Variant

Variant ID Consequence Effect Gene AC AN AF NS NHOM maxEAF
14-105190531-C-T c.-77C>T 5_prime_UTR_premature_start_codon_gain ADSSL1 1 31410 3.1837E-5 15705 0 NA
14-105190572-C-T c.-36C>T 5_prime_UTR_premature_start_codon_gain ADSSL1 3 34572 8.67754E-5 17286 0 NA
14-105190577-C-T c.-31C>T 5_prime_UTR_premature_start_codon_gain ADSSL1 104 34912 0.00297892 17456 1 0.0138889
14-105190624-C-G p.Ala6Gly missense ADSSL1 1 38782 2.57852E-5 19391 0 NA
14-105190636-G-T p.Arg10Leu missense ADSSL1 1 39304 2.54427E-5 19652 0 NA
14-105190640-C-A p.Pro11Pro synonymous ADSSL1 1 39680 2.52016E-5 19840 0 NA
14-105190646-C-T p.Gly13Gly synonymous ADSSL1 1 39676 2.52042E-5 19838 0 NA
14-105190652-CGGCGTCAAGCGGGGGCGGCTGCAGCAGGA-C p.Val17fs frameshift ADSSL1 1 40086 2.49464E-5 20043 0 NA
14-105190672-T-TGCAGCAGGAGGCGGCG p.Thr29fs frameshift ADSSL1 1 41890 2.3872E-5 20945 0 NA
14-105190679-G-A p.Gln24Gln synonymous ADSSL1 1 43156 2.31717E-5 21578 0 NA
14-105190685-G-A p.Ala26Ala synonymous ADSSL1 1 43772 2.28457E-5 21886 0 NA
14-105190694-C-G p.Thr29Thr synonymous ADSSL1 45 45106 9.9765E-4 22553 1 0.00576923
14-105190704-G-C p.Val33Leu missense ADSSL1 2 46632 4.2889E-5 23316 0 6.7659E-4
14-105190721-C-T p.Gly38Gly synonymous ADSSL1 2 48730 4.10425E-5 24365 0 NA
14-105190727-G-A p.Gln40Gln synonymous ADSSL1 1 49834 2.00666E-5 24917 0 NA
14-105190729-G-T p.Trp41Leu missense ADSSL1 6 50070 1.19832E-4 25035 0 0.00209864
14-105190729-G-C p.Trp41Ser missense ADSSL1 1 50070 1.9972E-5 25035 0 6.29723E-4
14-105190730-G-C p.Trp41Cys missense ADSSL1 3 50172 5.97943E-5 25086 0 1.72414E-4
14-105190732-G-A p.Gly42Glu missense ADSSL1 1 50316 1.98744E-5 25158 0 2.60756E-5
14-105190734-G-T p.Asp43Tyr missense ADSSL1 1 50542 1.97855E-5 25271 0 NA
14-105190736-C-T p.Asp43Asp synonymous ADSSL1 1 50320 1.98728E-5 25160 0 NA
14-105190764-C-T p.Leu53Leu synonymous ADSSL1 2 51522 3.88184E-5 25761 0 3.79555E-4
14-105190766-G-A p.Leu53Leu synonymous ADSSL1 1 51478 1.94258E-5 25739 0 NA
14-105190772-G-A p.Thr55Thr synonymous ADSSL1 1 50664 1.97379E-5 25332 0 3.1953E-5
14-105190776-G-A p.Ala57Thr missense ADSSL1 8 50022 1.5993E-4 25011 0 9.55501E-4
14-105190779-G-A p.Asp58Asn missense ADSSL1 1 50020 1.9992E-5 25010 0 0.00210748
14-105190782-A-G p.Ile59Val missense ADSSL1 13 49944 2.60292E-4 24972 0 5.72902E-4
14-105190800-G-GT c.192+1_192+2insT splice_donor ADSSL1 1 46852 2.13438E-5 23426 0 3.19754E-5
14-105190801-TGC-GGG c.192+2_192+4delTGCinsGGG splice_donor ADSSL1 1 46478 2.15156E-5 23239 0 NA
14-105190804-G-C c.192+5G>C splice_region ADSSL1 6 45680 1.31349E-4 22840 0 2.66241E-4
14-105196125-CGT-C p.Arg19fs frameshift ADSSL1 1 16886 5.92207E-5 8443 0 0.00188537
14-105196128-CGTGGGGAGGAGCGTGGCGTCGGCGTCGTGGGGAGGAGCGTGGCGTCGGCGTCGTGGGGAGGAGCGTGGCGTCGGCGTCGTGGGGAGGAGCGTGGCGTCGGCA-C p.Met1fs frameshift ADSSL1 1 17650 5.66572E-5 8825 0 0.00335249
14-105196128-CGTGGGGAGGAGCGTGGCGTCGGCGTCGTGGGGAGGAGCGTGGCGTCGGCGTCGTGGGGAGGAGCGTGGCGTCGGCGTCGTGGGGAGGAGCGTGGCGTCGGCATG-C p.Met1fs frameshift ADSSL1 1 17650 5.66572E-5 8825 0 NA
14-105196129-G-A p.Arg20His missense ADSSL1 21 17778 0.00118124 8889 0 0.00157073
14-105196141-G-A p.Arg24His missense ADSSL1 1 21156 4.72679E-5 10578 0 3.72439E-5
14-105196152-G-A p.Val28Ile missense ADSSL1 1 26564 3.76449E-5 13282 0 NA
14-105196180-C-G p.Ser37Trp missense ADSSL1 2 51200 3.90625E-5 25600 0 2.31267E-4
14-105196181-G-C c.-49G>C 5_prime_UTR_premature_start_codon_gain ADSSL1 1 53162 1.88104E-5 26581 0 3.78415E-5
14-105196197-C-T p.Arg43Cys missense ADSSL1 1 64560 1.54895E-5 32280 0 3.7103E-5
14-105196198-G-T p.Arg43Leu missense ADSSL1 2 66412 3.0115E-5 33206 0 NA
14-105196224-G-A p.Val52Ile missense ADSSL1 1 75646 1.32195E-5 37823 0 NA
14-105196227-G-A p.Gly53Ser missense ADSSL1 3 76160 3.93908E-5 38080 0 3.26691E-5
14-105196230-A-C p.Met54Leu missense+splice_region ADSSL1 8885 73420 0.121016 36710 1849 0.205498
14-105196230-A-G p.Met1? start_lost ADSSL1 1 76698 1.30381E-5 38349 0 2.70658E-5
14-105196233-G-T c.162+1G>T splice_donor ADSSL1 1 77078 1.29739E-5 38539 0 NA
14-105196235-G-A c.162+3G>A splice_region ADSSL1 18732 71324 0.262632 35662 5071 0.445
14-105196243-G-T p.Ser5Ile missense ADSSL1 1 77874 1.28413E-5 38937 0 NA
14-105196255-C-T p.Ala9Val missense ADSSL1 1 78404 1.27545E-5 39202 0 NA
14-105196266-C-G p.Gln13Glu missense ADSSL1 1 78990 1.26598E-5 39495 0 1.20669E-5
14-105196269-G-A p.Gly14Arg missense ADSSL1 1 79202 1.26259E-5 39601 0 1.75166E-5
14-105196276-G-A p.Gly16Glu missense ADSSL1 2 79376 2.51965E-5 39688 0 1.11324E-5
14-105196304-C-T p.Thr25Thr synonymous ADSSL1 1 80222 1.24654E-5 40111 0 NA
14-105196321-C-T p.Ala31Val missense ADSSL1 6 80402 7.4625E-5 40201 0 3.1902E-5
14-105196331-A-G p.Thr34Thr synonymous ADSSL1 1 80522 1.2419E-5 40261 0 9.0411E-6
14-105196360-T-G p.Leu44Arg missense ADSSL1 3 80878 3.70929E-5 40439 0 1.24111E-4
14-105196365-T-C p.Leu46Leu synonymous ADSSL1 40257 80350 0.501021 40175 10366 0.583183
14-105196365-T-G p.Leu46Val missense ADSSL1 2 80898 2.47225E-5 40449 0 4.87102E-6
14-105196369-T-A p.Leu47Gln missense ADSSL1 1 80912 1.23591E-5 40456 0 4.51162E-5
14-105196371-A-G p.Ser48Gly missense ADSSL1 2 80896 2.47231E-5 40448 0 4.93715E-6
14-105196378-A-G p.His50Arg missense ADSSL1 4 80864 4.94658E-5 40432 0 3.6951E-4
14-105196382-C-A p.Ser51Ser synonymous ADSSL1 1 80866 1.23661E-5 40433 0 2.80994E-5
14-105196391-T-G p.Ala54Ala synonymous ADSSL1 129 80826 0.00159602 40413 1 0.00357873
14-105196399-C-A p.Thr57Asn missense ADSSL1 1 80886 1.23631E-5 40443 0 NA
14-105196401-C-G p.Pro58Ala missense ADSSL1 2 80902 2.47213E-5 40451 0 NA
14-105196401-C-A p.Pro58Thr missense ADSSL1 1 80902 1.23606E-5 40451 0 3.56227E-5
14-105196402-C-G p.Pro58Arg missense ADSSL1 677 80896 0.00836877 40448 12 0.0203874
14-105196406-C-T p.His59His synonymous ADSSL1 3 80876 3.70938E-5 40438 0 1.10667E-4
14-105196418-C-T p.Ala63Ala synonymous ADSSL1 2 80868 2.47317E-5 40434 0 3.79235E-4
14-105196425-G-T p.Gly66Cys missense ADSSL1 1 80824 1.23726E-5 40412 0 NA
14-105196429-C-G p.Pro67Arg missense ADSSL1 1 80758 1.23827E-5 40379 0 6.24173E-6
14-105196431-A-C p.Thr68Pro missense ADSSL1 3 80746 3.71535E-5 40373 0 1.4218E-4
14-105196435-G-T p.Arg69Met missense ADSSL1 1 80692 1.23928E-5 40346 0 6.35098E-6
14-105196442-G-C p.Thr71Thr synonymous ADSSL1 1 80536 1.24168E-5 40268 0 NA
14-105196446-G-C p.Gly73Arg missense ADSSL1 3 80504 3.72652E-5 40252 0 1.92194E-5
14-105196452-G-T p.Glu75* stop_gained ADSSL1 1 80342 1.24468E-5 40171 0 NA
14-105196452-G-C p.Glu75Gln missense ADSSL1 1 80342 1.24468E-5 40171 0 NA
14-105196454-G-A p.Glu75Glu synonymous ADSSL1 1 80276 1.2457E-5 40138 0 5.33789E-5
14-105196459-C-T p.Ala77Val missense ADSSL1 1 80024 1.24963E-5 40012 0 NA
14-105196465-G-T p.Arg79Met missense ADSSL1 1 79880 1.25188E-5 39940 0 5.52547E-5
14-105196469-C-T p.Ser80Ser synonymous ADSSL1 11 79650 1.38104E-4 39825 0 2.24115E-4
14-105196477-C-G p.Ser83* stop_gained ADSSL1 1 79420 1.25913E-5 39710 0 NA
14-105196481-T-G p.Asn84Lys missense ADSSL1 1 79366 1.25999E-5 39683 0 NA
14-105196491-C-T p.His88Tyr missense ADSSL1 2 78968 2.53267E-5 39484 0 3.1904E-5
14-105196496-C-T p.Thr89Thr synonymous ADSSL1 5 78928 6.33489E-5 39464 0 6.25782E-4
14-105196502-G-C p.Leu91Leu synonymous ADSSL1 1 78796 1.2691E-5 39398 0 NA
14-105196510-G-A p.Arg94Lys missense ADSSL1 1 78712 1.27045E-5 39356 0 NA
14-105196514-TGCAGGAGCCGGATCCTTAACACCTGGAGGGGAGCGGGTGGGTGCGGTGGCGTACATCTGTAACTCCA-T p.Ala96_Arg107del splice_donor ADSSL1 1 78654 1.27139E-5 39327 0 NA
14-105196519-G-A p.Gly97Glu missense ADSSL1 3 78568 3.81835E-5 39284 0 8.2672E-5
14-105196521-G-A p.Ala98Thr missense ADSSL1 4 78502 5.09541E-5 39251 0 8.2421E-5
14-105196523-C-T p.Ala98Ala synonymous ADSSL1 2 78408 2.55076E-5 39204 0 NA
14-105196540-G-T p.Gly104Val missense ADSSL1 1 78088 1.28061E-5 39044 0 NA
14-105196541-A-C p.Gly104Gly synonymous ADSSL1 1 78042 1.28136E-5 39021 0 NA
14-105196544-G-A p.Gly105Gly synonymous ADSSL1 2 77972 2.56502E-5 38986 0 NA
14-105196552-T-C c.321+2T>C splice_donor ADSSL1 2 77672 2.57493E-5 38836 0 NA
14-105201349-T-C c.193-8T>C splice_region ADSSL1 1 80282 1.24561E-5 40141 0 NA
14-105201354-CA-C c.193-2delA splice_acceptor ADSSL1 1 80628 1.24026E-5 40314 0 2.40572E-5
14-105201355-AG-A c.193-1delG splice_acceptor ADSSL1 2 80672 2.47917E-5 40336 0 NA
14-105201356-G-C c.193-1G>C splice_acceptor ADSSL1 4 80728 4.95491E-5 40364 0 NA
14-105201358-G-A p.Gly65Glu missense+splice_region ADSSL1 1 80798 1.23765E-5 40399 0 3.18451E-5
14-105201359-G-A p.Gly65Gly splice_region+synonymous ADSSL1 2 80858 2.47347E-5 40429 0 8.01526E-6
14-105201365-C-G p.Asn67Lys missense ADSSL1 1 81122 1.23271E-5 40561 0 NA
14-105201366-A-G p.Asn68Asp missense ADSSL1 1 81218 1.23125E-5 40609 0 3.18512E-5
14-105201368-C-T p.Asn68Asn synonymous ADSSL1 5 81254 6.15354E-5 40627 0 1.04252E-4
14-105201369-G-A p.Ala69Thr missense ADSSL1 1 81244 1.23086E-5 40622 0 5.04541E-4
14-105201371-C-T p.Ala69Ala synonymous ADSSL1 3 81346 3.68795E-5 40673 0 8.67498E-5
14-105201372-G-A p.Gly70Ser missense ADSSL1 1 81382 1.22877E-5 40691 0 3.18451E-5
14-105201379-C-A p.Thr72Lys missense ADSSL1 1 81548 1.22627E-5 40774 0 1.20102E-5
14-105201379-C-T p.Thr72Met missense ADSSL1 3 81548 3.67881E-5 40774 0 6.06397E-5
14-105201380-G-A p.Thr72Thr synonymous ADSSL1 152 81536 0.00186421 40768 1 0.00388486
14-105201387-G-T p.Val75Leu missense ADSSL1 2 81696 2.4481E-5 40848 0 NA
14-105201390-G-C p.Asp76His missense ADSSL1 1 81736 1.22345E-5 40868 0 NA
14-105201395-GAA-G p.Lys78fs frameshift ADSSL1 1 81788 1.22267E-5 40894 0 4.00186E-6
14-105201405-G-A p.Asp81Asn missense ADSSL1 4 81812 4.88926E-5 40906 0 8.8199E-6
14-105201409-TC-T p.His83fs frameshift ADSSL1 2 81836 2.44391E-5 40918 0 3.56513E-5
14-105201410-C-A p.Phe82Leu missense ADSSL1 1 81864 1.22154E-5 40932 0 3.18552E-5
14-105201412-A-G p.His83Arg missense ADSSL1 4 81836 4.88782E-5 40918 0 1.27543E-4
14-105201420-C-T p.Pro86Ser missense ADSSL1 1 81798 1.22252E-5 40899 0 NA
14-105201421-C-T p.Pro86Leu missense ADSSL1 2 81788 2.44535E-5 40894 0 3.18492E-5
14-105201425-C-T p.Ser87Ser synonymous ADSSL1 78 81684 9.54899E-4 40842 0 0.00151057
14-105201426-G-C p.Gly88Arg missense ADSSL1 1 81672 1.22441E-5 40836 0 4.02178E-6
14-105201426-G-A p.Gly88Ser missense ADSSL1 2 81672 2.44882E-5 40836 0 6.37186E-5
14-105201427-GCAT-G p.Ile90del disruptive_inframe_deletion ADSSL1 1 81676 1.22435E-5 40838 0 2.01168E-5
14-105201429-A-C p.Ile89Leu missense ADSSL1 1 81668 1.22447E-5 40834 0 4.02262E-6
14-105201438-A-T p.Thr92Ser missense ADSSL1 2 81466 2.45501E-5 40733 0 NA
14-105201447-G-A p.Val95Met missense ADSSL1 3 81004 3.70352E-5 40502 0 3.25217E-5
14-105201448-T-C p.Val95Ala missense ADSSL1 1 80988 1.23475E-5 40494 0 2.2041E-5
14-105201451-C-A p.Ser96Tyr missense ADSSL1 1 80870 1.23655E-5 40435 0 8.21564E-6
14-105201452-C-T p.Ser96Ser synonymous ADSSL1 1 80840 1.23701E-5 40420 0 1.12362E-5
14-105201460-G-GCAACGGGGTGGTCATCCACTTGCCAGGCTTGTT c.295+1_295+2insCAACGGGGTGGTCATCCACTTGCCAGGCTTGTT splice_donor ADSSL1 1 80266 1.24586E-5 40133 0 NA
14-105201464-G-A c.295+5G>A splice_region ADSSL1 6 79940 7.50563E-5 39970 0 4.21092E-6
14-105204680-A-ACTCTGTCTCTCATGC c.296-17_296-3dupCTCTGTCTCTCATGC splice_acceptor ADSSL1 3 82950 3.61664E-5 41475 0 3.30589E-5
14-105204680-ACTCTGTCTCTCATGC-A c.296-17_296-3delCTCTGTCTCTCATGC splice_region ADSSL1 2 82950 2.41109E-5 41475 0 NA
14-105204706-C-G c.296-7C>G splice_region ADSSL1 1 83140 1.20279E-5 41570 0 NA
14-105204708-T-A c.296-5T>A splice_region ADSSL1 1 83138 1.20282E-5 41569 0 NA
14-105204717-C-T p.Asn100Asn synonymous ADSSL1 1 83174 1.2023E-5 41587 0 3.1839E-5
14-105204718-G-C p.Gly101Arg missense ADSSL1 2 83192 2.40408E-5 41596 0 NA
14-105204718-G-A p.Gly101Arg missense ADSSL1 1 83192 1.20204E-5 41596 0 1.27364E-4
14-105204733-T-C p.Leu106Leu synonymous ADSSL1 1 83204 1.20187E-5 41602 0 3.97735E-6
14-105204744-G-A p.Leu109Leu synonymous ADSSL1 1 83216 1.20169E-5 41608 0 NA
14-105204780-G-A c.358+5G>A splice_region ADSSL1 1 83108 1.20325E-5 41554 0 NA
14-105204783-C-T c.358+8C>T splice_region ADSSL1 13 83082 1.56472E-4 41541 0 3.50229E-4
14-105205659-C-T c.359-6C>T splice_region ADSSL1 6 81428 7.36847E-5 40714 0 3.19326E-4
14-105205660-C-T c.359-5C>T splice_region ADSSL1 4 81458 4.91051E-5 40729 0 6.81979E-5
14-105205668-TGAAGGACTGGGA-T p.Asp123_Lys126del conservative_inframe_deletion ADSSL1 1 81646 1.2248E-5 40823 0 NA
14-105205678-G-C p.Trp124Cys missense ADSSL1 17 81882 2.07616E-4 40941 0 4.79172E-4
14-105205695-T-C p.Ile130Thr missense ADSSL1 2 81884 2.44248E-5 40942 0 6.38692E-5
14-105205704-G-A p.Arg133Lys missense ADSSL1 1 81848 1.22178E-5 40924 0 4.22187E-6
14-105205708-C-A p.Ala134Ala synonymous ADSSL1 15 81820 1.83329E-4 40910 0 0.00201816
14-105205709-C-T p.His135Tyr missense ADSSL1 1 81830 1.22205E-5 40915 0 3.19142E-5
14-105205715-G-C p.Val137Leu missense+splice_region ADSSL1 6 81784 7.3364E-5 40892 0 1.57842E-4
14-105205719-C-T c.409+4C>T splice_region ADSSL1 1 81730 1.22354E-5 40865 0 3.19203E-5
14-105205720-G-A c.409+5G>A splice_region ADSSL1 3 81694 3.67224E-5 40847 0 4.36864E-5
14-105205993-A-T p.Gly127Gly splice_region+synonymous ADSSL1 65 78760 8.25292E-4 39380 0 0.006875
14-105205995-A-T p.Asp128Val missense ADSSL1 2 78940 2.53357E-5 39470 0 7.18081E-5
14-105205996-C-T p.Asp128Asp synonymous ADSSL1 2 79102 2.52838E-5 39551 0 4.46512E-6
14-105206021-A-G p.Met137Val missense ADSSL1 8 81240 9.84737E-5 40620 0 1.15403E-4
14-105206022-T-C p.Met137Thr missense ADSSL1 3 81314 3.6894E-5 40657 0 6.25E-4
14-105206037-C-T p.Ser142Phe missense ADSSL1 6 81984 7.3185E-5 40992 0 3.18593E-4
14-105206040-C-T p.Ser143Phe missense ADSSL1 2 82044 2.43772E-5 41022 0 1.20368E-5
14-105206051-C-T p.Leu147Leu synonymous ADSSL1 2 82252 2.43155E-5 41126 0 9.55779E-5
14-105206058-C-T p.Pro149Leu missense ADSSL1 1 82316 1.21483E-5 41158 0 2.23058E-4
14-105206061-C-T p.Ala150Val missense ADSSL1 2 82296 2.43025E-5 41148 0 NA
14-105206061-C-G p.Ala150Gly missense ADSSL1 1 82298 1.2151E-5 41149 0 NA
14-105206069-A-G p.Thr153Ala missense ADSSL1 1 82398 1.21362E-5 41199 0 3.59138E-5
14-105206074-G-C p.Trp154Cys missense ADSSL1 2 82490 2.42454E-5 41245 0 NA
14-105206077-C-T p.Pro155Pro synonymous ADSSL1 3 82558 3.63381E-5 41279 0 3.98861E-6
14-105206082-G-A p.Arg157Gln missense ADSSL1 4 82648 4.8398E-5 41324 0 2.39166E-5
14-105206083-A-G c.410-4A>G splice_region ADSSL1 1 82690 1.20934E-5 41345 0 NA
14-105206084-C-T p.Gln158* stop_gained ADSSL1 1 82740 1.20861E-5 41370 0 2.50317E-5
14-105206094-T-C p.Ile161Thr missense ADSSL1 1 82850 1.207E-5 41425 0 NA
14-105206105-C-G p.Ala143Gly missense ADSSL1 1 82924 1.20592E-5 41462 0 NA
14-105206110-G-A p.Asp145Asn missense ADSSL1 23 82932 2.77336E-4 41466 1 6.25E-4
14-105206112-C-T p.Arg183Trp missense ADSSL1 6 82918 7.23606E-5 41459 0 8.30468E-6
14-105206113-G-A p.Gly146Arg missense ADSSL1 2 82936 2.4115E-5 41468 0 3.98333E-6
14-105206116-C-G p.Leu147Val missense ADSSL1 1 82956 1.20546E-5 41478 0 NA
14-105206129-A-T p.Gln151Leu missense ADSSL1 2 82978 2.41028E-5 41489 0 NA
14-105206145-G-T p.Glu156Asp missense ADSSL1 4 82962 4.82148E-5 41481 0 1.66284E-5
14-105206156-A-C c.476+3A>C splice_region ADSSL1 5 82928 6.02933E-5 41464 0 6.37836E-5
14-105206161-T-G c.476+8T>G splice_region ADSSL1 1 82864 1.2068E-5 41432 0 NA
14-105206946-C-T p.Thr162Ile missense ADSSL1 1 83152 1.20262E-5 41576 0 NA
14-105206951-A-G p.Lys164Glu missense ADSSL1 1 83154 1.20259E-5 41577 0 5.03525E-4
14-105206955-A-G p.Lys165Arg missense ADSSL1 2 83166 2.40483E-5 41583 0 6.38366E-5
14-105206961-T-C p.Ile167Thr missense ADSSL1 2 83192 2.40408E-5 41596 0 8.24429E-6
14-105206963-G-A p.Gly168Arg missense ADSSL1 6 83200 7.21154E-5 41600 0 1.59106E-5
14-105206970-C-T p.Thr170Ile missense ADSSL1 13 83214 1.56224E-4 41607 0 9.56206E-5
14-105206973-A-G p.Tyr171Cys missense ADSSL1 2 83206 2.40367E-5 41603 0 3.97712E-6
14-105206990-C-T p.Arg177Trp missense ADSSL1 2 83226 2.4031E-5 41613 0 4.94544E-5
14-105206991-G-A p.Arg177Gln missense ADSSL1 5 83216 6.00846E-5 41608 0 6.25E-4
14-105206993-A-C p.Thr178Pro missense ADSSL1 1 83234 1.20143E-5 41617 0 3.18857E-5
14-105206999-C-T p.Leu180Phe missense ADSSL1 1 83220 1.20163E-5 41610 0 NA
14-105207002-C-T p.Arg181Cys missense ADSSL1 1 83210 1.20178E-5 41605 0 6.76095E-5
14-105207003-G-A p.Arg181His missense ADSSL1 28 83210 3.36498E-4 41605 0 0.00100705
14-105207005-A-C p.Ile182Leu missense ADSSL1 1 83204 1.20187E-5 41602 0 NA
14-105207008-T-C p.Cys183Arg missense ADSSL1 1 83210 1.20178E-5 41605 0 NA
14-105207010-C-T p.Arg221* stop_gained ADSSL1 5 83204 6.00933E-5 41602 0 2.14292E-4
14-105207018-T-C p.Leu186Pro missense ADSSL1 22 83192 2.64448E-4 41596 0 2.78419E-5
14-105207039-C-T p.Ser193Phe missense ADSSL1 47 83178 5.65053E-4 41589 0 6.69131E-4
14-105207040-C-T p.Ser193Ser synonymous ADSSL1 9275 83042 0.11169 41521 472 0.107912
14-105207049-C-T c.584+4C>T splice_region ADSSL1 1 83146 1.2027E-5 41573 0 NA
14-105207168-T-C c.585-8T>C splice_region ADSSL1 3 83078 3.61106E-5 41539 0 3.1902E-5
14-105207171-T-C c.585-5T>C splice_region ADSSL1 24 83082 2.88871E-4 41541 0 0.00105283
14-105207171-T-G c.585-5T>G splice_region ADSSL1 20 83084 2.4072E-4 41542 0 0.00135973
14-105207178-T-A p.Phe196Tyr missense+splice_region ADSSL1 1 83086 1.20357E-5 41543 0 2.78514E-5
14-105207179-C-G p.Phe196Leu missense ADSSL1 1 83096 1.20343E-5 41548 0 NA
14-105207185-C-T p.Asn198Asn synonymous ADSSL1 1 83078 1.20369E-5 41539 0 NA
14-105207194-C-G p.His201Gln missense ADSSL1 2 83094 2.40691E-5 41547 0 6.37633E-5
14-105207203-G-A p.Gln204Gln synonymous ADSSL1 1 83120 1.20308E-5 41560 0 3.97833E-6
14-105207205-C-T p.Ser205Leu missense ADSSL1 3 83128 3.60889E-5 41564 0 6.37592E-5
14-105207206-G-A p.Ser205Ser synonymous ADSSL1 7 83114 8.42217E-5 41557 0 3.18898E-5
14-105207214-C-T p.Pro208Leu missense ADSSL1 2 83114 2.40633E-5 41557 0 1.59128E-5
14-105207235-A-C p.Glu215Ala missense ADSSL1 2 83126 2.40599E-5 41563 0 NA
14-105207238-G-A p.Gly216Asp missense ADSSL1 1 83124 1.20302E-5 41562 0 1.19363E-5
14-105207254-C-G p.Leu221Leu synonymous ADSSL1 1 83122 1.20305E-5 41561 0 NA
14-105207259-T-C c.666+2T>C splice_donor ADSSL1 1 83104 1.20331E-5 41552 0 NA
14-105207263-G-GTCGGGGCC c.666+6_666+7insTCGGGGCC splice_region ADSSL1 1 83112 1.2032E-5 41556 0 NA
14-105207264-T-C c.666+7T>C splice_region ADSSL1 1 83098 1.2034E-5 41549 0 NA
14-105207265-C-T c.666+8C>T splice_region ADSSL1 7 83086 8.42501E-5 41543 0 8.24851E-6
14-105207447-C-G c.667-7C>G splice_region ADSSL1 49 83086 5.8975E-4 41543 0 0.00149806
14-105207447-C-T c.667-7C>T splice_region ADSSL1 1 83086 1.20357E-5 41543 0 3.46087E-5
14-105207465-G-A p.Glu226Glu synonymous ADSSL1 4 83084 4.8144E-5 41542 0 2.54988E-4
14-105207466-C-T p.Arg227Trp missense ADSSL1 2 83080 2.40732E-5 41540 0 9.56877E-5
14-105207467-G-A p.Arg227Gln missense ADSSL1 1 83100 1.20337E-5 41550 0 1.21859E-5
14-105207468-G-A p.Arg227Arg synonymous ADSSL1 1 83112 1.2032E-5 41556 0 1.61527E-5
14-105207478-A-G p.Met231Val missense ADSSL1 3 83110 3.60967E-5 41555 0 8.49387E-6
14-105207481-G-A p.Val232Ile missense ADSSL1 1 83112 1.2032E-5 41556 0 NA
14-105207484-C-T p.Arg233* stop_gained ADSSL1 1 83106 1.20328E-5 41553 0 1.20288E-5
14-105207493-GTTTAC-G p.Phe238fs frameshift ADSSL1 1 83126 1.20299E-5 41563 0 5.88998E-5
14-105207496-T-C p.Tyr237His missense ADSSL1 6 83134 7.21726E-5 41567 0 1.27518E-4
14-105207498-C-G p.Tyr237* stop_gained ADSSL1 1 83132 1.20291E-5 41566 0 NA
14-105207499-T-C p.Phe238Leu missense ADSSL1 1 83142 1.20276E-5 41571 0 1.68067E-5
14-105207504-G-A p.Met239Ile missense ADSSL1 1 83118 1.20311E-5 41559 0 3.18918E-5
14-105207519-C-T p.His244His synonymous ADSSL1 1 83046 1.20415E-5 41523 0 6.37389E-5
14-105207520-G-A p.Gly245Ser missense ADSSL1 3 83032 3.61306E-5 41516 0 6.37308E-5
14-105207521-G-GC p.Lys248fs frameshift ADSSL1 3 83006 3.6142E-5 41503 0 1.93893E-4
14-105207521-G-GCC p.Lys248fs frameshift ADSSL1 1 83016 1.20459E-5 41508 0 NA
14-105207523-C-G p.Pro246Ala missense ADSSL1 4 83038 4.81707E-5 41519 0 3.18796E-4
14-105207527-C-G p.Pro247Arg missense ADSSL1 5 83042 6.02105E-5 41521 0 1.59388E-4
14-105207527-C-A p.Pro247His missense ADSSL1 2 83042 2.40842E-5 41521 0 8.41751E-6
14-105207528-C-G p.Pro247Pro synonymous ADSSL1 173 83014 0.00208399 41507 0 0.0057983
14-105207528-C-A p.Pro247Pro synonymous ADSSL1 1 83024 1.20447E-5 41512 0 1.20193E-5
14-105207538-C-G p.Leu251Val missense ADSSL1 4 82980 4.82044E-5 41490 0 4.22569E-5
14-105207541-G-A p.Val252Met missense ADSSL1 3 82998 3.61454E-5 41499 0 1.69337E-5
14-105207545-AG-A p.Gly254fs frameshift ADSSL1 1 82944 1.20563E-5 41472 0 NA
14-105207547-G-A p.Gly254Ser missense ADSSL1 4 82928 4.82346E-5 41464 0 4.2551E-5
14-105207555-C-T p.Asn256Asn synonymous ADSSL1 176 82836 0.00212468 41418 0 0.00704935
14-105207556-G-A p.Ala257Thr missense ADSSL1 1 82792 1.20785E-5 41396 0 2.57954E-5
14-105207559-G-A p.Ala258Thr missense ADSSL1 1 82750 1.20846E-5 41375 0 6.04783E-5
14-105207568-G-A p.Asp261Asn missense ADSSL1 1 82648 1.20995E-5 41324 0 3.40362E-5
14-105207570-C-T p.Asp261Asp synonymous ADSSL1 1 82646 1.20998E-5 41323 0 NA
14-105207575-A-G p.Asp263Gly missense ADSSL1 1 82564 1.21118E-5 41282 0 NA
14-105207580-G-A p.Gly265Arg missense+splice_region ADSSL1 2 82418 2.42665E-5 41209 0 3.97664E-5
14-105207585-G-A c.793+5G>A splice_region ADSSL1 1 82308 1.21495E-5 41154 0 9.41593E-6
14-105207585-G-T c.793+5G>T splice_region ADSSL1 2 82308 2.4299E-5 41154 0 NA
14-105208186-G-A p.Gly265Gly splice_region+synonymous ADSSL1 1 82876 1.20662E-5 41438 0 7.98288E-6
14-105208188-C-A p.Thr266Asn missense ADSSL1 1 82892 1.20639E-5 41446 0 8.30993E-6
14-105208214-T-G p.Cys275Gly missense ADSSL1 3 82974 3.61559E-5 41487 0 2.48521E-5
14-105208220-G-C p.Val277Leu missense ADSSL1 1 82974 1.2052E-5 41487 0 NA
14-105208220-G-A p.Val277Met missense ADSSL1 4 82974 4.82079E-5 41487 0 5.03525E-4
14-105208221-T-C p.Val277Ala missense ADSSL1 1 82982 1.20508E-5 41491 0 NA
14-105208224-G-A p.Gly278Asp missense ADSSL1 1 83000 1.20482E-5 41500 0 1.59351E-5
14-105208225-C-T p.Gly278Gly synonymous ADSSL1 3 83000 3.61446E-5 41500 0 1.65596E-5
14-105208226-G-A p.Gly279Ser missense ADSSL1 1 82996 1.20488E-5 41498 0 6.37064E-5
14-105208233-G-A p.Cys281Tyr missense ADSSL1 1 83004 1.20476E-5 41502 0 7.96331E-6
14-105208234-C-G p.Cys281Trp missense ADSSL1 1 83002 1.20479E-5 41501 0 NA
14-105208236-C-T p.Thr282Met missense ADSSL1 6 83004 7.22857E-5 41502 0 0.00100705
14-105208236-C-A p.Thr282Lys missense ADSSL1 1 83004 1.20476E-5 41502 0 NA
14-105208237-G-A p.Thr282Thr synonymous ADSSL1 1 83000 1.20482E-5 41500 0 3.98168E-6
14-105208248-T-TCC p.Gln289fs frameshift ADSSL1 1 82990 1.20496E-5 41495 0 NA
14-105208250-C-A p.Pro287Thr missense ADSSL1 1 83014 1.20462E-5 41507 0 1.19412E-5
14-105208253-C-T p.Pro288Ser missense ADSSL1 1 83026 1.20444E-5 41513 0 5.03525E-4
14-105208255-G-A p.Pro288Pro synonymous ADSSL1 1 83016 1.20459E-5 41508 0 3.98057E-6
14-105208262-A-G p.Ile291Val missense ADSSL1 1 83028 1.20441E-5 41514 0 NA
14-105208263-T-C p.Ile291Thr missense ADSSL1 1 83026 1.20444E-5 41513 0 3.58175E-5
14-105208265-G-A p.Gly292Ser missense ADSSL1 361 83026 0.00434804 41513 9 0.00990761
14-105208270-C-T p.Asp293Asp synonymous ADSSL1 2 82992 2.40987E-5 41496 0 1.59307E-4
14-105208271-G-A p.Val294Met missense ADSSL1 2 83008 2.40941E-5 41504 0 4.96607E-5
14-105208279-C-T p.Gly296Gly synonymous ADSSL1 1 83002 1.20479E-5 41501 0 1.6556E-5
14-105208289-G-A p.Ala300Thr missense ADSSL1 2 82970 2.41051E-5 41485 0 NA
14-105208289-G-C p.Ala300Pro missense ADSSL1 1 82970 1.20525E-5 41485 0 NA
14-105208293-A-G p.Tyr301Cys missense ADSSL1 1 82970 1.20525E-5 41485 0 NA
14-105208297-C-G p.Thr302Thr synonymous ADSSL1 1 82940 1.20569E-5 41470 0 NA
14-105208301-C-T p.Arg304Cys missense ADSSL1 1 82924 1.20592E-5 41462 0 1.19532E-5
14-105208302-G-A p.Arg304His missense ADSSL1 19 82922 2.29131E-4 41461 0 1.59337E-4
14-105208306-G-T p.Val305Val synonymous ADSSL1 1 82920 1.20598E-5 41460 0 NA
14-105208309-CA-C p.Ile307fs frameshift ADSSL1 2 82886 2.41295E-5 41443 0 1.24362E-4
14-105208310-A-T p.Ile307Phe missense ADSSL1 1 82878 1.20659E-5 41439 0 NA
14-105208312-C-G p.Ile307Met missense ADSSL1 1 82858 1.20688E-5 41429 0 NA
14-105208313-G-A p.Gly308Arg missense ADSSL1 1 82848 1.20703E-5 41424 0 NA
14-105208324-C-A p.Pro311Pro synonymous ADSSL1 1 82784 1.20796E-5 41392 0 NA
14-105208324-C-T p.Pro311Pro synonymous ADSSL1 1 82784 1.20796E-5 41392 0 NA
14-105208327-C-T p.Thr312Thr synonymous ADSSL1 3 82712 3.62704E-5 41356 0 1.99693E-5
14-105208338-ACGTGAG-A p.Asn316fs frameshift ADSSL1 5 82596 6.05356E-5 41298 0 3.18695E-5
14-105208338-A-G p.Asn316Ser missense+splice_region ADSSL1 1 82596 1.21071E-5 41298 0 NA
14-105208338-A-T p.Asn316Ile missense+splice_region ADSSL1 1 82596 1.21071E-5 41298 0 8.33875E-6
14-105208339-C-T p.Asn316Asn splice_region+synonymous ADSSL1 2 82556 2.4226E-5 41278 0 3.18817E-5
14-105208340-G-A c.948+1G>A splice_donor ADSSL1 1 82530 1.21168E-5 41265 0 4.17167E-5
14-105208346-C-G c.948+7C>G splice_region ADSSL1 2 82404 2.42707E-5 41202 0 8.36288E-6
14-105209402-A-G c.949-2A>G splice_acceptor ADSSL1 1 82724 1.20884E-5 41362 0 NA
14-105209412-A-T p.Gly319Gly synonymous ADSSL1 1 82756 1.20837E-5 41378 0 NA
14-105209418-G-A p.Leu321Leu synonymous ADSSL1 1 82784 1.20796E-5 41392 0 1.66011E-5
14-105209420-T-C p.Leu322Pro missense ADSSL1 1 82772 1.20814E-5 41386 0 6.25E-4
14-105209422-C-T p.Gln323* stop_gained ADSSL1 18 82776 2.17454E-4 41388 0 6.78031E-5
14-105209428-C-T p.Arg325Cys missense ADSSL1 1 82768 1.2082E-5 41384 0 6.37064E-5
14-105209429-G-A p.Arg325His missense ADSSL1 1 82774 1.20811E-5 41387 0 1.19654E-5
14-105209430-C-T p.Arg325Arg synonymous ADSSL1 4 82762 4.83314E-5 41381 0 0.00201613
14-105209431-G-A p.Gly326Ser missense ADSSL1 2 82766 2.41645E-5 41383 0 4.97867E-5
14-105209436-C-T p.His327His synonymous ADSSL1 2 82772 2.41628E-5 41386 0 6.37064E-5
14-105209441-G-C p.Trp329Ser missense ADSSL1 156 82780 0.00188451 41390 0 0.00283548
14-105209441-G-A p.Trp329* stop_gained ADSSL1 1 82782 1.20799E-5 41391 0 3.18593E-5
14-105209447-T-C p.Val331Ala missense ADSSL1 1 82770 1.20817E-5 41385 0 2.48806E-5
14-105209468-G-A p.Arg338His missense ADSSL1 1 82736 1.20866E-5 41368 0 3.18756E-5
14-105209472-C-T p.Cys339Cys synonymous ADSSL1 2 82728 2.41756E-5 41364 0 2.79568E-5
14-105209473-G-A p.Gly340Ser missense ADSSL1 2 82740 2.41721E-5 41370 0 1.19794E-5
14-105209479-C-T p.Leu342Phe missense ADSSL1 6 82628 7.26146E-5 41314 0 4.98215E-5
14-105209481-C-T p.Leu342Leu synonymous ADSSL1 3 82618 3.63117E-5 41309 0 1.65959E-5
14-105209481-C-G p.Leu342Leu synonymous ADSSL1 3 82618 3.63117E-5 41309 0 NA
14-105209482-G-A p.Asp343Asn missense ADSSL1 6 82628 7.26146E-5 41314 0 8.39617E-5
14-105209486-T-C p.Leu344Pro missense ADSSL1 1 82682 1.20945E-5 41341 0 NA
14-105209489-T-G p.Met345Arg missense ADSSL1 1 82704 1.20913E-5 41352 0 NA
14-105209489-TGATTCTAA-T p.Leu347fs frameshift ADSSL1 1 82704 1.20913E-5 41352 0 NA
14-105209493-T-C p.Ile346Ile synonymous ADSSL1 1 82718 1.20893E-5 41359 0 NA
14-105209496-A-G p.Leu347Leu synonymous ADSSL1 25 82710 3.02261E-4 41355 0 5.22665E-4
14-105209504-C-T p.Ala350Val missense ADSSL1 1 82710 1.20904E-5 41355 0 1.65961E-5
14-105209506-C-T p.His351Tyr missense ADSSL1 2 82722 2.41774E-5 41361 0 1.20045E-5
14-105209507-A-C p.His351Pro missense ADSSL1 1 82712 1.20901E-5 41356 0 NA
14-105209509-A-G p.Met352Val missense ADSSL1 9 82708 1.08817E-4 41354 0 4.00365E-5
14-105209510-T-A p.Met352Lys missense ADSSL1 2 82700 2.41838E-5 41350 0 NA
14-105209518-G-A p.Gly355Arg missense ADSSL1 5 82644 6.05005E-5 41322 0 2.40769E-5
14-105209528-C-T p.Ala358Val missense+splice_region ADSSL1 67 82446 8.12653E-4 41223 0 0.00207072
14-105209529-G-A c.1073+1G>A splice_donor ADSSL1 4 82428 4.85272E-5 41214 0 2.09328E-4
14-105211143-C-T c.1074-6C>T splice_region ADSSL1 7 83238 8.40962E-5 41619 0 3.97972E-5
14-105211145-A-G c.1074-4A>G splice_region ADSSL1 2 83236 2.40281E-5 41618 0 8.26556E-6
14-105211146-C-T c.1074-3C>T splice_region ADSSL1 2 83248 2.40246E-5 41624 0 1.19386E-5
14-105211154-C-T p.Ala360Val missense ADSSL1 1 83282 1.20074E-5 41641 0 6.36699E-5
14-105211161-G-A p.Thr362Thr synonymous ADSSL1 1 83294 1.20057E-5 41647 0 1.65256E-5
14-105211177-G-A p.Asp368Asn missense ADSSL1 1 83294 1.20057E-5 41647 0 NA
14-105211177-G-T p.Asp368Tyr missense ADSSL1 2 83294 2.40113E-5 41647 0 2.47852E-5
14-105211180-G-A p.Val369Ile missense ADSSL1 6 83296 7.20323E-5 41648 0 6.25E-4
14-105211180-G-C p.Val369Leu missense ADSSL1 1 83296 1.20054E-5 41648 0 1.65237E-5
14-105211200-C-T p.Val375Val synonymous ADSSL1 8 83276 9.60661E-5 41638 0 6.36623E-5
14-105211202-G-A p.Gly376Asp missense ADSSL1 5 83280 6.00384E-5 41640 0 2.47958E-5
14-105211221-C-T p.Asn382Asn synonymous ADSSL1 6858 82970 0.0826564 41485 476 0.133455
14-105211225-A-G p.Lys384Glu missense ADSSL1 1 83200 1.20192E-5 41600 0 NA
14-105212433-C-T c.-151C>T 5_prime_UTR_premature_start_codon_gain ADSSL1 3 48854 6.14075E-5 24427 0 1.27494E-4
14-105212434-G-A c.-150G>A 5_prime_UTR_premature_start_codon_gain ADSSL1 5 49534 1.00941E-4 24767 0 0.00125786
14-105212498-C-T c.-86C>T 5_prime_UTR_premature_start_codon_gain ADSSL1 3 72194 4.15547E-5 36097 0 6.37064E-5
14-105212514-C-T c.-70C>T 5_prime_UTR_premature_start_codon_gain ADSSL1 3 76566 3.91819E-5 38283 0 NA
14-105212558-G-A c.-26G>A 5_prime_UTR_premature_start_codon_gain ADSSL1 26 81836 3.17709E-4 40918 0 0.0012346
14-105212563-CT-C c.1172-8delT splice_region ADSSL1 1 82014 1.2193E-5 41007 0 NA
14-105212570-C-T c.1172-3C>T splice_region ADSSL1 4 82302 4.86015E-5 41151 0 2.56288E-5
14-105212599-G-A p.Glu400Lys missense ADSSL1 1 82766 1.20823E-5 41383 0 1.9927E-5
14-105212615-C-T p.Thr405Met missense ADSSL1 2 82882 2.41307E-5 41441 0 3.18613E-5
14-105212616-G-A p.Thr405Thr synonymous ADSSL1 2 82848 2.41406E-5 41424 0 1.66572E-5
14-105212616-G-C p.Thr405Thr synonymous ADSSL1 1 82848 1.20703E-5 41424 0 3.98324E-6
14-105212632-G-T p.Ala411Ser missense ADSSL1 13 82850 1.5691E-4 41425 0 5.17759E-5
14-105212633-C-G p.Ala411Gly missense ADSSL1 2 82854 2.41388E-5 41427 0 NA
14-105212643-A-G p.Thr414Thr synonymous ADSSL1 10 82852 1.20697E-4 41426 0 0.001875
14-105212646-C-T p.Gly415Gly synonymous ADSSL1 70 82798 8.45431E-4 41399 0 0.0075
14-105212647-G-T p.Ala416Ser missense ADSSL1 1 82796 1.20779E-5 41398 0 7.96597E-6
14-105212650-A-T p.Arg417Trp missense ADSSL1 3 82828 3.62196E-5 41414 0 3.18654E-5
14-105212654-G-T p.Arg418Met missense ADSSL1 1 82840 1.20715E-5 41420 0 NA
14-105212667-G-T p.Leu422Leu synonymous ADSSL1 1 82792 1.20785E-5 41396 0 4.16826E-5
14-105212683-A-G p.Asn428Asp missense ADSSL1 1 82710 1.20904E-5 41355 0 6.37105E-5
14-105212688-C-T p.Tyr429Tyr synonymous ADSSL1 1 82700 1.20919E-5 41350 0 3.98645E-6
14-105212689-A-G p.Ile430Val missense ADSSL1 1 82698 1.20922E-5 41349 0 8.36834E-6
14-105212692-C-T p.Arg431Cys missense ADSSL1 30 82668 3.62897E-4 41334 1 0.0010101
14-105212693-G-A p.Arg431His missense ADSSL1 1 82634 1.21016E-5 41317 0 5.05051E-4
14-105212710-G-A p.Val437Met missense ADSSL1 14 82394 1.69915E-4 41197 0 5.04541E-4
14-105212716-G-A p.Val439Ile missense ADSSL1 1 82276 1.21542E-5 41138 0 0.00125313
14-105212718-C-T p.Val439Val synonymous ADSSL1 2 82170 2.43398E-5 41085 0 NA
14-105212723-G-C c.1321+1G>C splice_donor ADSSL1 1 82068 1.2185E-5 41034 0 8.02858E-6
14-105212723-G-A c.1321+1G>A splice_donor ADSSL1 3 82068 3.65551E-5 41034 0 2.00715E-5
14-105212724-T-C c.1321+2T>C splice_donor ADSSL1 1 82004 1.21945E-5 41002 0 8.63871E-6
14-105213255-T-C p.Val47Ala missense+splice_region ADSSL1 1 83080 1.20366E-5 41540 0 3.18431E-5
14-105213257-T-C p.Cys48Arg missense+splice_region ADSSL1 1 83118 1.20311E-5 41559 0 NA
14-105213263-A-G p.Ile50Val missense ADSSL1 1 83168 1.20239E-5 41584 0 1.19312E-5
14-105213265-AAC-A p.Thr51fs frameshift ADSSL1 24 83174 2.88552E-4 41587 0 1.7101E-4
14-105213279-C-T p.Ala55Val missense ADSSL1 1 83222 1.20161E-5 41611 0 NA
14-105213289-C-A p.Val441Val splice_region+synonymous ADSSL1 1 83260 1.20106E-5 41630 0 1.98834E-5
14-105213291-A-G p.Lys442Arg missense ADSSL1 1 83252 1.20117E-5 41626 0 NA
14-105213298-T-A p.Val444Val synonymous ADSSL1 1 83264 1.201E-5 41632 0 NA
14-105213321-C-T p.Ser452Leu missense ADSSL1 3 83248 3.60369E-5 41624 0 1.11347E-4
14-105213322-G-A p.Ser452Ser synonymous ADSSL1 4 83250 4.8048E-5 41625 0 3.18512E-5
14-105213329-CAGCTGTTTTAGTCACAGA-C p.Gln455_Ter458delins??? stop_lost ADSSL1 1 83228 1.20152E-5 41614 0 NA
14-105213330-A-G p.Gln455Arg missense ADSSL1 9 83228 1.08137E-4 41614 0 NA
14-105213338-T-G p.Ter458Gluext*? stop_lost ADSSL1 1 83196 1.20198E-5 41598 0 NA