8.25314E-5
7-44153776-G-A p.Glu1131Glu synonymous AEBP1 1 83124 1.20302E-5 41562 0 2.78567E-5
7-44153777-GAGA-G p.Lys1133del disruptive_inframe_deletion AEBP1 4 82730 4.83501E-5 41365 0 9.61634E-4
7-44153780-A-G p.Lys1133Glu missense AEBP1 35394 81476 0.43441 40738 7339 0.436592
7-44153782-AGAG-A p.Glu1136del conservative_inframe_deletion AEBP1 4 83136 4.81139E-5 41568 0 9.56145E-5
7-44153789-G-A p.Glu1136Lys missense AEBP1 7 83162 8.41731E-5 41581 0 3.18319E-5
7-44153804-C-G p.Gln1141Glu missense AEBP1 2 83206 2.40367E-5 41603 0 5.03525E-4
7-44153825-G-A p.Val1148Ile missense AEBP1 1925 83168 0.0231459 41584 28 0.0209866
7-44153847-T-C p.Phe1155Ser missense AEBP1 1 83198 1.20195E-5 41599 0 1.65172E-5
7-44153848-T-C p.Phe1155Phe synonymous AEBP1 205 83198 0.002464 41599 1 0.00580172
7-44153849-G-A p.Gly1156Arg missense AEBP1 1 83204 1.20187E-5 41602 0 NA
7-44153859-G-A p.Ter1159Ter stop_retained AEBP1 1 83176 1.20227E-5 41588 0 NA